In this paper, the whole bacteria inactivated vaccine was prepared by the mermaid subspecies of Mermaid Luminescent Bacillus. The semislippery tongue sole was immunized by immersion and intraperitoneal injection respectively. The liver, kidney, gill and spleen were dissected and RNA was extracted at nine time points, 0h, 4h, 8h, 12h, 24h, 48h, 72h, 96h and 7d after immunization. Detection was carried out in various tissues, using real-time fluorescence quantitative PCR, upon ,the expression changes of the following seven immune-related genes: Toll-like receptor (TLR2), myeloid differentiation factor MyD88, nuclear transcription factor (NF)-κB, co-stimulatory molecule CD28 expressed on the surface of T lymphocytes, CD40, a member of the tumor necrosis factor receptor superfamily, interleukin (IL)-1β, and tumor necrosis factor (TNF) α. The results show：Among the two immunization methods, except for the expression amount of genes of IL-1β in liver and kidney and that of MyD88 in liver in the immersion group being lower than that in the control group, the expression of genes in other tissues showed an upward trend compared with that in control group. In addition, under the immersion immunization mode, except for the TNF-α gene, the tissues with the highest gene expression among the four tissues were gill or spleen；Under injection immunization, the tissues with the highest gene expression among the four tissues were liver or kidney. Also in the immersion group the vast majority of genes showed, at 0h of immune treatment, significantly higher expression than in the control group. The results show that：Both immunization modalities elicited an immunoprotective response in semislippery tongue sole, and there was organizational variability in the expression of immune-related genes through the different immunization modalities.
Research Article
The Effect of Inactivated Vaccine on the Expression of Some Immune-Related Genes in Semislippery Tongue Sole (Cynoglossus Semilaevis)
https://doi.org/10.21203/rs.3.rs-2730972/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Cynoglossus semilaevis
Luminescent Bacillus Mermaid mermaid subspecies inactivated vaccines
injection immunization
immersion immunization
immune-relevant genes
Cynoglossus semilaevis is one of the important economic marine fishes, which is frequently infected with skin ulcer disease during its culture, which causes great economic losses to the culture industry.
Photobacterium damselae subspecies Damselae was isolated from a species of temperate-water damselfish, the blacksmith (Chromis punctipinnis) suffering from skin ulcers in 1981. Since then, it has been found in many marine fishes, such as seriola quinqueradiata , redbanded seabream, oncorhynchus mykiss and trachinotuscvatus. In recent years, the pathogenic bacteria were successively isolated from Semislippery tongue soles with skin ulcers. When the semisllipery tongue soles are infected, the sick fish have hemorrhagic hepatomegaly, surface bleeding, skin ulcers and other symptoms, which will not only lead to large-scale death of farmed fish, but also lead to white scars on the ulcerated epidermal scales of the healed fish, which affects its commercial value[7-8]. At the same time, it is reported that this pathogen，being a pathogenic bacteria, which will infect both humans and fish, causes quick onset and high mortality rate[2] after infection. Therefore, how to effectively control the disease caused by the bacteria is very important. Compared with the traditional way of preventing and curing the disease by using antibiotics and chemical drugs, vaccination is the most-appropriate and most effective method for the control of fish diseases causing by bacteria and viruses[9]. For the evaluation of vaccine immune effect, there are more and more reports of immune effect evaluation from the detection of immune-related gene expression, such as Toll receptor signaling pathway, co-stimulatory molecules expressed on the surface of adaptive immune cells, immune response molecules, such as cytokines, that play an important role in fish immune response.
In June 2018, a large number of cynoglossus semilaeves were found dead in a farm in Bohai Bay, Tianjin. A strain of pathogenic bacteria were isolated from the diseased cynoglossus semilaeves. In view of the strong pathogenic ability of the bacterium against the semislippery tongue sole, and since the current research on the immune effect of the inactivated vaccine prepared by the pathogenic bacterium has rarely been reported, this study intends to use the mermaid subspecies of Mermaid Luminescent Bacilli to prepare a whole-bacteria inactivated vaccine, and immumize the semislippery tongue soles by intraperitoneal injection and immersion, and use a fluorescence quantitative PCR instrument to detect the expression changes of 7 immune-related genes in the liver, kidney, gills and spleen of the fish at 9 time points, and evaluate the immune effect triggered by the vaccine from the gene level. It aims to provide theoretical support for the development and application of disease prevention and treatment methods caused by the mermaid subspecies of Luminescent Bacilli Mermaid.
Laboratory Animals
Some Cynoglossus semilaeves were purchased from a Tianjin aquaculture farm, between 12 cm and 15 cm in length, in good health and vigor, and kept in a recirculating water system in the laboratory for one week prior to the official start of the experiment.
Preparation of Whole Bacteria Inactivated Vaccine against Mermaid Luminescent Bacillus Mermaid Subspecies（Photobacterium damselae subsp. Damselae）
Bacteria were inoculated in 2216E solid medium and cultured at 28°C for 24 hours. Single colony was selected and cultured in 2216E liquid medium at 28℃ for 24 hours. Centrifuge at 4°C for 15 min at 7000 rpm and leave the precipitate, then wash the precipitate with PBS and repeat 3 times. Resuspended with PBS containing 0.3% formaldehyde (v/v) and placed at 28°C for 15h. Then incubate on transfer to solid medium to confirm no viable bacteria growth, centrifuge again at 4°C for 15 min at 7000 rpm and rinse with PBS, and repeat 3 times. Finally, the concentration of the bacterial solution was adjusted to 1×108 CFU / mL with sterile PBS and stored at 4°C.
Immunosampling of Semislippery Tongue Soles
Healthy experimental fish were irregularly divided into 4 treatment groups, each of which was further divided into 8 groups with 12 fish in each group. The first treatment group was immersed in 1x108 CFU/mL of vaccine solution for 30 min as the immersion group; the second treatment group was immersed in seawater for 30 min and served as an immersion control group；the third treatment group was injected with 0.2 mL of 1x108 CFU/mL of Vaccine bacteria liquid per fish as the injection group；the fourth treatment group was injected with 0.2 mL of sterile PBS per fish and served as the injection control group. Tissue samples were randomly obtained from 8 panels of each treatment group at 9 time points, 0h, 4h, 8h, 12h, 24h, 48h, 72h, 96h and 7d after immunization for each group. Finally, 1 fish was taken from each of the four groups, ie., the soaking group, the injection group and the two control groups, at each time point, totaling 8 fish. At the same time, four tissues of the liver, kidney, gill and spleen, were immediately dissected and quick frozen in liquid nitrogen and stored at -80°C for subsequent detection of immune-related gene expression.
Extraction of RNA and Synthesis of cDNA
Total RNA was extracted using the Takara MiniBEST Universal RNA Extraction Kit. RNA integrity was examined by 1.2% agarose gel electrophoresis, and the RNA concentration and purity of each sample was measured by micro-nucleic acid meter. Extracted RNA is synthesized into cDNA by using a reverse transcription kit(PrimeScriptTMRT reagent kit Takara) in which reverse transcription primers were used with random primers and Oligo DT. The synthesized cDNA samples were stored at -20°C.
Design and Validation of Primers used for Fluorescent Quantitative PCR
Based on the known gene sequences of the immune genes β-actin, TLR2, MyD88, (NF)-κB, CD40, CD28, IL-1β, and TNF-α in cynoglossus semilaeves, specific primers were designed using Premier 5.0 software. cDNA samples from liver, kidney, gill, and spleen were selected It is first amplified using common PCR methods, and by agarose gel electrophoresis, the product with a single band is selected as primers. The PCR reaction was then performed using TBGreen®Premix Ex Taq™II (Takara, Japan) in Bio-Rad IQ5, and primers with a single peak profile curve as the melting curve and with amplification efficiency of 90%-110% were selected as specific primers for the final experiment.
Fluorescent Quantitative PCR Detection
β-actin was used as an internal reference gene and amplified on a real-time fluorescent quantitative PCR (qRT-PCR) Bio-Rad IQ5 using the TBGreen ®Premix Ex Taq ™II (Takara) kit. The amplification system is 20μl, that is: 2 μl template cDNA (<100ng), 0.8 μl each of PCR forward and reverse primers (0.4 μm/L final primer concentration), 10 μl TB Green Premix Ex Taq II (Tli RNaseH Plus) (2X), 6.4 μl sterilized water, and three parallels were set up for each sample. Set the amplification program to: 95°C 30s,1 cycle；95°C 5s；60°C 30s,40 cycle；The melting procedure is：95°C 5s,60°C 1min,95℃ 1 cycle；50°C 30s cooling. The melting curve analysis of the amplified product was added to confirm that only the target product was amplified, in which the target gene and the reference gene were amplified in separate wells, and the Ct value was obtained for data processing and analysis.
Data Processing and Analysis
Fluorescence quantitative data analysis was performed using the 2 -ΔΔCt method, and all values have mean ± standard deviation (
SD) representation, using Origin 8.0 for graphing and SPSS 25.0 for statistical data analysis. Differences in gene expression at different time points were determined by using a one-factor square (One-Way ANOVA). Statistical significance was considered when p <0.05.
Acquisition of Primers used for Fluorescence Quantification
Eight gene-specific primers were finally obtained through the validation of conventional PCR amplification--electrophoresis single bands, fluorescence quantitative PCR single melting curve and amplification efficiency. The sequence of primer name, annealing temperature and amplification efficiency of each gene are shown in Table 1：
Table 1 Primers Used for Fluorescent Quantitative PCR
|
Primer |
Sequences(5’-3’) |
TM |
Amplification efficiency |
NCBI Accession number |
|
β-actin-F |
GCTGTGCTATGTCGCCTTG |
59.28 |
96.4% |
NM_001308179.1 |
|
β-actin-R |
TACCAAGGAAGGAAGGCTGG |
59.01 |
|
|
|
TLR2-F |
TGTTACGGTTTGACTGGCGT |
60.18 |
102.2% |
XM_025061574.1 |
|
TLR2-R |
AAGATTGGGCATGTAGCCCC |
60.11 |
|
|
|
MyD88-F |
GTGTGTGGACCATCACGAGT |
59.97 |
91.3% |
NM_001294201.1 |
|
MyD88-R |
ACGTTTCTTCTCGGCTCCAG |
60.04 |
|
|
|
NF-κB-F |
AGCTACGAGGTCTCAGGAGG |
60.11 |
102.9% |
XM_025063059.1 |
|
NF-κB-R |
CCTCTACAGTGGAGCCTTGC |
60.11 |
|
|
|
CD28-F |
AGATTGGACTTGCTGTTGAT |
54.93 |
104.2% |
XM_008325487.3 |
|
CD28-R |
GGCTTGGTGTTGATGTAGT |
55.10 |
|
|
|
CD40-F |
ATTCGTGTCATTCGCTCGC |
59.00 |
107% |
XM_025059755.1 |
|
CD40-R |
ACTGTGTGCCAAAGATGTCCC |
60.82 |
|
|
|
IL-1β-F |
ATCTCGAGGAAGTGAAGGACCC |
61.21 |
96% |
NM_001297581.1 |
|
IL-1β-R |
ATAGCGCTGGCTGGTCTCT |
60.76 |
|
|
|
TNF-α-F |
CGACACCTGGCTGTAAACGA |
60.32 |
100% |
XM_008331806.3 |
|
TNF-α-R |
CAACCCCAAAATGACCAACTC |
57.61 |
|
|
TLR2 Expression in Liver, Kidney, Gill and SpleenTLR2
The expression of TLR2 in the liver of soaking group was significantly higher than that of the control group at 0h, and the expression of TLR 2 in the two experimental groups increased first and then decreased at other time points, which was consistent with the change of the expression of MyD88 in injection immunization. The expression of TLR2 in the liver of soaking group was the highest at 48h, which was 2.37 times that of the control group, while the expression of TLR2 in injection group was the highest at 12h, which was 2.72 times that of the control group. The transcription value of TLR2 in the kidney of soaking group was significantly higher than that of the control group from 0h, and then the transcription level was basically 1-3 times that of the control group from 4h to 7d, and its expression peak was 2.87 times that of the control group at 72h, and then gradually decreased；In the kidney of the injection group, the number of transcripts increased significantly from 8h, and the maximum value appeared at 72h, which was 5.78 times that of the control group, and then the expression gradually became lower until 7d when it was basically not significantly different from the control group. In gill tissues, the transcriptional values of TLR2 in the immersion group appeared to increase and then decrease, reaching a peak at 8h, which was 3.3 times that of the control group, and the expression at subsequent time points was basically 1-2 times that of the control group；However,TLR2 expression in the gills of the injection group reached a small peak at 48 h, which was 4.36 times that of the control group, followed by a peak at 7d. In the spleen of the soaked group, the expression of TLR2 reached a peak at 0h, and then appeared to increase and then decrease, with the maximum value at 48h being 1.75 times that of the control group；However, in the spleen of the injection group, the expression of TLR2 showed a trend of increasing first and then decreasing, and reached the maximum at 24 hours, which was 1.9 times that of the control group. TLR2 was significantly elevated in all four organs across immunization modalities, with faster onset of immunization in the liver, kidney and spleen in the immersion group than in the injection group, with higher gene upregulation in the gill tissue than in the other tissues in the immersion group, and significantly higher levels of gene upregulation in the kidney than in the other tissues in the injection group.
Expressions of MyD88 in Liver, Kidney, Gills and Spleen
The expression of MyD88 in the liver of the immersion group all showed a down-regulation performance, MyD88 was significantly lower than the control group from 4h, and then continued to decline, reaching the lowest at 8h, which was 0.4 times that of the control group, and then gradually up-regulated. the expression of MyD88 in the liver of the injection group showed a trend of rising, then falling and then rising again, reaching the first small peak of expression after 8h of injection, after which the expression became smaller， and the highest peak of expression was reached at 96h, with the two peaks being 1.52 and 3.33 times that of the control group. In the kidney, the expression of MyD88 was basically unchanged in the immersed group compared with the group immersed in seawater, and a small peak of expression occurred in the immersed group at 8h, which was 1.21 times that in the control group. However, the expression level in the injection group increased first, then decreased and then rose again. The two small peaks of expression level appeared at 8 hours and 72 hours respectively, which were 3.44 times and 1.99 times that of the control group. In gill tissue, compared with the control group, the expression level of MyD88 in the soaking group reached the first peak at 0h, which was 2.99 times that of the control group, and then decreased rapidly and then rose again, and the second peak at 7d was 2.77 times that of the control group. However, in the injection group, MyD88 increased in gill from 0 to 4 hours, and reached the first peak at 4 hours, which was 2.06 times that of the control group, and then showed a trend of decreasing and then increasing, and the expression reached the peak at 72 hours, which was 2.66 times that of the control group. In the spleen, MyD88 reached a peak at 0 h in the immersion group, similar to the trend at 0 h in gill tissue, after which it rapidly became lower and showed a second small climax at 7d, which was 2.14 times that of the control group. In the injection group, MyD88 basically increased first and then decreased, and its peak appeared at 24 hours, which was 1.85 times that of the control group.
Expression of NF-κB in Liver, Kidney, Gills and Spleen
In the liver, NF-κB showed an overall increase, then decrease and then increase in both experimental groups, reaching its first maximum at 48 h, which was 1.3 times that of the control group, and its maximum at 7d, which was 2.15 times that of the control group. In contrast, in the injection group, NF-κB showed a rise in the liver from 0-8h, with a peak at 8h, which was 3.17 times that in the control group, and showed a trend of decreasing before rebounding in the following time points, and the expression increased at 7d, which was 2.03 times that in the control group. In kidney tissues, the expression of NF-κB in the immersion group was significantly higher than that in the control group from 0h, 1.42 times that in the control group, and the transcript level was basically lower than that in the control group in the following time points. However in the injection group, the expression of NF-κB appeared to first increased and then decreased, reaching a peak expression at 8 h, which was 3.32 times that of the control group. In the gill tissues, the NF-κB expression in the immersion group first decreased and then increased, and the lowest and highest values of expression were 0.4 and 2.67 times at 8h and 72h, respectively. The expression of NF-κB in the immersion group was significantly higher than that in the control group from 72h, while it still maintained a relatively high level at 7d, while the expression in the injection group basically showed a phenomenon of increasing and then decreasing, with its expression reaching a peak at 4h, which was 3.2 times that of the control group, and then gradually decreasing, with no significant difference from that of the control group at 7d. In spleen, after the expression of MyD88 in the immersion group reached the highest peak at 0h, it declined rapidly thereafter and showed an overall slow increase during the time point of 4h-7d, reaching a second small peak of expression at 7d, which was 2.64 times higher than that of the control group. However the expression trend of MyD88 in the injection group showed a rising trend followed by a decreasing trend, reaching a maximum at 24 h and then slowly decreasing.
Expression of CD40 in Liver, Kidney, Gills and Spleen
The CD40 gene transcripts were significantly higher in the four tissues of the immersion group at 0h than in the control group. In liver and kidney, the CD40 gene transcripts in the soaking group were significantly less expressed than the control group at all time points except for 0h. However, the total expression of CD40 in the liver of the injection group increased at first and then decreased. The highest transcription level was 2.62 times that of the control group at 8 hours, and then the expression level gradually decreased. At 7days, the expression level reached the second small peak, which was 2.03 times that of the control group.The expression of CD40 in the kidneys of the injection group showed a general trend of increasing and then decreasing, and the expression at 8 h was significantly higher than that of the control group, which expression was 4.51 times of its transcript amount, and then the expression decreased and peaked again at 7d, which was 2 times higher than that of the control group. In gill tissues, CD40 in the soaking group showed a trend of up-regulation, then down and then back up, reaching a small peak of expression at 8h, which was 1.9 times higher than that of the control group, followed by a down-regulation, and the expression reached peak at 7d, which was 2.28 times that of the control group. However the transcript amount of CD40 in the injection group showed a trend of increasing and then decreasing, and the maximum transcript amount appeared at 48 h, which was 1.64 times that of the control group, and then the expression amount slowly decreased and at 7d,there was no significant difference between the expression amount of the injiction group and that of the control group. In the spleen, the expression of CD40 in the immersion group was significantly higher than that in the control group at 0h and 7d, and significantly lower than that in the control group at the rest of the time. However in the injection group, the total transcription increased first and then decreased, reaching a maximum of 1.99 times that of the control group at 24 hours, and then decreased to 7days, which was significantly lower than that of the control group. Overall, the highest expression level of CD40 in 4 tissues in the soaking group appeared earlier than that in the injection group, but the transcription level of CD40 in liver, kidney and gill tissues in the injection group was higher than that in the soaking group.
Expression of CD28 in the Liver, Kidney, Gills and Spleen.
CD28 showed a significant overall down-regulation in the livers of the soaking group, while the expression was significantly lower than that of the control group. In the injection group, the expression of CD28 in the liver showed an overall trend of increasing and then decreasing, and the transcript amount from 8h was significantly higher than that of the control group while the maximum value appeared, which was 2.98 times higher than that of the control group. A second small peak of expression occurred at 7d, which was 1.76-times that of the control group. The CD28 transcripts amount at 0h in the kidney, gill and spleen of the immersion group showed higher expression than that of the control group. In the kidney, the expression of CD28 in the immersion group was significantly higher than that in the control group at 8h, 1.38 times that of the control group, and reached a second peak of transcription by 96h, 1.28 times that of the control group. However in the injection group, the overall expression trend was up-regulated and then down-regulated, which was significantly higher than that of the control group at 4h, and the highest transcript peak appeared at 48h, which was 2.25 times that of the control group. In gill tissue, the overall expression level rose, declined and rose. After 4 hours, the expression level gradually increased, and it was significantly higher than that of the control group at 24 hours, reaching the first small peak of expression level, which was 2.34 times that of the control group. The maximum expression was reached at 7d, which was 2.6 times that of the control group. In the injection group, the expression of CD28 in gills was significantly upregulated at 7d compared with the control group, and the transcript levels at the rest of the time were not significantly different from the control group. In the spleen, the expression trend of CD28 in the immersion group was similar to that in the gill, and the overall expression in the spleen showed a rising, falling and rebounding performance, and the transcript amount gradually increased after 4h. The first small peak of transcript amount appeared at 24h, which was 2.29 times that of the control group, and reached the maximum expression amount at 7d, which was 2.96 times that of the control group. In the injection group, the expression of CD28 in the spleen showed an overall phenomenum of increase and then decrease, reaching a maximum transcript level at 24h that was 1.9 times that of the control group.
IL-1β Expression in Liver, Kidney, Gills and Spleen
The transcript levels of IL-1β in the liver and kidney of the immersion group were significantly lower than those of the control group, while the overall trend of IL-1β expression in the liver of the injection group showed an increase and then down-regulation, reaching the highest value at 8 h, which was 15.19 times that of the control group, and then showed a down-regulation trend to 2.36 times the expression of the control group at 7d. The expression trend of IL-1β in the kidney of the injected group showed a general trend of increasing and then decreasing, and the expression of IL-1β reached the highest value at 48h, which was 3.1 times that of the control group, and then decreased to 1.68 times that of the control group at 7d. In gill tissues, two expression peaks of IL-1β were observed in the immersion group, at 0h and 7d, with transcripts 11.99 and 6.6 times that of the control group. However in the injection group, the transcript amount of IL-1β was highest at 4h, reaching 10.13 times that of the control group. After that, the expression was down-regulated and reached the highest value at 96h, which was 14.7 times that of the control group. In the spleen, the transcripts of IL-1β in the immersion group were significantly lower than those in the control group until 96h. The expression was highest at 7d, which was 6.73 times that of the control group. However the expression of IL-1β in the injection group showed an overall trend of rising and then down-regulating, with two swings to a peak at 4h and 24h in 9 time points, which were 3.6 and 2.56 times those of the control group, respectively, after which the expression decreased.
TNF-α Expression in Liver, Kidney, Gills and Spleen
The expression of TNF-α in the liver, kidney, gill and spleen of the soaking group was significantly higher than that of the control group at 0h. In the liver, the expression of TNF-α in the soaking group showed a trend of up-regulation followed by down-regulation from 4h-7d, and was significantly higher than that in the control group at 12h, reaching the highest value at 48h, which was 2.14 times that of the control group, and then decreased to 7d when there was no significant difference with the expression in the control group. However, in the injection group, the peak of TNF-α transcription appeared at 4h, 12h and 7d, respectively. The transcription level at 4h was significantly higher than that in the control group, and the peak of TNF-α expression appeared at 12h, which was 7.41 times that of the control group. In the kidney, the expression of TNF-α in the soaking group showed a downward trend from 4h to 7d, and the highest expression level appeared at 24h, which was 3.28 times that of the control group. After that, the expression level was down-regulated, and there was basically no difference between the soaking group and the control group at 7days. However, the expression of TNF-α gene in injection group reached the first small peak at 8 hours, which was 4.47 times that of control group, and then the expression decreased first and then increased, and the transcription reached the peak at 48 hours, which was 5.91 times that of control group. In gill, the transcription of TNF-α in soaking group increased obviously at 24 hours, and the maximum transcription reached at 72 hours was 2.37 times that of control group. However the expression of TNF-α gene in the injection group showed a maximum at 4h that was 3.3 times that of the control group, and the expression at the subsequent time points was one time that of the control group. In the spleen, TNF-α transcripts were significantly higher in the soaking group than in the control group at 24h. The maximum transcript level appeared at 7d, which was 9.09 times that of the control group. The TNF-α transcript level in the injection group showed an overall trend of increasing and then decreasing, and its maximum transcript level appeared at 24h, which was 2.72 times higher than that of the control group, and then slowly decreased to a significantly lower expression than that of the control group.
Expression of Immune Gene-Related Genes
Toll-like receptors are pattern recognition receptors (PRRs) on the surface of cell membranes that recognize specific molecular structures (PAMPs) common to the surface of bound microorganisms. TLR2-activated signals are transduced through MyD88, ultimately leading to the activation of multiple downstream transcription factors (e.g. NF-κB). These transcription factors upregulate the transcription of pro-inflammatory cytokines and various organismal defense proteins (e.g., TNF, IL-1β), thereby activating the innate immune response [15-16]. In this study TLR2, MyD88 and NF-kb genes involved in the Toll-like pathway of innate immunity showed a trend of upregulation of gene expression within 48h after immunization. One study found that TLR2 expression in the liver and intestine was significantly higher in Edwardsiella Tarda-infected semislippery soles than in the control group for 24h[17], and the transcription of TLR2 in spotted forktail catfish and long-finned forktail catfish increased after 1 day of infection by Edwardsiella tarda [18].For the semi-slippery tongue soles with intraperitoneal injection of inactivate vibrio eel， MyD88 in the head and kidney of vibrio eel rose to the highest value at 8h[19]. The expression of MyD88 in liver, kidney and spleen showed significant up-regulation within 48h after vibrio eelis infection of Miichthys miiuy [20]. A significant increase in NF-κB expression was also observed in all three tissues in ashort period (within 48h) after immunization of dental flounder with Vibrio eelis inactivated vaccine [21]. The above findings suggest that gene expression in the Toll-like pathway occurs in multiple tissues and that gene expression in this pathway is upregulated in a short period of time after stimulation. At the same time, in this study, the highest expression levels of IL-1β and TNF-α were 15 times higher than those of the control group. As a pro-inflammatory cytokine, IL-1β can cause the body's inflammatory reaction, which is a protective mechanism used by the body to remove harmful stimuli and start the healing process [22], which further reveals that after the pathogen infects Cynoglossus semilaevis, the genes of this pathway are activated and participate in the body's immune protection response.
The induction of adaptive immune response depends on the expression of costimulatory molecules and cytokines in antigen presenting cells. Toll receptor expression can induce the activation of NF-κB and regulate the expression of inflammatory cytokines IL-1β, IL-6 and costimulatory molecule B7, thus activating natural T cells [23]. The expression of CD28 and CD40, which are involved in adaptive immune responses, also appeared to be upregulated in this study, and CD28 and CD40 have been reported to be involved in the transduction of the second signaling of T cell/B cell activation [24]. Similar to this result, the transcript levels of CD40 in the liver, spleen and kidney were also significantly higher than in the control group for a shorter period of time after infection of semislipperysole with Vibrio harveyi[25]. Although innate and adaptive immune functions have been clearly classified, in practice they are closely linked and require a highly organized arrangement to complete the understanding of the host infection elimination process [26]. It is speculated that while the Toll-like pathway exerts innate immunity, inactive pathogens entering the body are also recognized by antigen-presenting cells of adaptive immunity and begin to activate signal transduction, and whether it exerts adaptive immunity effects needs to be studied in more depth in conjunction with more gene expression changes in the pathway or detection of antibody titer in serum. At the same time, genes in the same pathway did not show a theoretically consistent up and down trend, and it is speculated that this difference is related to the complex and ordered immune response mechanism of the organism and the complex composition of inactivated vaccines.
Comparison of the expression levels of the same gene in different tissues under the same immunization modality
The analysis showed that in the injection immunization mode, the tissues with the highest expression of seven different immune-related genes were liver or kidney, while in the immersion immunization, the tissues with the highest expression of seven different immune-related genes were gill or spleen. For example, the highest TLR2 gene expression in four different tissues under the intraperitoneal injection immunization modality was in the kidney, and the highest expression in the immersion immunization modality was in the gill. Summary found that: it was found that the tissues with the highest expression of the seven genes under the intraperitoneal immunization modality were the liver and kidney. However the highest expressions of the six genes in the four tissues under the immersion immunization approach, except for the TNF-α gene, were in the gill and spleen. It is speculated that this may be caused by the different immune responses induced by the two immune modes on the body of Cynoglossus semilaevis. Under the immersion immune mode, the tissues that first contact the inactivated vaccine through gills, skin and other organs cause a stronger non-specific (mucus) immune response, while the immune protective response produced by other immune tissues in the body is weaker. By further analysis of the data, it was obtained that under the immersion immunity mode, except for the TLR2 genes of gill tissue and the IL-1β genes of spleen tissue, the expression of genes detected by dissection of the gills and spleen tissues after 30 minutes of immersion immunity was higher than that of the control group. This result further illustrates that the non-specific (mucus) response of fish is activated more rapidly with immersion immunization. One study found that after immunization of fish with Aeromonas hydrophila vaccine under three immunization modalities: injection, immersion and oral, showed that the peak of antibodies appeared earlier in the immersion and oral modalities than in the injection group [27]. Immunization of grass carp with grass carp reovirus immersion increased IgM expression and significantly improved innate immune function [28]. All of these results suggest that immersion immunity stimulates stronger nonspecific (mucus immunity) immunity. This may be related to the presence of various immunopreventive factors (e.g., lysozyme and antimicrobial peptides) in fish epidermal mucus that inhibit bacterial growth and block pathogen invasion, as well as the presence of IgM-specific antibodies in the mucus that exert a direct immune effect against invading pathogens [29]. Because the mermaid luminescent bacillus mermaid subspecies has a strong specific adhesion to skin mucus, the skin of susceptible fish may be one of the main pathways of infiltration [30], so more in-depth studies about the non-specific (mucus) immune response induced after immunization with semislippery tongue sole should be conducted to better solve the problems in practical production applications.
In this study, the whole inactivated vaccine was prepared by using Mermaid Luminescent Bacillus Mermaid Subspecies. Cynoglossus semilaevis was immunized by two immunization methods, and the expression changes of seven immune-related genes in four tissues were detected by fluorescence quantitative PCR. The results showed that both immunization modalities induced immune-related gene changes in semislippery tongue sole, activated the body's immune response, released pro-inflammatory cytokines, enhanced the body's anti-bacterial immune response, and signaling of adaptive immunity was also activated. At the same time, the expression of the same gene in the same tissue will be different under different immunization methods. The research results have provided theoretical support for the development and application of prevention and treatment methods of diseases caused by Mermaid Luminescent Bacillus Mermaid Subspecies.
Funding
The study was supported by Tianjin Municipal Science andTechnology Commission (grant number 18YFZCNC01190)and Innovation and Entrepreneurship Training Program for College Students（202110061078）. We also would like to thank Editage [www.editage.cn] for English language editing
Authors’ contributions
PS helped perform the analysis with constructive discussions and the study design .
QY performed wrote the manuscript and contributed to the conception of the study
ZY contributed significantly to analysis and manuscript preparation
JZ performed the data analyses
LJ performed the statistical analysis
WY contributed to literature search
HC performed the data analyses
FM contributed to rear fish
NL contributed to collected the data
The author(s) read and approved the fnal manuscript.
Availability of data and materials
The 16S rRNA gene sequence of EPL 0201 strain has been submitted to GenBank (https://www.ncbi.nlm.nih.gov/genbank/; accession number OL687343).
Ethics approval and consent to participate
All animal experiments were approved by the Animal Experiment Ethics Committee at Tianjin Agricultural University, China.
All methods were performed in accordance with relevant guidelines and
regulations.
All methods are reported in accordance with ARRIVE guidelines (https://arriv
eguidelines.org) for the reporting of animal experiments.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
- Zhang Z, Wang Y G, Wang L, et al. A preliminary investigation on the main diseases and epidemic charac -teristics of cultured half-smooth tongue sole[J]. Fisheries Science &Technology Information, 2012, 39(2) : 65-69.[2] Love M, Teebken F D, Hose J E, et al. Vibrio damsela, a Marine Bacterium, Causes Skin Ulcers on the Damselfish Chromis punctipinnis[J]. Science ,1981,214(4525):1139-1140.
- Sakata T, Matsuura M, Shimokawa Y. Characteristics of Vibrio damsela isolated from diseased yellowtail Seriola quinqueradiata.[J]. Nippon Suisan Gakkaishi, 1989, 55(1):135-141.
- Labella A, Vida M, Alonso MC, et al.First isolation of Photobacterium damselae ssp. damselae from cultu -red redbanded seabream, Pagrus auriga Valenciennes, in Spain[J]. Journal Fish Disease,2006,29(3):175-179.
- Pedersen K, Skall H F, Lassen A M, et al. Photobacterium damselae subsp. damselae, an emerging pathog -en in Danish rainbow trout, Oncorhynchus mykiss (Walbaum), mariculture[J]. Journal of Fish Diseases,2009, 32(5):465-472.
- Zhao D H, Sun J J, Liu L, et al. Characterization of Two Phenotypes of Photobacterium damselae subsp. damselae Isolated from Diseased Juvenile Trachinotus ovatus Reared in Cage Mariculture[J]. Journal of the World Aquaculture Society, 2009, 40(2):281:289.
- Yan L, Zhang Z Q, Wu T L.et al.Isolation and Identification of Photobacterium damselae subsp．damselae from Tongue Sole[J]. Chinese Journal of Veterinary Drug,2018,52(2):19-25.
- Shao P, Yong P Z, Zhou W L, et al. First isolation of Photobacterium damselae subsp. damselae from half -smooth tongue sole suffering from skin-ulceration disease [OL]. Netherlands: Aquacu-lture, 2019(0611). Ht -tps:// doi.org/10.1016/j.aquaculture.2019.734208.
- Rombout J H, Yang G, Kiron V. Adaptive immune responses at mucosal surfaces of teleost fish[J]. Fish& Shellfish Immunol, 2014,40:634~643.
- Hu Y H, Sun B G, Deng T, et al. Molecular characterization of Cynoglossus semilaevis CD28[J]. Fish & Shellfish Immunology, 2012, 32(5):934-938.
- Li Y W, Luo X C, Dan X M, et al. Orange-spotted grouper (Epinephelus coioides) TLR2, MyD88 and IL -1β involved in anti-Cryptocaryon irritans response[J]. Fish & Shellfish Immunology,2011,30(6):1230-1240.
- Hollenbaugh D, Ochs H D, Noelle R J, et al. The role of CD40 and its ligand in the regulation of the im -mune response[J]. Immunological Reviews, 1994,138(1):23~37.
- Hirono I, Nam B H, Kurobe T, Aoki T. 2000.Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder Paralychthys olivaceus[J]. Journal of Immunology
- ,165(8):4423~4427.
- Seppola M, Larsen A N, Steiro K, et al. Characterisation and expression analysis of the interleukin genes, il-1β, il-8 and il-10, in atlantic cod (gadus morhua L) [J]. Molecular Immunology, 2008,45(4): 887~897.
- Arancibia S A, BELTRáN C J, Aguirre I M, et al. Toll-like Receptors are Key Participants in Innate Immune Responses[J]. Biological Research, 2007, 40(2):97-112.
- Frederick J,Luke A. The troll in toll:mal and tram as bridges for TLR2 and TLR4 signaling[J]. Journal of Leukocyte Biology, 2007, 82(2):196~203.
- Samanta M , Swain B , Basu M, et al. Molecular characterization of toll-like receptor 2 (TLR2), analysis of its inductive expression and associated down-stream signaling molecules following ligands exposure and bacterial infection in the Indian major carp, rohu (Labeo rohita)[J].2012, Fish & Shellfish Immunology,32(3): 411~425.
- Baoprasertkul P, Peatman E, Chen L, et al. Structural characterisation and expression analysis of Toll-like receptor 2 gene from catfish[J]. Fish & Shellfish Immunology, 2007,22(4):418-426.
- Yu Y, Zhong Q W, Zhang Q Q, et al. Full-length sequence and expression analysis of a myeloid differentiation factor 88 (myd88) in half-smooth tongue sole Cynoglossus semilaevis[J]. International Journal of Immunogenetics,2009 , 36(3):173~182.
- Tang D, Gao Y H, Wang R X, et al. Characterization, genomic organization, and expression profiles of MyD88, a key adaptor molecule in the TLR signaling pathways in miiuy croaker (Miichthys miiuy)[J]. Fish Physiol Biochem,2012, 38(6):1667-1677.
- Xue J, Song J, Xing J, et al.Expression Analysis of Thirteen Immune Related Genes of Flounder(paralichth-ys olivaceus) vaccinated with Formalin-Inactivated Vibrio anguillarum[J]. Periodical of Ocean University of China, 2016, 46(2):42-53
- Zhang X, Wang S L, Chen S L, et al. Transcriptome analysis revealed changes of multiple genes involved in immunity in Cynoglossus semilaevis during Vibrio anguillarum infection[J]. Fish & Shellfish Immunology,2015,43(1):209-218.
- Medzhltov R, Preston-Hurlburt P, Janeway C A. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity[J]. Nature, 1997,388(6640):394-397.
- Rombout J H, Yang G, Kiron V, et al. Adaptive immune responses at mucosal surfaces of teleost fish[J]. Fish &Shellfish Immunol, 2014,40:634~643.
- Wei Z F. Cloning and expression analysis of three immune genes, and the primary methylation analysis of CD40 promoter in half-smooth tongue sole (Cynoglossus semilaevis)[D].Shang hai: Shang Hai Ocean University,2016:1-72.
- Krishnan J, Selvarajoo K, Tsuchiya M, et al. Toll-like receptor signal transduction[J]. Experimental & Molecular Medicine, 2007, 39(4):421-438.
- Liu Y G, Pan H J, Shi C B, et al. Influence of Three Means of Immunization on Protection of Siniperca chuatsi Caused by Killed Aeromonas hydrophila Vaccine[J]. Journal of Guangdong Ocean University, 2011,31(4):81-85
- Liu Q F. Studies on the Cultivation of Grass Carp Reovirus by Microcarrier and the Immune Effect of Immersion with Killed Vaccine[D]. Shang hai: Shang Hai Ocean University,2013:1-61
- Bai S S, Jia Z Y, Shi L Y. Research Progress of Immune Response Mechanisms in Fish[J]. Chinese Jouranl Of Fisheries,2017,30(4):59-67.
- Fouz B, Toranzo A E, M Milán, et al. Evidence that water transmits the disease caused by the fish pathogen Photobacterium damselae subsp. damselae[J]. Journal of Applied Microbiology, 2000, 88(3):531-535.
No competing interests reported.