Elucidation of  Antioxidant and Neuroprotective Potential of Fucoxanthin Isolated from Brown Seaweed Sargassum oligocystum

doi:10.21203/rs.3.rs-2721377/v1

Download PDF

Research Article

Elucidation of Antioxidant and Neuroprotective Potential of Fucoxanthin Isolated from Brown Seaweed Sargassum oligocystum

https://doi.org/10.21203/rs.3.rs-2721377/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Fucoxanthin belonging to the carotenoid family has different bioactive properties as anti-oxidant, anti-obesity, anti-diabetic, and anti-cancer effects. This study presents the results of the extraction and purification of fucoxanthin from Sargassum olygocystum Montagne, 1845 using thin-layer chromatography, column chromatography, and high-performance liquid chromatography. Furthermore, this study demonstrated the antioxidant activities, expression of antioxidant enzymes, and inhibition of acetylcholinesterase (AChE) of fucoxanthin. The chemical structure, molecular formula (C₄₂H₅₈O₆), and molecular weight (658) of fucoxanthin were determined by nuclear magnetic resonance spectroscopy. Fucoxanthin isolated from S. olygocystum showed no cytotoxic effects, moreover, it showed potent antioxidant activity as assessed by the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method (with an IC₅₀ value of 3.42 ± 0.15 mg mL^− 1), and AchE inhibitory activity (with an IC₅₀ value of 130.12 ± 6.65 µg mL^− 1). At concentrations of 50 and 100 µg mL^− 1, fucoxanthin protected against amyloid β-protein fragment 25–35 - induced neurotoxicity on the C6 neuronal cell line with the survival of C6 cells higher than 81.01 and 80.98%, respectively, compared to the control group (59%). Moreover, antioxidant enzyme activity and quantitative PCR analysis revealed that the neuroprotective effect of fucoxanthin, was possibly due to not only regulation of gene expression of antioxidant enzyme (CAT and GPx), ER pathway (caspase-3 and Bax) but also promoting expression of genes involved in PI3K/Akt signaling (GSK-3β), autophagy (p62 and ATG5) and the biosynthesis of ACh (VAChT and ChAT). Therefore, fucoxanthin extracted from the Sargassum olygocystum is a potential feedstock source for the production of health foods with neuroprotective effects.

Alzheimer

Antioxidant

Acetylcholinesterase inhibitory

β-amyloid protein fragment

Fucoxanthin

Sargassum olygocystum

Seaweed is one of the world’s important marine organisms, with significantly high species diversity and it is prized for its nutritional and health benefits (Ranga Rao and Ravishankar 2022a). For recent decades, precious marine resource has been cultivated and harvested for food globally. In 2018, 50 countries are actively involved in seaweed farming accounting for 97.1% by volume, out of a total of 32.4 million tons of wild-harvested and cultivated seaweed (FAO 2020; Chopin and Tacon 2021). Seaweeds are classified into three main groups including red (Rhodophyta), brown (Phaeophyceae) and green (Chlorophyta) based on the pigments in their chloroplasts (Deepika et al. 2022a, b). At present, about 10 species of seaweed are widely cultivated among more than 200 known commercial seaweed species. Prominent ones include red seaweeds (Eucheuma spp., Kappaphycus alvarezii, Gracilaria spp., Pyropia (Porphyra) spp.); brown seaweeds (Saccharina japonica, Undaria pinnatifida, Sargassum fusiforme); and green seaweeds (Enteromorpha clathrata, Monostroma nitidum, Cauleurpa spp.) (FAO 2018). Seaweed farming contributes significantly to the economy of the sea by employing millions of people, especially in Asian countries (Sugumaran et al. 2022). Various industries and farming communities are employed in seaweed cultivations around the world (Wang et al, 2020; Chen et al, 2020; Felaco et al. 2020; Padam and Chye 2020).

Seaweeds are one of the most abundant and promising sources of bioactive substances including polysaccharides, unsaturated fatty acids, phenols, peptides, terpenoids, etc., with unique structures and properties (Ranga Rao and Ravishankar 2022b). They have been reported as having potential anti-oxidant, anti-viral, anti-coagulant, anti-bacterial, and anti-cancer properties (Lakshminarayana et al. 2022). Many active substances found in brown seaweeds, red seaweeds, and green seaweeds are used in agriculture, food, and medicinal applications (Alghazwi et al. 2016; Zhang et al. 2022). Fucoxanthin is an important carotenoid present in both seaweeds such as Undaria, Laminaria, Eisenia, Sargassum, Dictyota, Fucus, Myagropsis, and in microalgae such as Phaeodactylum, Cylindrotheca, Isochrysis, Cyclotella, Nitzschia, Prymnesium, Chaetoceros, Odontella (Oliyaei et al. 2023). This pigment contains an unusual allenic bond, 5,6-monoepoxide group, and conjugated carbonyl groups in the polyene chain with several pharmacological activities including anti-obesity, anti-diabetic, anti-oxidant, anti-inflammatory, anti-cancer, hepatoprotective, skin protective, anti-angiogenic, cerebrovascular, bone-protective, ocular-protective, cardiovascular-protective and anti-malarial activities. Therefore, fucoxanthin has the potential to develop as a promising nutritional and medicinal constituent of food for human health.

Cell degeneration is the main cause of diseases in the human body due to the excessive generation of highly reactive free radicals (Hileman et al. 2004). The decreasing anti-oxidant levels in the body may increase the risk of cell damage. The harmful effects of some of the oxidative reactions can be prevented by supplementing with antioxidants found in foods and herbs (Schramm et al. 2003; Conforti et al. 2008). Antioxidant compounds prevent the growth of free radicals to protect the cells. Recently, Sun et al. (2020) demonstrated that fucoxanthin is a potential therapeutic agent in the anti-inflammatory, anti-oxidant, and neurotoxic induced by amyloid β protein fragment 1–42 (Aβ_1-42).

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the ARE (Antioxidant responsive element) and promotes the redox state of the cell under harmful stresses (Yan et al. 2008). Under basal conditions, Nrf2 is localized in the cytoplasm and anchored by its inhibitor, Kelch-like ECH-associated protein 1 (Keap1) (Kobayashi et al. 2004). However, under conditions of oxidative or xenobiotic stress, Nrf2 dissociates from Keap1, translocates into the nucleus, and regulates the expression of anti-oxidant genes such as heme oxygenase-1 (HO-1) and NADPH (nicotinamide adenine dinucleotide phosphate): quinine oxidoreductase-1 (NQO-1) via interaction with the ARE. Recent reports showed that fucoxanthin inhibits apoptosis and oxidative stress, and induces autophagy through Nrf2 (Pajares et al. 2016). Moreover, PLGA-PEG (Poly lactide-co-glycolide (PLGA) with poly ethylene glycol (PEG)) nanoparticles containing fucoxanthin promoted the antioxidant activity by elevating superoxide dismutase (SOD), and catalase (CAT) in the brain (Yang et al. 2021a). In addition, fucoxanthin has also been reported to indirectly activate Nrf2/ARE pathway via Akt (protein kinase B, PKB) pathways. Akt is a classic signal-transducing protein that can activate the primary cellular defense mechanism Nrf2/ARE in cells (Rodriguez et al. 2013). Zheng et al. (2014) found that in human keratinocytes, fucoxanthin increased the level of phosphorylated Akt and elevated the nuclear level of Nrf2. Furthermore, LY294002 (2-(4-morpholinyl)-8-phenyl-chromone), a specific inhibitor of Akt, significantly suppressed the active form of Akt, which resulted in the reduction of Nrf2 accumulation (Zheng et al. 2014). However, a probable mechanism by which fucoxanthin regulates Nrf2/ARE pathway has not been fully explained.

Moreover, the relationship between the phosphatidylinositol 3-kinase (PI3K)/Akt signaling and the metabolism of Aβ oligomers has been reported by various authors (Ren 2019; Choi and Koh 2016; Ryu 2016). Accumulated Aβ inhibits the propagation of the PI3K/Akt signaling and it increases the activity of this protein kinase in the neurons by eliminating the suppressive effect of this pathway on GSK-3β (glycogen synthase kinase − 3ß). Once GSK-3β is activated, it would eventually increase the apoptotic signals and diminish the survival capacity of the cells. This enzyme also has a deep role in the regulation of Tau (microtubule-associated protein) hyper-phosphorylation. Indeed, the activation of the PI3K/Akt signaling axis in neurons could reduce hyper-phosphorylation of Tau through suppression of GSK-3β activity (O’Neill 2013; O’Neill et al. 2012; Koh and Lo 2015). Lin et al. (2017) reported that pretreatment with fucoxanthin significantly prevented Aβ oligomer-induced alteration of the PI3K/Akt and ERK pathways in SH-SY5Y cells.

Recently, reports have shown that many drugs can provide neuroprotection in brain injury models through the activation of autophagy (Zhang et al. 2017). During the process of autophagy, Beclin-1 is necessary for the recruitment of other Atg proteins and LC3 is essential for autophagy formation. P62 (sequestosome-1/A170/Zeta-interacting protein) is a selective substrate of autophagy and serves as a common readout of autophagic activity. Zhang et al. (2017) suggested that fucoxanthin suppressed traumatic brain injury (TBI)-induced apoptosis and oxidative stress via activation of autophagy by increased expression of two important autophagic genes Beclin-1, LC3-II and decreased expression of p62.

The synthesis, storage, and hydrolysis of acetylcholine require the expression of several specialized proteins, including choline acetyltransferase (ChAT) and the vesicle acetylcholine (ACh) transporter (VAChT). ACh is packaged into the secretory vesicles by a specific transporter protein VAChT using an exchange of protons (H⁺) (Ferreira-Vieira et al. 2016). Most cholinergic neurons in the brain, spinal cord, and neuromuscular junction (NMJ) with skeleton muscle express VAChT (Ferreira-Vieira et al. 2016). Alteration of VAChT expression has consequences on the concentration of ACh loaded in the secretory vehicle, thus indirectly maintaining the neurotransmitter release. Dysregulation of VAChT has been reported in several diseases like AD (Efange et al. 1997). ChAT is responsible for the biosynthesis of ACh. The ACh content in cells is proportional to the expression of ChAT within the cells (Fujii et al. 2017). This enzyme is synthesized in the perikaryon of cholinergic neurons and is under the control of multiple regulatory elements (Bellier and Kimura 2011). Chen et al. (2021) reported that carotenoids as astaxanthin treatment in ferrous amyloid buthionine (FAB)-infused rats decreased neuroinflammation and restored the expression of ChAT in the cholinergic neuron of medical septal (MS) nucleus and cholinergic fibers in the hippocampal CA1 region. It also partly recovered the spine loss on hippocampal CA1 pyramidal neurons and ameliorated the behavioral deficits in AD-like rats.

In Vietnam, 827 species of seaweeds have been identified. Of which, there were 412 species of red seaweeds (Rhodophyta), 180 species of green seaweeds (Chlorophyta), 147 species of brown seaweeds (Ochrophyta-Phaeophytaceae) and 88 species of cyanobacteria (Cyanophyta) (Phang et al. 2016; Dang et al. 2019, Dang and Ha 2022). Sargassum is a genus of brown seaweed with great economic value due to the large amounts of alginate in the cell wall. South Central region is the most diverse zone with 75% of species recorded from the survey areas (Nguyen Tan Phong and Huynh Van Tien 2019). For a long time, Vietnamese seaweed has been used as a health food, supplementary feed for domestic animals, raw materials for industry, biofertilizer, biofuel as well as a source of new materials and bioactive substances/extracts (Dang et al. 2007; Dang et al. 2019, Dang and Ha 2022). So far, Vietnam has announced 73 different species of Sargassum and some species including Sargassum olygocystum Montagne, 1875 have large reserves for exploitation of biologically active substances. Therefore, fucoxanthin isolated from Sargassum seaweed species has practical significance and is highly feasible in exploiting substances with neuroprotective and memory-enhancing effects. This paper studied the extraction and purification of fucoxanthin from Sargassum olygocystum Montagne, 1875 and evaluated its neuroprotective ability through anti-oxidant and acetylcholinesterase (AChE) inhibitory activity and the protection of the cell against cytotoxity in the C6 Alzheimer’s disease cell model induced by H₂O₂ or Aβ_25-35 in vitro. The obtained results have proven that fucoxanthin isolated from S. olygocystum of Vietnam can be used in functional food applications for human health benefits.

Materials

Nine species of seaweed belonging to the genus Sargassum collected from Khanh Hoa, Ninh Thuan, Thua Thien Hue in 2021 and 2022 are presented in Table 1.

Cell Culture and Treatment

C6 rat glial cells (ATCC, CCL-107™) were obtained from Dr. Duong Hoang Nguyen, Center for Soft Matter and Biological Physics, Center for high technology development, Vietnam Academy of Science and Technology. The cells were cultured in Dulbecco’s Minimum Essential Medium (DMEM)/high glucose supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin/streptomycin under 5% CO₂ at 37°C.

Chemicals

Standard fucoxanthin (F6932; Sigma-Aldrich, Singapore); 5-5’-dithiobis-2-nitrobenzoic acid (DTNB) (Sigma-Aldrich, Singapore); acetylthiocholine iodide (ACTI) (SigmaAldrich, Singapore); DPPH (2,2-diphenyl-1-picrylhydrazyl, purity 95%, Alfa Aesar, Japan); 3-4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT, Invitrogen, USA), Aβ_25-35 (purity ≥ 97%, No. A.4559; Sigma, USA), Galantamine hydrobromide (Sopharma AD, Bulgaria). Chemicals used for cell culture: Fetal bovine serum (FBS), penicillin, and streptomycin (Invitrogen, USA); Dulbecco’s Modified Eagle Medium (DMEM)/high glucose, and other common chemicals were used in this study.

Methods

Extraction of fucoxanthin

The extraction of fucoxanthin was performed according to the procedure described by Haugan et al. (1992). Weighed 0.5 g (m1) of sample and transferred into a dark bottle. Samples mixed with 0.6 mL of 90% acetone, shaken well, and soaked for 10-20 min. The obtained extract (green color) and transferred to another dark bottle. The residue was further extracted in 0.6 mL acetone for 10-20 min. The extraction was repeated until the extract became colorless. The volume of the extract mixture was measured accurately. n-Hexane and water were added to the extract with the following ratio: extract: n-hexane: water as 3:1:1 (v/v/v). The mixture was shaken well and layered on a separatory funnel for 10 min. The mixture was divided into two phases: the upper phase contained n-hexane, the lower phase, acetone and water. The upper phase (n-hexane) was collected and the lower phase was removed. The upper phase was washed with 80% methanol according to the methanol: n-hexane ratio of 1:1 (v/v). This process was repeated 2-3 times. n-Hexane phase was collected completely. Rotary evaporation at 70°C was used to remove the solvent to obtain fucoxanthin (m2).

The fucoxanthin content was calculated according to the formula:

%F = m2/m1*100

Where: m1 is the initial biomass mass, m2 is the mass of obtained fucoxanthin.

Preparation of methanol extract

S. olygocystum (100 g) was extracted 4 times each with 300 mL of methanol (MeOH) at room temperature, each time using an ultrasonic bath (BioBase, ultrasonic power 80 w, ultrasonic frequency 4.7 kHz) for 15 minutes and then resting for 15 minutes with completion of extraction in 2 h. Extracts obtained each time were pooled and solvent was evaporated using rotary evaporator (provide the Instrument details about the company and manufacture details) under reduced pressure at 37 °C to obtain 2.04 g of methanol extract.

Isolation of fucoxanthin

The dry brown algae S. olygocystum (200 g) were ground and extracted with acetone using sonication at room temperature (4 times, 600 mL of acetone and 30 min for each time). The combined extracts were evaporated in vacuo at 37°C to obtain the total acetone extract (3.78 g), which was subjected to a silica gel column, eluted with a n-hexane/acetone gradient system (0® 50% acetone, v/v) to get the crude fucoxanthin fraction. The crude fucoxanthin fraction (150 mg) was further purified by Sephadex LH-20 column using CH₂Cl₂/MeOH (1:4, v/v) as eluents to obtain fucoxanthin (1; 13.8 mg).

Column chromatography method

Fucoxanthin (1) was isolated using a silica gel 60 column, particle size 0.040-0.063 mm (230 - 400 Mesh) of Merck and Sephadex LH-20 (Sigma), and eluted with the mixture of n-hexane/acetone, dichloromethane/methanol solvents.

Thin layer chromatography (TLC)

Crude fucoxanthin was separated on a 10 x 8 cm TLC. TLC was performed using Merck pre-coated Silica gel 60 F254 aluminum sheets (layer thickness 0.2 mm). The mobile phase was consisted of chloroform: methanol in the ratio of 98: 2 (v/v). The bands on the chromatographic plate were detected by spraying with 10% H₂SO₄ solution and drying on an alcohol lamp.

Determination of fucoxanthin content and purity

Fucoxanthin content and purity was analyzed by high performance liquid chromatography (HPLC), Shimazu LC 10ADVP, Japan. The system is equipped with Column: Symmetry® C18, 5µm, 100A° Column (4.6mm x 250mm Column); Part Number: WAT054275, Made in Ireland. The mobile phase comprised acetonitrile/methanol (1: 9, v/v) at a flow rate of 0.5 mL min^-1. Fucoxanthin was detected using a PDA probe (Shimazu, Japan) at 450 nm. The retention time of samples containing fucoxanthin was compared with that of standard fucoxanthin. The fucoxanthin content of the sample was quantified from the peak area using standard calibration curve.

Determination of fucoxanthin structure:

The structure of fucoxanthin was determined by nuclear magnetic resonance (NMR) spectra recorded on a Bruker Avance Neo 600 MHz spectrometer with CDCl₃ as solvent and TMS as internal standard. ¹H NMR spectra was measured at 600 MHz and ¹³C was measured at 150 MHz at the Institute of Chemistry, Vietnam Academy of Science and Technology. The structure of fucoxanthin was determined by comparing the NMR data with the published standard (Yan et al. 1999).

DPPH assay:

The 2, 2-diphenyl-1-picrylhydrazyl (DPPH) assay was performed according to the procedure described by Xiao et al. (2020). The absorbance of the reaction mixtures was measured at the wavelength of 517 nm using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The scavenging effect on the DPPH inhibition as a percentage (%) was calculated according to the equation:

% Inhibition = [(A⁰ - A¹)/A⁰] x 100

Where A⁰ is the absorbance of the DPPH solution in methanol, and A¹ is the absorbance of the samples. IC₅₀ values calculated denote the concentration of the sample of fucoxanthin and fucoxanthin isolated from S. olygocystum (denoted by FS) to decrease the absorbance at the wavelength of 517 nm by 50% and are calculated based on the standard curve of y = ax + b. The IC₅₀value is inversely proportional to the free radical scavenging activity/antioxidant property of the sample. Ascorbic acid (at concentrations of 4, 20, and 100 μg mL^-1) was used as the positive control. All experiments were performed in triplicate.

AChE inhibitory activity assay

This test is performed according to the method of Ellman et al. (1961). Inhibition of AChE activities by FS was analyzed by using Acetylcholinesterase Inhibitor Screening Kit (MAK324, Sigma, USA) as the manufacturer’s instruction provided. Galantamine (at concentrations of 4, 20, 100, and 500 µg mL^-1) which is used to treat Alzheimer's disease was used as a positive control. Evaluation of AChE activity was based on the measurement of the absorbance of the FS or galantamine at a wavelength of 412 nm by using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA). All experiments were performed in triplicate. The results were given as IC₅₀. The percentage inhibition of AchE activity (I %) was calculated as follows:

I (%) = (1 – DA_{Test Cpd} /DA_{No Inhibitor}) x 100%

Where: I (%): Percentage of AChE inhibition; DA_{Test Cpd}: Change in the A_412nm value of a sample well at 0 min and at 10 min; DA_{No Inhibitor}: Change in the A_412nm value of the wells with no Inhibitor control at 0 min and 10 min.

Cell culture and treatment

C6 rat glial cells (ATCC, CCL-107™) were cultured in Dulbecco’s Minimum Essential Medium (DMEM)/high glucose supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin/streptomycin under 5% CO₂ at 37 °C.

For the cell viability test, C6 cells were cultured in DMEM/high glucose in a 96-well culture plate at a cell density of 0.5 x 10⁵ cells well^-1 for 24 h. After that, the cells were incubated with FS at different concentrations of 1, 10, and 100 μM for 24h. Afterwards, cell viability was determined by using a 3-4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT) assay.

For assessment of protective ability against oxidative stress induced by H₂O₂ or FS, C6 cells were cultured in DMEM/high glucose in 96-well culture plate at a density of 0.5 x 10⁵ cells well^-1 for 24 h. After that, the cells were incubated with FS at different concentrations of 1, 10, and 100 μM for 24h or ascorbic acid (20 µg mL^-1) as a positive control for another 24 h, followed by 1 h being incubated with H₂O₂ solution (10 mM). The cytoprotective effect of FS samples against oxidative stress induced by H₂O₂ on C6 cells was indicated by cell survival rate using the MTT assay method.

For assessment of neuroprotection against Aβ_25-35-induced cytotoxicity by FS, C6 cells were cultured 24 h in DMEM/high glucose in a 96-well culture plate at a density of 0.5 x 10⁵ cells well^-1. After that, the cells were incubated with FS at different concentrations of 1, 10, and 100 μM for 24h or galantamine (0.1 µg mL^-1; Sopharma AD, Bulgaria) as a positive control for another 24 h, followed by 24 h being incubated with protein Aβ_25-35 (20 μM) (Yu et al. 2020). The experiment consists of 3 groups: the control group (EtOH - Aβ_25-35); the model group (EtOH + Aβ_25-35); experimental group (FS or galantamine + Aβ_25-35). Each experiment was performed in triplicate. Cell viability was determined using the MTT assay method.

MTT assay

After treatment, C6 cells were incubated with 5 μL of MTT solution (5 mg mL^-1) at 37°C, 5% CO₂ for 4 h. After 4 h incubation, current media were removed and the purple MTT-formazan crystals were dissolved by adding 100 μL DMSO to each well. The absorbance was measured at 570 nm by using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA). In this experiment, each concentration was performed in triplicate. The cell survival rate was calculated as follows:

Cell survival rate (%) = (A¹/A⁰) x 100

Where A⁰ is the absorbance of control at the wavelength of 570 nm and A¹ is the absorbance of the sample at 570 nm. All experiments were performed in triplicate.

Measurement of antioxidant enzymes

C6 cells after being incubated with FS at different concentrations of 50 and 100 μM for 24 h or ascorbic acid (20 µg mL^-1) were washed twice by phosphate-buffered saline (PBS, pH 7.4), cells lysed, ultrasonic extracted, and centrifuged at 12.000 rpm min^-1 for 10 min at 4°C. The suspension was used to identify the activity of enzyme SOD, CAT, and glutathione peroxidase (GPx) as described by Weydert et al. (2010). The total amount of protein was determined by Bradford protein assay (Bio-Rad, Hercules, CA, USA) for normalization (Bradford 1976).

Real-time polymerase chain reaction (qPCR)

Total RNA was extracted from C6 using TRIzol™ Reagent (Invitrogen, Singapore) according to the manufacturer's instructions. Quantitative real-time PCR was performed in the MyGo Pro real-time PCR instrument (IT-IS Life Science Ltd., Dublin, Republic of Ireland) using a LunaÒUniversal One-Step RT-qPCR Kit (New England BioLabs Inc., UK). The primer sequences were shown in Table 2. The expression levels of target genes were normalized to that of β-actin by the normalization of expression (CT) method according to the guidelines of the manufacturer.

Statistical Analysis

Data were expressed as the mean ± standard error of the mean (SEM). Statistically significant differences were evaluated using Student's t test. Differences were considered statistically significant at p < 0.05.

Screening of species of the Sargassum genus with the potential to accumulate fucoxanthin

The screening experiment of nine seaweed species of the genus Sargassum rich in fucoxanthin collected at different locations in Thua Thien Hue, Khanh Hoa, and Ninh Thuan, Vietnam at different times (2021-2022) is presented in Table 1.As results shown in Table 3, various species of Sargassum can accumulate fucoxanthin ranging from 3.82 to 2927.98 mg g^-1 on a dry weight basis. S. oligocystum harvested from Khanh Hoa during 15-17 Jan 2022 had the highest fucoxanthin accumulation capacity of 2927.98 mg g^-1 dry cell weight (DCW). Therefore, this seaweed species was selected to extract fucoxanthin for further studies.

Sargassum grows well generally from October to June each year. The harvest season of Sargassum species in Vietnam is from March to April and September to October each year. The results in Table 3 showed that the fucoxanthin content in Sargassum genus varied greatly by species, geographical location and harvest time. There were two species of S. oligocystum and S. mucclurei which gave high fucoxanthin content of 2927.98 and 1650.03 µg g^-1 dry weight, respectively. Therefore, we investigated fluctuations of fucoxathin content of these two species of Sargassum according to season of the year (Table 4).

The results in Table 4 showed that the fucoxanthin content of S. oligocystum was much higher than that of S. mucclurei. For both S. olygocystum and S. mucclurei the harvest time of December and January recorded highest fucoxanthin content. In addition, both species have large reserves in Vietnam and they can be used as a good source of raw materials for fucoxanthin extraction. However, the fucoxanthin content of S. olygocystum species was much higher than that of S. mucclurei. This prompted us to extract a large amount of fucoxanthin from this S. olygocystum biomass for further studies.

Purification and quantification of fucoxanthin by column chromatography and thin layer chromatography

Crude fucoxanthin extracted from the biomass of S. oligocystum was purified by column chromatography and thin layer chromatography (TLC). The results in Figure 1 showed that the fucoxanthin extracted from S. oligocystum species has a similar band (wells 2, 3, 4) with the standard fucoxanthin (well 1). The silicagel containing these bands was further used for HPLC analysis. Through HPLC analysis, fucoxanthin content was analyzed qualitatively, reaching 2927.78 ± 241.21 µg g^-1 DCW. An illustration for the chromatography (HPLC) of fucoxanthin is shown in Figure 2C.

Determine the structure of the isolated compound

Compound 1 was isolated as red needles. The ¹H NMR and ¹³C NMR spectra of 1 showed the signals assignable to polyene possessing acetyl, conjugated ketone, two quaternary geminal dimethyls, two quaternary geminal methyls of oxygen, four olefinic methyls, and allene functionalities. These data suggested that 1 was a carotenoid with one hydroxyl group acetylated (Figure 2).

¹H NMR (CDCl₃, 600 MHz) δ_H ppm: 0.96 (3H, s, H₃-16), 1.03 (3H, s, H₃-17), 1.07 (3H, s, H₃-17¢), 1.22 (3H, s, H₃-18), 1.35 (1H, m, H-2ax), 1.36 (3H, s, H₃-16¢), 1.38 (3H, s, H₃-18¢), 1.42 (1H, m, H-2¢ax), 1.49 (1H, t, J = 12.5 Hz, H-2eq), 1.50 (1H, m, H-4¢ax), 1.78 (1H, m, H-4ax), 1.81 (3H, s, H₃-19¢), 1.94 (3H, s, H₃-19), 1.99 (3H, s, H₃-20), 1.99 (3H, s, H₃-20¢), 1.99 (1H, m, H-2¢eq), 2.03 (3H, s, H₃-22¢), 2.28 (1H, m, H-4¢eq), 2.32 (1H, m, H-4eq), 3.63 (1H, s, H-7a); 3.66 (1H, s, H-7b), 3.82 (1H, m, H-3), 5.38 (1H, m, H-3¢), 6.05 (1H, s, H-8¢), 6.13 (1H, d, J = 11.4 Hz, H-10¢), 6.27 (1H, d, J = 11.4 Hz, H-14¢), 6.35 (1H, d, J = 15.0 Hz, H-12¢), 6.40 (1H, d, J = 11.4 Hz, H-14), 6.57 (1H, m, H-11), 6.59 (1H, m, H-11¢), 6.63 (1H, m, H-15¢), 6.65 (1H, d, J = 15.0 Hz, H-12), 6.76 (1H, d, J = 15.0 Hz, H-15), 7.14 (1H, d, J = 11.4 Hz, H-10).

¹³C NMR (CDCl₃, 150 MHz) δ_C ppm: 11.82 (C-19), 12.75 (C-20), 12.90 (C-20¢), 14.00 (C-19¢), 21.15 (C-22¢), 21.39 (C-18), 25.05 (C-17), 28.13 (C-16), 29.20 (C-18¢), 31.25 (C-16¢), 32.08 (C-17¢), 35.16 (C-1), 35.77 (C-1¢), 40.81 (C-7), 41.64 (C-4), 45.26 (C-4¢), 45.45 (C-2¢), 47.07 (C-2), 64.32 (C-3), 66.17 (C-5), 67.14 (C-6), 68.07 (C-3¢), 72.69 (C-5¢), 103.39 (C-8¢), 117.52 (C-6¢), 123.38 (C-11), 125.69 (C-11¢), 128.54 (C-10¢), 129.42 (C-15), 129.42 (C-14¢), 132.51 (C-9¢), 132.51 (C-15¢), 134.54 (C-9), 135.42 (C-13), 136.63 (C-14), 137.11 (C-12¢), 138.07 (C-13¢), 139.10 (C-10), 145.04 (C-12), 170.49 (C-21¢), 197.89 (C-8), 202.37 (C-7¢).

Antioxidant properties of fucoxanthin isolated from S. olygocystum

In this study, fucoxanthin isolated from S. olygocystum (FS) displayed significant antioxidant activities (Table 5). The percentages of radical scavenging activities in the DPPH assay of FS at a concentration of 2 mg/mL were 31.80 ± 0.84% (Table 5).

Acetylcholinesterase (AChE) inhibitory activity

FS showed AChE inhibitory activities with IC₅₀ values of 130.12 ± 6.65 μg mL^-1 (Table 6). Galantamine, a positive control, showed higher AChE inhibition with IC₅₀ value of 1.78 ± 0.13 μg mL^-1 when compared to FS (Table 6). The percentage of AchE inhibition of fucoxanthin extracted from brown seaweed at the tested concentration of 100 μg/mL reaching 46.28 ± 1.05% indicated that the extracts were moderate AChE inhibitors (with IC₅₀ value of 130.12 ± 6.65 µg/mL). AchE inhibition percentage of the positive control galantamine at a concentration of 10 μg/mL reached 87. 39 ± 2. 84% (with an IC₅₀ value of 1.78±0,13 μg mL^-1).

Cytotoxicity effect of fucoxanthin extracted from S. olygocystum on C6 cells

Before evaluating the neuroprotective activities of FS by the cells, its cytotoxicities was examined to exclude secondary effects of the toxicity on its bioactivities. The obtained results showed that the cell viability of C6 cells after incubation with FS at concentrations of 1, 10, and 100 μM in 24 h was over 95%, suggesting that FS was nontoxic at the tested concentrations (Figure 3).

Neuroprotective effects of fucoxanthin extracted from S. olygocystum against damages caused by oxidative stress induced by H₂O₂ on C6 cell lines

In this study, treatment with 10 mM H₂O₂ significantly decreased cell viability by 74% while this rate reached 100% when the cells were cultured in the medium without H₂O₂ supplement (in the ethanol (EtOH) group) (Figure 4). Pre-incubating the cells with ascorbic acid before adding H₂O₂ supplement significantly inhibited H₂O₂ damaging effect on C6 cells. Similarly, pretreatment with FS at concentrations of 50, 100, and 200 μg mL^-1 protected C6 cells against H₂O₂-induced cell damage. The percentage of viability in cells pretreated with the FS at concentrations of 50 and 100 μg/mL increased to 97.69% and 91.23%, respectively, compared to cells only treated with H₂O₂ (Figure 4). Therefore, FS extracted from S. olygocystum with concentrations of 50 and 100 µg mL^-1 was selected for the next experiment.

Fucoxanthin protects C6 cell lines against Aβ_25-35- induced cytotoxicity

Treatment of Aβ_25-35 led to a decrease in the cell viability from 100% in the control group to 59% in Aβ_25-35 treated group. However, pretreated C6 cells with FS or galantamine (0.1 μg mL^-1) before the addition of Aβ_25-35 significantly attenuated Aβ_25-35-induced cell death (Figure 5). At a concentration of 50 and 100 μg mL^-1 of FS, the cell survival rate significantly increased from 59.01% to 81.02% and 80.98%, respectively. The results indicate that fucoxanthin has neuroprotective effects on C6 cells treated with Aβ_25–35.

Cytoprotective effects of FS on C6 cell lines against damages by oxidative stress induced by H₂O₂

Results in Figure 6 showed that ascorbic acid (concentration of 20 µg mL^-1) treated cells significantly induced the activity of SOD, CAT, and GPx by 107.47%, 51.22% and 51.27% respectively. FS significantly increased the activities of CAT and GPx and slightly induce the activity of SOD. FS at a concentration of 50 and 100 μg mL^-1 increased GPx’activities by 57.51% and 105.81%, respectively, compared with cells treated with H₂O₂ only. At concentration of 50 μg/mL, FS stimulation in C6 cels induced the activity of CAT by 31.98%.

Neuroprotective effects of fucoxanthin by regulating genes participating in multiple metabolisms of C6 cell lines

The mRNA expression of antioxidant enzymes such as SOD, CAT, and GPx in C6 cell lines were observed, found that mRNA expression of antioxidant enzymes, CAT and GPx increased in FS incubated cells when compared to Aβ_25-35 treated group, The results were observed similar trend with enzyme activities (Figure 7A).

In this study, we found that pre-treatment with FS significantly reversed the decrease of GSK3β induced by Aβ_25-35, suggesting that fucoxanthin may protected against Aβ_25-35-induced neuronal death via reversing the inhibition of PI3-K/Akt cascade (Figure 7B). However, in this study we did not detect increased expression levels of PI3K and Akt in all tested samples (Galantamine and FS) compared to H₂O₂treated group (Figure 7B). Further, the protective effect of FS against Aβ_25–35-induced apoptosis and ER stress in C6 cell lines were investigated. Morever, we observated that FS significantly reduced expression levels of gene encording apoptotic protein like caspase -3 and Bax (Figure 7C). These results are completely consistent with the previous results of other authors (Dhami et al. 2021; Nisa et al. 2020; Sodik et al. 2022).

Additionally, we also found that Aβ_25-35treated cells significantly suppressed mRNA levels of both ChAT and VAChT compared to the control sample. However, the values significantly improved when cells were treated with galatamine and FS (Figure 7D). Amyloid peptide (Aβ), generated by proteolytic cleavage of the amyloid precursor protein (APP), plays an important role in the pathogenesis of Alzheimer’s disease (AD). Lin et al. (2008) reported that curmin reversed metal ion - induced AD in PC-12 cells by inhibiting excessive expressions of APP and BACE1. In our study, FS did not inhibited expression level of APP compared to the Aβ_25-35treated group (Figure 7E).

We found that galantamine significantly inhibited the mRNA level of S6K1, while FS had an inverted effect (Figure 7F). This means that the neuroprotective effect of FS was not via modulating protein translation. Here, we observed low mRNA level of p62 and a higher level of ATG5 (autophagy related 5) in FS group compared to Aβ_25-35treated group (Figure 7G). Above all, these results showed FS may exert a neuroprotective role in AD process by stimulating autophagy and autophagic flux.

Seaweeds are used both as medicinal ingredients and as healthy foods in East-Asian countries such as China, Korea, and Japan (FAO 2020). Among that Sargassum is one of seaweeds which have been garnering considerable interest as sources of valuable functional metabolites (Oliyaei et al. 2023). Numerous studies have reported that Sargassum species contains many bioactive molecules, such as fucoidan, phlorotannins, fucoxanthin, and polysaccharides. Sargassum extracts or isolated pure components have been studied for years for analyzing their diverse pharmacological effects such as antioxidant, anticancer, anti-inflammatory, antibacterial, anticoagulant and neuroprotective activities. Hence, our study isolated and evaluated bioactivities, especielly neuroprotective effect of fucoxanthin isolated from Sargassum olygocystum Montagne, 1845 which could provide a comprehensive insight into the chemical structures and biological activities of its active compounds and could also provide information that would lead to the development of more different applications based on Sargassum.

According to Terasaki et al. (2017), the total fucoxanthin and lipid content of seaweed species depended on the location and the season of the year. Our obtained screening results (two species of S. oligocystum and S. mucclurei gave high fucoxanthin content of 2986.28 and 1658.81 µg/g dry weight, respectively showed in Table 4) were consistent with the reports from Jaswir et al. (2012). The fucoxanthin content of S. duplicatum and S. binderi reached 1010 and 730 µg g^-1 dry weight respectively. The fucoxanthin content of S. angustifolium was recorded to be 700 µg g^-1 DCW (Oliyaei et al. 2021). In Japan, the fucoxanthin content of S. horneri reached from 3.70 to 10.81 mg g^-1 dry weight when cultured from December to June when temperature during sampling day ranged from 2.8 to 13.6°C) and highest levels of fucoxanthin were obtained in February (10.81 mg g^-1 DCW) (Terasaki et al. 2017).

NMR techniques are very useful method for the structural determination. It was used to perform the structure of fucoxanthin isolated from Sargassum. As a result, the NMR data of compound 1 were in agreement with the literature which can allow us to assign (Fig. 2) those of fucoxanthin reported in the literature (Ayyad et al. 2011; Yan et al. 1999). With a chemical structure including an epoxide group, hydroxyl group, and allenic bond, fucoxanthin is considered a potential antioxidant (Lakshminarayana et al. 2022). Numerous studies showed that fucoxanthin isolated from seaweed has an effective radical scavenging ability (Zhang et al. 2015; Foo et al. 2017). Here we found that the radical scavenging activitiy of FS isolated from S. olygocystum (Table 5) was higher compared with those from S. fusiforme (24.3%), S. marginatum (11%), S. myriocystum (10–25%), S. pallidum (29.4%) (Hong-Yu et al. 2010; Chandini et al. 2008; Badrinathan et al. 2011). Nisa et al. (2020) and Sodik et al. (2022) investigated that the antioxidant activity of fucoxanthin extracted from S. filipendula and Sargassum sp. assessed by DPPH was IC₅₀ of 0.639 and 0.087 mg mL^− 1, respectively. According to the publication of Savira et al. (2021), the methanol extract of S. duplicatum showed the highest antioxidant activity with IC₅₀ value of 78.52 ppm (78.52 µg mL^− 1), followed by the ethanol extract with IC₅₀ value of 93.77 ppm (93.77 µg mL^− 1) and acetate extract with the lowest antioxidant activity with IC₅₀ value of 112.3 ppm (112.3 µg mL^− 1). Thus, the results of antioxidant activity of fucoxanthin isolated from S. oligocystum in our study were lower than those reported above by authors. This difference may be due to differences in Sargassum species of collected region, seasonal variations, harvest time, solvent selection, as well as different extraction methods used for the study.

Reducing acetylcholine (ACh) levels in the hippocampus and cortex of the brain is one of the remarkable biochemical changes in AD patients. Acetylcholinesterase (AChE) is a well-known enzyme for catalysis of the cleavage of acetylcholine in the synaptic cleft after depolarization. Therefore, AChE inhibitor is currently the most established approach for treating AD (Huang et al. 2013). Kawee-ai et al. (2013) reported that the crude extracts of Phaeodactylum tricornutum had strong AChE inhibitory activities with IC₅₀ values of 1.65 mg mL^-1, respectively. Natarajan et al. (2009) reported that the AChE inhibitory activities with IC₅₀ values of the extracts from Gracilaria gracilis, Sargassum, and Cladophora fasicularis were approximately 2 mg mL^-1. Among that the IC₅₀ value of fucoxanthin extracted from S. olygocystum had inhibitory activity against AChE up to 130.12 ± 6.65 µg mL^-1 (0.130 mg mL^-1), we suggest that fucoxanthin isolated from S. olygocystum in our study may be consider as a useful approach for AD treatment and it can be used in functional food applications for health benefits.

According to Vinutha et al. (2007), plant extracts/substances with strong or weak AchE inhibitory effects were classified based on their percentage of AchE inhibition. Weak inhibitors (AchE inhibition ≤ 30%), moderate inhibitors (AchE inhibition of 30–50%), and potential inhibitors (AchE inhibition ≥ 50%) have been proposed and recognized. Compared with the positive control galantamine, IC₅₀ value of fucoxanthin extracted from S. olygocystum was lower, reaching 130.12 ± 6.65 µg mL^-1. According to Alghazwi et al. (2016), fucoxanthin isolated from seaweed was tested in vitro for effects of inhibiting AChE and Butyrylcholinesterase (BChE), reducing oxidative stress, increasing anti-inflammatory activity, inhibiting kinase, enhancing neurodevelopment and reducing neurotoxicity of dopamine receptors (Alghazwi et al. 2016). Lin et al. (2016) also reported that fucoxanthin inhibited AChE activity with an IC₅₀ value of 81.2 µM (equivalent to 53.43 µg mL^-1). Our results are also observed similar to the above studies.

Oxidative stress-induced cell damage factors are important in the development of neurodegenerative diseases such as Alzheimer’s disease (Han et al. 2017). Substantial evidence shows that oxidative stress results from the cytoplasmic accumulation of hydrogen peroxide (H₂O₂), ultimately leading to the peroxidation of membrane lipids and cell death (Ciofani et al. 2014). The neuroprotective effects of FS are comparable with that of ascorbic acid and other studies by Xiang et al. (2017) in SH-SY5Y and Alghazwi et al. (2019) in PC-12 cells and uponthese results suggest that treatment of C6 cells with fucoxanthin extracted from S. olygocystum inhibits H₂O₂-induced oxidative stress.

Numerous studies reported that an abnormal deposition of amyloid β-peptide (Aβ) is the primary cause of the pathogenesis of AD. Therefore the elimination of Aβ is regarded as an important strategy for AD treatment. The discovery of drug candidates using culture neuronal cells against Aβ peptide toxicity is believed to be an effective approach to developing a drug for the treatment of AD patients (Alghazwi et al. 2019). Heo et al. (2008) found that fucoxanthin isolated from S. siliquastrum could reduce the toxicity induced by H₂O₂ in Vero cell in a concentrations - dependent manner (5–200 µM), while Alghazwi et al. (2019) suggested that at concentrations of 0.1–2 µM, fucoxanthin was able to increase cell viability compromised by Aβ_25-35 from around 67-98.5%. Choi et al. (2017) also reported that the alcohol extract of S. serratifoilum reduced the accumulation of Aβ_1-42 in the CHO-751 (Chinese hamster ovary cells) cell line. Our results were found to be similar to the above statement. Concentrations of tested sample likely depend on cell lines and some cell lines are more sensitive than others such as PC-12 cells.

SOD, CAT, and GPx are the crucial antioxidant enzymes which maintain the dynamic balance of oxidative stress. Under oxidative stress, these enzymes act as endogenous antioxidants against free radicals and eliminate excessive free radicals produced in cells by directly catalyze in the disintegration process of H₂O₂ to O₂ (García-Pérez et al. 2021). Some studies show that fucoxanthin inhibited Aβ oligomer and H₂O₂-induced apoptosis and oxidative stress in SH-SY5Y cells through a mechanism that involves the improvement of antioxidant enzyme activities, the activation of the PI3K/Akt pathway and the inhibition of the ERK pathway (Yang et al. 2021b; Lin et al. 2017; Yu et al. 2017).

Aβ oligomers or H₂O₂ could induce neuronal apoptosis via increasing oxidative stress, possibly as a result of altered regulation of signaling pathways (Jimenez et al. 2011; Chong et al. 2006; Kim et al. 2016). In neurons, those substantially increased the level of intracellular reactive oxygen species (ROS) (Kim et al. 2016). Moreover, Aβ oligomers and H₂O₂ were reported to inhibit the prosurvival phosphoinositide 3-kinase (PI3K)/Akt signaling pathway, over-activate the downstream glycogen synthase kinase 3β (GSK-3β), and induce neuronal death in vitro (Jimenez et al. 2011). Although fucoxanthin was found to inhibit cytotoxicity induced by H₂O₂ in study of Yu et al. (2017) and Aβ oligomer in study of Lin et al. (2017) in SH-SY5Y cells via activating the PI3K/Akt cascade and inhibiting the ERK pathway but we did not detect increased expression levels of PI3K and Akt in all tested samples (Galantamine and FS) compared to H₂O₂. This may be because the authors determined changes in the content of proteins using antibody, but not in the expression levels of genes encoding these proteins. In the next study, we may need to confirm the effect of fucoxanthin on altered activation of Akt/Nrf2/ARE pathway via protein expression levels.

Exposure of cells to Aβ₂₋₃₅ caused significant cell viability loss and apoptosis, Aβ aggregation, mitochondrial and endoplasmic reticulum (ER) morphological changes, as well as mitochondrial membrane potential dissipation, ROS production, intracellular calcium elevation, and cytochrome c release from mitochondria. In this study, the protective effect of FS against Aβ_25–35-induced apoptosis and ER stress in C6 cell lines were investigated. When cellular stress is very serious or prolonged, these can promote apoptosis signaling pathways through the activation of the CHOP and caspase-12 proteins (Szegezdi et al. 2006). The induction of CHOP mRNA by brain ischemia or hypoxia has been demonstrated in previous studies to be one of the most significant pathways leading to neuronal apoptosis and increase in oxidative damage (Ferri and Kroemer 2001). Caspase-12 is a member of the interleukin-1β converting enzyme subfamily of caspases which normally exist in an inactive pro-enzyme state attached to the ER membrane (Gundu et al. 2022). Active caspase-12 triggers caspase-9 and caspase-3 and Bcl2-associated X (Bax) activation, resulting in DNA fragmentation.

Choline acetyltransferase (ChAT) is responsible for the biosynthesis of ACh. The ACh content in cells is proportional to the expression of ChAT within the cells (Fujii et al. 2017). This enzyme is synthesized in the perikaryon of cholinergic neurons and is under the control of multiple regulatory elements (Bellier et al. 2011). The synthesis, storage, and release of acetylcholine require the expression of several specialized proteins, including ChAT and the vesicular ACh transporter (VAChT). The VAChT gene is located within the first intron of the ChAT gene. This unique genomic organization permits coordinated activation of the expression of the two genes by extracellular factors. Much less is known about factors that reduce the expression of the cholinergic phenotype. A cholinergic deficit is one of the primary features of AD, and AD brains are characterized by amyloid deposits composed primarily of Aβ peptides. Although Aβ peptides are neurotoxic, part of the cholinergic deficit in AD could be attributed to the suppression of cholinergic markers in the absence of cell death (Lusztajn et al. 2000). Our results were found to be similar to previous studies in which fucoxanthin reversed Aβ oligomer-induced ChAT reduction in the hippocampal regions and could attenuate Aβ oligomer-induced loss of cholinergic neurons (Xiang et al. 2017).

There are multiple mechanisms through which S6 kinase 1 (S6K1) activation may be directly related to Alzheimer’s disease. S6K1 may directly phosphorylate Tau. Therefore, inhibiting S6K1 reducint the expression of BACE1 (which cleaves amyloid precursor protein at the start of the β-amyloid pathway) and Tau (Maruani et al. 2012).

Several evidences support that autophagy dysfunction plays an indispensable impact in AD pathology (Zhang et al. 2017). In early AD, autophagy accelerates the clearance of misfolded proteins and promotes neuronal survival, and as AD progresses, the normal autophagic function of neurons is continuously destroyed and the autophagic flux process is blocked, and the ability to clear protein aggregates is declined (Orr and Oddo 2013). Since autophagy is a dynamic process and is regulated by a series of key autophagy-related genes, such as Beclin-1, autophagy-related gene (ATG) 5, ATG 12, and LAMP-1.

Based on our results, the neuroprotective effect of fucoxanthin isolated from different sources varied. Especially, FS isolated from S. olygocystum protected against H₂O₂ and Aβ_25–35-induced neurotoxic in C6 cell lines by regulating gene expression of antioxidant enzymes (CAT and GPx) and ER pathway (caspase − 3 and Bax). FS also promoted the expression of a gene(s) involved in PI3K/Akt signaling (GSK-3β), autophagy (p62 and ATG5) and the biosynthesis of ACh (VAChT and ChAT).

Among nine species of Sargassum, S. olygocystum Montagne, 1845 was found to produce the highest fucoxanthin content of 2986.28 µg g^-1 on the dry weight basis. Fucoxanthin from S. oligocystum was isolated, purified, and structural identification was done.by NMR. The extracted fucoxanthin exhibited DPPH free radical scavenging and AchE inhibitory activities. Fucoxanthin showed no cytotoxicity against C6 cell lines up to a concentration of 100 µM and the event showed more powerful cytoprotective effects on H₂O₂ and Aβ_25-35 induced neurotoxic C6 cell damage at concentrations of 50 and 100 µg mL^-1. Fucoxanthin extracted from S. olygocystum had the neuroprotective effect by protection against H₂O₂ and Aβ_25-35 induded neurotoxic in C6 cell lines by not only regulating activity as well as gene expression of antioxidant enzymes (as CAT and GPx) and ER pathway (as caspase − 3 and Bax) but also promoting expression of genes involved in PI3K/Akt signaling (GSK-3β), autophagy (p62 and ATG5) and the biosynthesis of acetycholine (VAChT and ChAT). The present results showed that fucoxanthin extracted from S. olygocystum of Vietnam is a potential source for the utilization of health food applications in the prevention and treatment of Alzheimer's disease.

Author’s contribution Conceptualization, Dang Diem Hong; Data curation, Hoang Thi Minh Hien, Le Thi Thom, Nguyen Cam Ha, Nguyen Manh Dat, Nguyen Thi Minh Hang and Luu Thi Tam; Formal analysis, Hoang Thi Minh Hien, Le Thi Thom, Nguyen Cam Ha, Luu Thi Tam, Nguyen Thi Minh Hang and Ngo Thi Hoai Thu; Investigation, Dang Diem Hong; Methodology, Le Thi Thom, Nguyen Cam Ha, Luu Thi Tam and Nguyen Thi Minh Hang; Project administration, Dang Diem Hong; Resources, Nguyen Van Tru; Validation, Hoang Thi Minh Hien, Nguyen Cam Ha, Le Thi Thom and Luu Thi Tam; Visualization, Le Thi Thom; Writing - original draft, Dang Diem Hong, Hoang Thi Minh Hien, Le Thi Thom and Nguyen Cam Ha; Writing - review & editing, Dang Diem Hong, Hoang Thi Minh Hien and Ranga Rao Ambati. All authors have read and agreed to the published version of the manuscript.

Funding This work was funded by the projects with codes VAST04.10/22-23 and NVCC 08.04/22-23 for Prof. Dr. Dang Diem Hong.

Acknowledgments:

We would like to thank Amicogen Company, Korea for supporting the HPLC column for the analysis of fucoxanthin for the first stage from 1 June 2007 1 to 15 October 2007. The authors would like to thank Dr. John Ỵ Jeon, Chief Technology Officer and Dr. Yong Chul Chin, Chief Executive Officer, Amicogen Inc for supporting Prof. DD Hong's research team in this study on fucoxathin from Vietnam seaweed of Sargassum. Authors thank Prof. Gokare A. Ravishankar (Dr. C. D. Sagar Centre for Life Sciences, Department of Biotechnology, Dayananda Sagar College of Engineering, Dayananda Sagar Institutions, Kumaraswamy Layout, Bangalore-560111, Karnataka, India) for helping in critical reading, editing and revising the manuscript.

Competing interests The authors declare no competing interests

Akpan N, Caradonna K, Chuenkova MV, PereiraPerrin M (2008). Chagas' disease parasite-derived neurotrophic factor activates cholinergic gene expression in neuronal PC12 cells. Brain research 1217:195-202.
Alghazwi M, Kan YQ, Zhang W, Gai WP, Garson MJ, Smid S (2016) Neuroprotective activities of natural products from marine macroalgae during 1999-2015. J Appl Phycol 28:3599 - 3616.
Alghazwi M, Smid S, Musgrave I, Zhang W (2019) In vitro studies of the neuroprotective activities of astaxanthin and fucoxanthin against amyloid beta (Aβ1-42) toxicity and aggregation. Neurochem Int 124:215-224.
Altınöz E, Ekici C, Özyazgan B, Çiğremiş Y (2016) The effects of crocin (active contstituent of saffron) treatment on brain antioxidant enzyme mRNA levels in diabetic rats. Turkish J Biochem 41:112-117.
Ayyad SEN, Ezmirly ST, Basaif SA, Alarif WM, Badria AF, Badria FA (2011) Antioxidant, cytotoxic, antitumor, and protective DNA damage metabolites from the red sea brown alga Sargassum sp. Pharmacol Res 3:160-165.
Badrinathan S, Suneeva SC, Shiju TM, Girish KC, Pragasam V (2011) Exploration of a novel hydroxyl radical scavenger from Sargassum myriocystum. J Med Plant Res 5:1997-2005.
Bellier JP, Kimura H (2011) Peripheral type of choline acetyltransferase: biological and evolutionary implications for novel mechanisms in cholinergic system. J Chem Neuroanat 42:225-235.
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle ofprotein‐dye binding. Anal Biochem 72:248-254.
Chandini SK, Ganesan P, Bhaskar N (2008) In vitro antioxidant activities of three selected brown seaweeds of India. Food Chem 107:707-713.
Chen MH, Wang TJ, Chen LJ, Jiang MY, Wang YJ, Tseng GF, Chen JR (2021) The effects of astaxanthin treatment on a rat model of alzheimer's disease. Brain Res Bull 172: 151-163.
Chen Y, Li J, Huang Z, Su G, Li X, Sun Z, Qin YB (2020) Impact of short-term application of seaweed fertilizer on bacterial diversity and community structure, soil nitrogen contents, and plant growth in maize rhizosphere soil. Folia Microbiol 65:591-603.
Choi H, Kol SH (2016) Interaction between amyloid beta toxicity and the PI3K pathway in Alzheimer’s disease. J Alzheimers Dis 6:1 - 3.
Choi MW, Jung CG, Kim HR, Kim RI (2017) Effect of Sargassum serratifolium extracts on β-Amyloid production. Korean J Fish Aquat Sci 50:085-091.
Chong YH, Shin YJ, Lee EO, Kayed R, Glabe CG, Tenner AJ (2006) ERK1/2 activation mediates Aβ oligomer-induced neurotoxicity via caspase-3 activation and tau cleavage in rat organotypic hippocampal slice cultures. J Biol Chem 281:20315-20325.
Chopin T, Tacon AGJ (2021) Importance of seaweeds and extractive species in global aquaculture production. Rev Fish Sci Aquacult 29:139 - 148.
Ciofani G, Genchi GG, Mazzolai B, Mattoli V (2014) Transcriptional profile of genes involved in oxidative stress and antioxidant defense in PC12 cells following treatment with cerium oxide nanoparticles. Biochim Biophys Acta 1840:495-506.
Clementi ME, Lazzarino G, Sampaolese B, Brancato A, Tringali G (2019) DHA protects PC12 cells against oxidative stress and apoptotic signals through the activation of the NFE2L2/HO-1 axis. Int J Mol Med 43:2523-2531.
Conforti F, Sosa S, Marrelli M, Menichini F, Statti GA, Uzunov D, Tubaro A, Menichini F, Loggia RD (2008) In vivo anti-inflammatory and in vitro antioxidant activities of Mediterranean dietary plants. J Ethnopharmacol 116:144-151.
Dang DH, Anh HTL, Thom LT, Ha NC, Tien DD, Duy DA (2019) The genus Gracilaria in Vietnam. Institute of Ocean and Earth Sciences Monograph Series 17: Taxonomy of southeast asian seaweed III. Phang, Song & Lim (eds). :29-46
Dang D.H., and Ha, N.C. (2022). Seaweeds of Vietnam: Opportunities for Commercial Production. In: Ranga Rao A, Ravishankar GA (eds) Sustainable Global Resources of Seaweeds Volume 1: Bioresources , cultivation, trade and multifarious applications. Springer, Cham, Springer Nature Switzerland AG, pp 109-127.
Dang DH, Hien HM, Son PN (2007) Use of Vietnamese seaweed for functional food, medicine and biofertilizer. J. Appl. Phycol 19:817-826.
Deepika C, Ravishankar GA., Rao AR (2002a) Potential Products from Macroalgae: An Overview. In: Ranga Rao A, Ravishankar GA (eds) Sustainable Global Resources Of Seaweeds Volume 1. Springer, Cham, pp 17-44.
Deepika C, Wolf J, Moheimani N, Hankamer B, von Herzen B, Rao AR (2022b) Utilisation of Seaweeds in the Australian Market – Commercialisation Strategies: Current Trends and Future Prospects. In: Ranga Rao A, Ravishankar GA (eds) Sustainable Global Resources Of Seaweeds Volume 1. Springer, Cham, pp 265-294
Dhami M, Raj K, Singh S (2021) Neuroprotective effect of fucoxanthin against intracerebroventricular streptozotocin (ICV-STZ) induced cognitive impairment in experimental rats. Curr Alzheimer Res 18:623-637.
Efange SM, Garland EM, Staley JK, Khare AB, Mash DC (1997) Vesicular acetylcholine transporter density and Alzheimer’s disease. Neurobiol Aging 18:407-413.
Ellman GL, Courtney KD, Andres JV, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7:88-95.
Fan B, Yu Y, Zhang Y (2015) PI3K-Akt1 expression and its significance in liver tissues with chronic fluorosis. Int J Clin Exp Pathol 8:1226-1236.
FAO (2018) The Global Status of Seaweed Production, Trade and Utilization. Globefish Research Program 124. Food and Agriculture Organization of the United Nations; Rome, Italy: 2018. 120p
FAO. The State of World Fisheries and Aquaculture 2020. Sustainability in Action. FAO; Rome, Italy.
Felaco L, Olvera-Novoa MA Robledo D (2020) Multitrophic integration of the tropical red seaweed Solieria filiformis with sea cucumbers and fish. Aquaculture 527:735475.
Ferreira-Vieira TH, Guimaraes IM, Silva FR, Ribeiro FM (2016) Alzheimer's disease: Targeting the Cholinergic System. Curr Neuropharmacol 14:101-15.
Ferri KF, Kroemer G (2001) Organelle-specific initiation of cell death pathways. Nat Cell Biol 3: E255-63.
Foo SC, Yusoff FM, Ismail M, Basri M, Yau SK, Khong NM, Chan KW, Ebrahimi M (2017) Antioxidant capacities of fucoxanthin-producing algae as influenced by their carotenoid and phenolic contents. J Biotechnol 241:175-183.
Fujii T, Mashimo M, Moriwaki Y, Misawa H, Ono S, Horiguchi K, et al (2017) Expression and function of the cholinergic system in immune cells. Front Immunol 8:1085.
García-Pérez E, Ryu D, Lee C, Lee HJ (2021) Ochratoxin A induces oxidative stress in HepG2 cells by impairing the gene expression of anti-oxidant enzymes. Toxins 13:271.
Gundu C, Arruri VK, Sherkhane B, Khatri DK, Singh SB (2022) GSK2606414 attenuates PERK/p-eIF2α/ATF4/CHOP axis and augments mitochondrial function to mitigate high glucose induced neurotoxicity in N2A cells. Curr Res Pharmacol Drug Discov 3:100087.
Han Q, Wang H, Xiao C, Fu BD, Du CT (2017) Oroxylin A inhibits H₂O₂-induced oxidative stress in PC12 cells. Nat Prod Res 31:1339-1342.
Haugan JA, Akermann T, Liaaen JS (1992) Isolation of fucoxanthin and piridinin. In: Packer L (ed) Carotenoids part A: Chemistry, separation, quatitation and antioxidants. Methods in Enzymology, Vol.213. Academic Press Inc., Orlando, pp 231-245.
He X, Sun J, Huang X (2018) Expression of caspase-3, Bax and Bcl-2 in hippocampus of rats with diabetes and subarachnoid hemorrhage. Exp Ther Med 15:873-877.
Heo SJ, Ko SC, Kang SM, Kang HS, Kim JP, Kim SH, Lee KW, Cho MG, Jeon YJ (2008) Cytoprotective effect of fucoxanthin isolated from brown algae Sargassum siliquastrum against H₂O₂-induced cell damage. Eur Food Res Technol 228:145-151.
Hileman EO, Liu J, Albitar M, Keating MJ, Huang P (2004) Intrinsic oxidative stress in cancer cells: a biochemical basis for therapeutic selectivity. Cancer Chemother Pharmacol 53:209-219.
Hong-Yu L, Bin W, Chun-Guang Y, You-le Q, Chuan-ling S (2010) Evaluation of antioxidant activities of five selected brown seaweeds from China. J Med Plant Res 4:2557-2565.
Huang L, Su T, Li X (2013) Natural products as sources of new lead compounds for the treatment of Alzheimer's disease. Curr Top Med Chem 13:1864-1878.
Jaswir I, Noviendri D, Salleh HM, Miyashita K (2012) Fucoxanthin extractions of brown seaweeds and analysis of their lipid fraction in methanol. Food Sci Technol Res 18:251-257.
Jimenez S, Torres M, Vizuete M (2011) Age-dependent accumulation of soluble amyloid beta (Abeta) oligomer reverses the neuroprotective effect of soluble amyloid precursor protein-alpha (sAPP(alpha)) by modulating phosphatidylinositol 3-kinase (PI3K)/Akt-GSK-3beta pathway in Alzheimer mouse model. J Biol Chem 286:18414-18425.
Kawee-ai A, Kuntiya A, Kim SM. Anticholinesterase and antioxidant activities of fucoxanthin purified from the microalga Phaeodactylum tricornutum. Nat Prod Commun 8:1381-1386.
Kim B, Park J, Chang KT, Lee DS (2016) Peroxiredoxin 5 prevents amyloid-beta oligomer-induced neuronal cell death by inhibiting ERK-Drp1-mediated mitochondrial fragmentation. Free Radic Biol Med 90:184-194.
Kobayashi A, Kang MI, Okawa H, Ohtsuji M, Zenke Y, Chiba T, Igarashi K, Yamamoto M (2004) Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol 24:7130-7139.
Koh SH, Lo EH (2015) The role of the PI3K pathway in the regeneration of the damaged brain by neural stem cells after cerebral infarction. J Clin Neurol 11:297-304.
Kumar V, Tripathi VK, Jahan S, Agrawal M, Pandey A, Khanna VK, Pant AB (2015) Lead intoxication synergies of the ethanol-induced toxic responses in neuronal Cells-PC12. Mol Neurobiol 52:1504-1520.
Lakshminarayana R, Vijay K, Ambedkar R, Ranga Rao A, Ravishankar GA (2022) Biological Activities and Health Benefits of Seaweed Carotenoids with Special Reference to Fucoxanthin. In: Ranga Rao A and Ravishankar GA (eds) Sustainable Global Resources of Seaweeds, Vol2. Springer Cham; Springer Nature Switzerland AG, pp 539-558.
Liao Z, Zhou X, Li S, Jiang W, Li T, Wang N, Xiao N (2022) Activation of the AKT/GSK-3β/β-catenin pathway via photobiomodulation therapy promotes neural stem cell proliferation in neonatal rat models of hypoxic-ischemic brain damage. Ann Transl Med 10(2):55.
Lin J, Huang L, Yu J, Xiang S, Wang J, Zhang J, Yan X, Cui W, He S, Wang Q (2016) Fucoxanthin, a marine carotenoid, reverses scopolamine-induced cognitive impairments in mice and inhibits acetylcholinesterase in vitro. Mar Drugs 14:67.
Lin J, Yu J, Zhao J, Zhang K, Zheng J, Wang J, Huang C, Zhang J, Yan X, Gerwick WH, Wang Q, Cui W, He S (2017) Fucoxanthin, a marine carotenoid, attenuates β-amyloid oligomer-induced neurotoxicity possibly via regulating the PI3K/Akt and the ERK Pathways in SH-SY5Y cells. Oxid Med Cell Longev 2017:6792543.
Lin R, Chen X, Li W, Han Y, Liu P, Pi R (2008) Exposure to metal ions regulates mRNA levels of APP and BACE1 in PC12 cells: Blockage by curcumin. Neurosci Lett 440:344 - 347.
Lu Z, Chen C, Wu Z, Miao Y, Muhammad I, Ding L, Tian E, Hu W, Ni H, Li R, Wang B, Li J (2017) A Dual Role of P53 in regulating colistin-induced autophagy in PC-12 Cells. Front Pharmacol 8:768.
Lusztajn JK, Berse B (2000) The cholinergic neuronal phenotype in Alzheimer's disease. Metab Brain Dis 15:45-64.
Maruani DM, Spiegel TN, Harris EN, Shachter AS, Unger HA, Herrero-González S, Holz MK (2012) Estrogenic regulation of S6K1 expression creates a positive regulatory loop in control of breast cancer cell proliferation. Oncogene 31:5073 - 5080.
Natarajan S, Shanmugiahthevar KP, Kasi PD (2009) Cholinesterase inhibitors from Sargassum and Gracilaria gracilis: seaweeds inhabiting South Indian coastal areas (Hare Island, Gulf of Mannar). Nat Prod Res 23:355-369.
Phong NT, Tien HV (2019) Distribution and species identification of Sargassum genus (Phaeophyta) in Phu Quoc - Kien Giang, Vietnam. Can Tho University Journal of Science 55 (5B):57-66.
Nisa AA, Sedjati S, Yudiati E (2020) Quantitative fucoxanthin extract of tropical Padina sp. and Sargassum sp. (Ocrophyta) and its’ radical scavenging activity. In IOP Conference Series: Earth and Environmental Science 584:012044.
O’Neill C (2013) PI3-kinase/Akt/mTOR signaling: impaired on/off switches in aging, cognitive decline and Alzheimer’s disease. Exp Gerontol 48:647-653.
Oliyaei N, Moosavi‐Nasab M (2021) Ultrasound‐assisted extraction of fucoxanthin from Sargassum angustifolium and Cystoseira indica brown algae. J Food Process Preserv 45:p.e15929.
Oliyaei N, Moosavi-Nasab M, Tanideh N, Iraji A (2023) Multiple roles of fucoxanthin and astaxanthin against Alzheimer’s disease: Their pharmacological potential and therapeutic insights. Brain Res Bull 193:11-21.
O'Neill C, Kiely AP, Coakley MF, Manning S, Long-Smith CM (2012) Insulin and IGF-1 signalling: longevity, protein homoeostasis and Alzheimer's disease. Biochem Soc Trans 2012, 40(4):721-727.
Orr ME, Oddo S (2013) Autophagic/lysosomal dysfunction in Alzheimer's disease. Alzheimers Res Ther. 2013, 5:53.
Padam BS, Chye FY (2020) Chapter 2: Seaweed components, properties, and applications. In: Torres MD, Kraan S, Dominguez H (eds) Sustainable Seaweed Technologies: Cultivation, Biorefinery, and Applications. Elsevier, Amsterdam, The Netherlands, pp 33-87.
Pajares M, Jiménez-Moreno N, García-Yagüe ÁJ, Escoll M, de Ceballos ML, Van Leuven F, Rábano A, Yamamoto M, Rojo AI, Cuadrado A (2016) Transcription factor NFE2L2/NRF2 is a regulator of macroautophagy genes. Autophagy 12:1902-1916.
Phang SW, Yeong HY, Ganzon-Fortes ET, Lewmanomont K, Prathep A, Le NH, Gerung GS, Tan KS (2016) Marine algae of the south china sea bordered by Indonesia, Malaysia, Philippines, Singapore, Thailand and Vietnam. Raffles Bull Zool 34:13-59.
Ranga Rao A, Ravishankar GA (2022a) Sustainable Global Resources of Seaweeds Volume 1: Bioresources, cultivation, trade and multifarious applications. Springer Cham, Springer Nature Switzerland AG.
Ranga Rao A, Ravishankar GA (2022b) Sustainable Global Resources of Seaweeds Volume 2: Food, Pharmaceutical and Health Applications. Springer Cham, Springer Nature Switzerland AG.
Ren Z, Yang M, Guan Z, Yu W (2019) Astrocytic α7 nicotinic receptor activation inhibits amyloid-β aggregation by upregulating endogenous αB-crystallin through the PI3K/Akt signaling pathway. Curr Alzheimer Res 16:39 - 48.
Rodriguez KJ, Wong HK, Oddos T, Southall M, Frei B, Kaur S (2013) A purified feverfew extract protects from oxidative damage by inducing DNA repair in skin cells via a PI3-kinase-dependent Nrf2/ARE pathway. J Dermatol Sc, 72:304 - 310.
Ryu J, Hong BH, Kim YJ, et al (2016) Neuregulin-1 attenuates cognitive function impairments in a transgenic mouse model of Alzheimer's disease. Cell Death Dis 7:e2117.
Savira ADR, Amin MNG, Alamsjah MA (2021) The effect of different type of solvents on the antioxidant activity of fucoxanthin extract from brown seaweed Sargassum duplicatum. IOP Conference Series: Earth and Environmental Science 78(1):012010.
Schramm DD, Karim M, Schrader HR, Holt RR, Cardetti M, Keen CL (2003) Honey with high levels of antioxidants can provide protection to healthy human subjects. J Agric Food Chem 51:1732-1735.
Sodik V, Tamat S, Suwarno T, Noviendri D (2022) Ekstraksi dan purifikasi fukosantin dari rumput laut cokelat Sargassum sp. sebagai antioksidan. Jurnal riset kesehatan poltekkes depkes bandung 14:123-133.
Sugumaran R, Padam BS, Yong WTL, Saallah S, Ahmed K, Yusof NA (2022) A retrospective review of global commercial seaweed production – current challenges, biosecurity and mitigation measures and prospects. Int J Environ Res Public Health 19:7087.
Sun X, Zhao H, Liu Z, Sun X, Zhang D, Wang S, Xu Y, Zhang G, Wang D (2020) Modulation of gut microbiota by fucoxanthin during alleviation of obesity in high-fat diet-fed mice. J Agric Food Chem 68:5118-5128.
Szegezdi E, Logue SE, Gorman AM, Samali A (2006) Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep 7:880-5.
Terasaki M, Kawagoe C, Ito A, Kumon H, Narayan B, Hosokawa M, Miyashita K (2017) Spatial and seasonal variations in the biofunctional lipid substances (fucoxanthin and fucosterol) of the laboratory-grown edible Japanese seaweed (Sargassum horneri Turner) cultured in the open sea. Saudi J Biol Sci 24:1475-1482.
Vinutha B, Prashanth D, Salma K, Sreeja SL, Pratiti D, Padmaja R, Radhika S, Amit A, Venkateshwarlu K, Deepak M (2007) Screening of selected Indian medicinal plants for acetylcholinesterase inhibitory activity. J Ethnopharmacol 109:359-363.
Wang X, He L, Ma Y, Huan L, Wang Y, Xia B, Wang G (2020) Economically important red algae resources along the Chinese coast: History, status, and prospects for their utilization. Algal Res 46:101817
Weydert CJ, Cullen JJ (2010) Measurement of superoxide dismutase, catalase and glutathione peroxidase in cultured cells and tissue. Nat Protoc 5:51-66.
Xiang S, Liu F, Lin J, Chen H, Huang C, Chen L, Zhou Y, Ye L, Zhang K, Jin J (2017) Fucoxanthin inhibits β-amyloid assembly and attenuates β-amyloid oligomerinduced cognitive impairments. J Agric Food Chem 65:4092-4102.
Xiao F, Xu T, Lu B, Liu R (2020) Guidelines for antioxidant assays for food components. Food Front 1:60-69.
Yan W, Wang HD, Hu ZG, Wang QF, Yin HX (2008) Activation of Nrf2-ARE pathway in brain after traumatic brain injury. Neurosci Lett 431:150-154.
Yan X, Chuda Y, Suzuki M, Nagata T (1999) Fucoxanthin as the major antioxidant in Hijikia fusiformis, a common edible seaweed. Biosci Biotechnol Biochem 63:605-607.
Yang H, Xing R, Liu S, Yu H, Li P (2021a) Role of fucoxanthin towards cadmium-induced renal impairment with the anti-oxidant and anti-lipid peroxide activities. Bioengineered 12:7235-7247.
Yang M, Jin L, Wu Z, Xie Y, Zhang P, Wang Q, Yan S, Chen B, Liang H, Naman CB, Zhang J (2021b) PLGA-PEG Nanoparticles Facilitate In Vivo anti-alzheimer's effects of fucoxanthin, a marine carotenoid derived from edible brown algae. J Agric Food Chem 69:9764-9777.
Yu J, Lin JJ, Yu R, He S, Wang QW, Cui W, Zhang JR (2017) Fucoxanthin prevents H₂O₂-induced neuronal apoptosis via concurrently activating the PI3-K/Akt cascade and inhibiting the ERK pathway. Food Nutr Res 61:1304678.
Yu X, Li Y, Mu X (2020) Effect of Quercetin on PC12 Alzheimer’s Disease Cell Model Induced by Aβ25-35 and Its Mechanism Based on Sirtuin1/Nrf2/HO-1 Pathway. Biomed. Res. Int. 8210578.
Zhang H, Tang Y, Zhang Y, Zhang S, Qu J, Wang X, Kong R, Han C, Liu Z (2015) Fucoxanthin: A promising medicinal and nutritional ingredient. Evid Based Complement Alternat Med 2015:723515.
Zhang L, Liao W, Huang Y, Wen Y, Chu Y, Zhao C (2022) Global seaweed farming and processing in the past 20 years. Food Production Processing and Nutrition 4:28.
Zhang L, Wang H, Fan Y, Gao Y, Li X, Hu Z, Ding K, Wang Y, Wang X (2017) Fucoxanthin provides neuroprotection in models of traumatic brain injury via the Nrf2-ARE and Nrf2-autophagy pathways. Sci Rep 7:1-15.
Zheng J, Piao MJ, Kim KC, Yao CW,Cha JW, Hyun JW (2014) Fucoxanthin enhances the level of reduced glutathione via the Nrf2-mediated pathway in human keratinocytes. Mar Drugs 12:4214-4230.
Zou CG, Cao XZ, Zhao YS, Gao SY, Li SD, Liu XY, Zhang Y, Zhang KQ (2009) The molecular mechanism of endoplasmic reticulum stress-induced apoptosis in PC-12 neuronal cells: the protective effect of insulin-like growth factor I. Endocrinology 150:277-285.

Table 1. Provided the list of Sargassum species and their scientific names including the places and times for collection samples used in this study

Number	Scientific name	Places and times for collecting	With coordinates
1	Sargassum mcclurei Setchell, 1933	Hon Chong, Nha Trang, Khanh Hoa province; 5-10 October, 2022	12°16’N 109°12’E
2	S. binderi Sonder ex J. Agardh, 1848	Bau Hamlet, Vinh Nguyen, Nha Trang; 15-20 October, 2021	12°13'N 109°14'E
3	S. polycystum C. Agardh, 1824	My Hoa, Ninh Hai, Ninh Thuan province; 15-20 October, 2021	11°42'N 109°12'E
4	S. duplicatum Bory	Hon Chong, Vinh Phuoc, Nha Trang, Khanh Hoa province; 15-20 October, 2021	12°16'N 109°12'E
5	S. denticarpum T. Ajusaka, 1994	My Hoa, Ninh Hai, Ninh Thuan province; 15-20 October, 2021	11°42'N 109°12'E
6	S. swartzii (Turn.) C. Ag.	Thua Thien Hue province, 15-20 October, 2021	16°32'N 107°39'E
7	S. microcystum J. Agardh, 1848	Tri Nguyen Island, Nha Trang, Khanh Hoa province; 20-30 October, 2021	12°11'N 109°13'E
8	S. crassifolium J. Agardh	Bai Tien, Vinh Hoa, Nha Trang, Khanh Hoa province; 20-30 October, 2021	12°13'N 109°12'E
9	S. oligocystum Montagne, 1845	Hon Chong, Nha Trang, Khanh Hoa province; 17 -18 October, 2021	12°16’N 109°12’E

Table 2. Primer sequence for real-time PCR

Primer	Sequences (5’-3’)		References
Primer	Forward	Reverse	References
CHAT	AGCCCTGCTGTGATCTTTGCTCG	CCTTGGCCCAGTCAGTGGGAA	Akpan et al. 2008
VAChT	CCCTTAAGCGGGCCTTTCATTGAT	AAAGGCAAACATGACTGTGGAGGC	Akpan et al. 2008
SOD	GCCTGGATGGCTACGTACA	GGTCCAGCGGATGAAGAG	Altınöz et.al. 2016
CAT	AATGAAGACAACGTCACTCAGG	TGTTCTCACACAGGCGTTTC	Altınöz et.al. 2016
GPX	GCAATCAGTTCGGACATCAG	CACCGGGTCGGACATACTT	Altınöz et.al. 2016
PI3K	AACACAGAAGACCAATACTC	TTCGCCATCTACCACTAC	Fan et al. 2015
Akt	GTGGCAAGATGTGTATGAG	CTGGCTGAGTAGGAGAAC	Fan et al. 2015
GSK-3β	CATCCTTATCCCTCCTCACGCT	TATTGGTCTGTCCACGGTCTCC	Liao et al. 2022
S6K1	CTCTGAGGATGAGCTGGAGG	TTCTCACAATGTTCCATGCC	Maruani et al. 2012
CHOP	GGAGAAGGAGCAGGAGAATGA	AGACAGACAGGAGGTGATGC	Zou et al. 2009
Atg5	CCCTGAAGACGGAGAGAAGA	TGCTGATGTGAAGGAAGTTGTC	Lu et al. 2017
p62	CCTATTACCTGGCCTGTGGA	GTTCATCCGTTGTGCATGAG	Lu et al. 2017
Caspase-3	GTGGAACTGACGATGATATGGC	CGCAAAGTGACTGGATGAACC	He et al. 2018
APP	GGACGACTCCGATGTCTGGT	ACATCAAAGTACCAGCGGGAG	Lin et al. 2008
Caspase -9	AGCCAGATGCTGTCCCATAC	CAGGAGACAAAACCTGGGAA	Kumar et al. 2015
Beclin	TGGAAATCACTCGTATCTGGAG	CCACCTCTTCTTTGAACTGCT	Lu et al. 2017
Bax	GCAGGGAGGATGGCTGGGGAG	TCCAGACAAGCAGCCGCTCACG	Clementi et al. 2019
β-actin	CTAAGGCCAACCGTGAAAAG	GCCTGGATGGCTACGTACA	Altınöz et.al. 2016

Table 3. The fucoxanthin content of the different species of Sargassum collected from Thua Thien Hue, Khanh Hoa, and Ninh Thuan provinces, Vietnam (2021-2022)

No.	Species Name	Place and time of samples collection	Fucoxanthin content (mg/g wet weight)	Fucoxanthin content (mg/g dry weight)
1	S. mucclurei	Hon Chong, Nha Trang, Khanh Hoa province, 5-10 December, 2021	1875.03 ± 8.75	1650.03 ± 7.01
2	S. binderi	Vinh Nguyen, Nha Trang, Khanh Hoa province, 15-20 October, 2021	144.15 ± 4.88	296.07 ± 5.50
3	S. polycystum	My Hao, Ninh Hai, Ninh Thuan province, 15-20 October, 2021	1.04 ± 0.49	3.82 ± 0.89
4	S. duplicatum	Hon Chong, Nha Trang, Khanh Hoa province, 15-20 October, 2021	104.68 ± 3.49	255.03 ± 5.71
5	S. denticarpum	My Hoa, Ninh Hai, Ninh Thuan province, 15-20 October, 2021	10.37 ± 3.66	24.25 ± 2.72
6	S. swartzii	Thua Thien Hue province, 15-25 October, 2021	117.40 ± 2.56	217.60 ± 5.04
7	S. microcystum	Dao Tri Nguyen, Nha Trang Bay, Khanh Hoa province, 20-30 October, 2021	60.95 ± 3.06	161.52 ± 2.90
8	S. crassifolium	Bai Tien, Nha Trang, Khanh Hoa province, 20-30 October, 2021	12.67 ± 1.50	26.65 ± 2.86
9	S. oligocystum	Xom Bau, Vinh Nguyen, Nha Trang, Khanh Hoa province, 17 - 18 January, 2022	3327.25 ± 30.96	2927.98 ± 8.01

Note: The mean values n=3 except for S. oligocystrum, S. duplicatum, S. binderi and S. swartzii (n=6)

Table 4. Seasonal fucoxanthin content from S. olygocystum and S. mucclurei in the year 2021 and 2022

Sample collection time	S. mucclurei (µg/g dry weight)	S. oligocystum (µg/g dry weight)
21 September, 2021	697.65 ± 5.78	978.22 ± 7.18
22 October, 2021	897.82 ± 7.98	1362.82 ± 7.92
20 November, 2021	1298.67 ± 6.71	1872.16 ± 8.62
20 December, 2021	1658.81 ± 7.17	2276.19 ± 8.68
20 January, 2022	1310.72 ± 7.81	2986.28 ± 9.01
20 February, 2022	1259.17 ± 7.42	1968.82 ± 7.62
15 March, 2022	1087.16 ± 6.72	1276.92 ± 6.73
17 April, 2022	962.19 ± 5.17	872.19 ± 5.12
11 May, 2022	802.29 ± 7.82	776.97 ± 5.89
25 June, 2022	779.78 ± 5.82	672.08 ± 4.82
20 July, 2022	563.74 ± 4.17	517.81 ± 4.78
10 August, 2022	392.81 ± 4.12	439.78 ± 3.36

Table 5. Antioxidant activities of fucoxanthin isolated from S. olygocystum (FS).

DPPH Scavenging Activity (%)		DPPH Scavenging Activity (%)
Concentrations (mg/mL)	FS	Concentrations (μg/mL)	Ascorbic acid
0.1	8.34 ± 0.14	4	32.70 ± 0.52
0.4	13.97 ± 0.10	20	89.90 ± 1.31
2	31.80 ± 0.84	100	92.3 ± 1.83
IC₅₀ (mg/mL)	3.42 ± 0.15	IC₅₀ (μg/mL)	19.43 ± 0.13

Noties: Ascorbic acid: positive control

Table 6. Acetylcholinesterase inhibitory activities of fucoxanthin extracted from S. olygocystum (FS)

AChE Inhibition Activity (%)		AChE Inhibition Activity (%)
Concentrations (µg/mL)	FS	Concentrations (µg/mL)	Galantamine
4	4.25 ± 0.10	0.08	9.51 ± 0.52
20	21.35 ± 0.84	0.4	25.72 ± 1.31
100	46.28 ± 1.05	2	53.02 ± 1.10
500	75.43 ± 1.46	10	87.39 ± 2.84
IC₅₀(µg/mL)	130.12 ± 6.65	IC₅₀(µg/mL)	1.78±0.13

Noties: Galantamine: positive control

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Elucidation of Antioxidant and Neuroprotective Potential of Fucoxanthin Isolated from Brown Seaweed Sargassum oligocystum

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1