Ameliorating Prediabetes Symptoms via Aerobic Exercise Combined with Green Coffee and Chlorogenic Acid Intake by Targeting MondoA-TXNIP/ARRDC4-GLUT4 Axis inHigh Fat Diet-Induced Prediabetic Mice

doi:10.21203/rs.3.rs-2738434/v1

Download PDF

Research Article

Ameliorating Prediabetes Symptoms via Aerobic Exercise Combined with Green Coffee and Chlorogenic Acid Intake by Targeting MondoA-TXNIP/ARRDC4-GLUT4 Axis inHigh Fat Diet-Induced Prediabetic Mice

https://doi.org/10.21203/rs.3.rs-2738434/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background and Aim:

Type 2 diabetes (T2D) begins with prediabetes (PD), whose primary cause is insulin resistance (IR) in the muscle, liver, and adipose tissues, followed by hyperinsulinemia induced by beta (β)-cells and their destruction. As metabolic balance and homeostasis in the human body heavily depend on skeletal muscles, metabolic syndrome (MetS), hepatic steatosis (HS), and T2D may all occur by skeletal muscle failure. Improving understanding of the molecular mechanisms of muscle energy homeostasis and IR may accordingly help in discovering novel methods for combating metabolic disorders, like T2D. In this way, MondoA, an essential glucose-responsive transcription factor regulated by nutrients, such as glucose 6-phosphate (G6P), can reduce the increased amount of glucose inside the cell and prevent more glucose from entering the cell by amplifying the expression of two insulin pathway suppressors, viz, thioredoxin-interacting protein (TXNIP) and arrestin domain containing protein 4 (ARRDC4), under normal conditions. Against this background, the main objective of the present study was to examine the effects of aerobic exercise (Exe) alone and in combination with green coffee (GC) and chlorogenic acid (CGA) intake on the MondoA activity and the expression of its target genes in the skeletal muscles of a high-fat diet (HFD)-induced PD mouse model.

Materials and Methods

To develop PD, the C57 black 6 (C57BL/6) mice recruited in this study received an HFD for 12 weeks. Upon confirming the PD induction, the animals were given Exe, GC, CGA, or their combination for 10 weeks. Afterward, the metabolic data, i.e., fasting blood sugar (FBS), glucose tolerance test (GTT), the homeostatic model assessment for IR (HOMA-IR) index, plasma insulin levels, together with the cellular localization of MondoA and glucose transporter type 4 (GLUT4), as well as the TXNIP and ARRDC4 expression in the myocytes from various groups were evaluated.

Results

After administering the treatments in this study, the results established a downward trend in the TXNIP and ARRDC4 expression, a drop in the presence of MondoA in the cell nucleus, and a rise in GLUT4 in the muscle cell membrane.

Conclusion

By reducing the MondoA activity in the cell nucleus and expanding the presence of GLUT4 in the cell membrane, Aerobic exercise alone and in combination with green coffee and chlorogenic acid intake may be thus useful in lowering blood sugar and improving PD conditions in mice.

MondoA

Aerobic exercise

Green coffee

Cholorogenic asid

TXNIP

Prediabetes (PD) represents a condition of hyperglycemia, in which glycemic indices (GIs) are typically greater than the normal range, but below the diabetes threshold[1]. PD has also been defined by two primary indicators, namely, impaired fasting glucose (IFG) and impaired glucose tolerance (IGT). In other words, fasting blood sugar (FBS) in PD patients is between 100 and 125 mg/dL, after 8 h. In addition, the 2-h glucose tolerance test (GTT) results range from 145 to 199 mg/dL[2].

The major cause of PD is insulin resistance (IR) in the muscle, liver, and adipose tissues, followed by an upsurge in insulin production by the pancreatic beta (β)-cells. Higher IR ultimately leads to the death of the β-cells as well as abnormalities in insulin production, resulting in type 2 diabetes (T2D)[3]. In this way, the skeletal muscles account for around 40% of the bulk in the body, yet they absorb over 80% of glucose. Accordingly, any malfunctions in the muscles may cause conditions, including metabolic syndrome (MetS), hepatic steatosis (HS), and T2D. In this respect, the extensive knowledge of the molecular mechanisms controlling IR and muscle energy balance may help develop novel treatments for metabolic disorders, such as T2D[4]. Besides, the role of key transcription factors in the skeletal muscles involved in regulating the whole body’s metabolism has not yet been fully understood[5]. The IR development in the skeletal muscles and the PD emergence due to a high-fat diet (HFD) likely imply an upstream mechanism in the skeletal muscles. Recent studies have further demonstrated MondoA as a negative modulator of insulin sensitivity in such muscles. This transcription factor is responsible for the transcriptional alterations brought on by glucose[6]. MondoA is also a transcription factor that binds to carbohydrate response elements (ChoREs) in the promoters of its target genes, that is, thioredoxin-interacting protein (TXNIP), arrestin domain containing protein 4 (ARRDC4), and the genes implicated in fatty acid synthesis and triacylglycerol biosynthesis after creating a heterodimeric complex with max-like protein X (MLX)[7]. TXNIP and ARRDC4 are two members of the alpha (α)-arrestin family that inhibit glucose absorption in myocytes and adipocytes via promoting the glucose transporter type 4 (GLUT4) endocytosis. They are hence characterized as insulin pathway suppressors[8]. TXNIP and ARRDC4 also seem to prevent hypoglycemia and limit glucose absorption in myocytes and adipocytes during fasting by boosting the GLUT4 endocytosis. Moreover, they regulate the insulin sensitivity of the muscle and adipose tissues[9]. As evidenced, the MondoA-MLX complex is typically activated in response to a proliferation in glucose within the cell, followed by a rising trend in glucose 6-phosphate (G6P), glyceraldehyde 3-phosphate dehydrogenase (GAPD), and fructose 6-phosphate (F6P). Consequently, it reaches the cell nucleus and controls the expression of its target genes[7]. Under normal cellular conditions, this transcription factor further inhibits the flow of surplus energy into catabolic pathways in the skeletal muscles. On the other hand, abnormal cellular conditions, such as a HFD and excess food, lead to the constant activation of MondoA. Thus, a vicious cycle of IR and muscle fat deposition begins[10].

Improving lifestyle and doing regular physical activity are among the effective methods for preventing and treating some disorders, like T2D, HS, and PD[11]. Hence, exercise seems to be a useful non-pharmaceutical treatment for Metabolic disorder[12]. As reported, aerobic Exercise encourages glucose absorption, fat and glucose oxidation, and insulin sensitivity[13]. With the stimulation of non-insulin-dependent pathways, such as the adenosine monophosphate-activated protein kinase (AMPK), exercise may lead to the transfer of glucose into myocytes, circumventing insulin-signaling abnormalities during IR[14]. The anti-glycemic activities of phenolic acids, such as plant metabolites, have also been studied. On the other hand, Individuals now show a greater propensity to consume coffee regularly[15]. In this study, chlorogenic acid (CGA) was employed as one of the beneficial polyphenols in coffee, and as a green coffee (GC) supplement. Drinking coffee has been further demonstrated to aid in weight management in previous investigations[16]. For instance, the existing data have indicated that a daily intake of three to four cups of coffee decrease fat formation, calorie absorption, blood sugar, and increase insulin sensitivity and β-oxidation of fatty acids in the liver[17]. Besides, CGA controls glucose homeostasis, as shown by the animal and human models. While this mechanism of action is still unknown, certain studies have so far established that such biodrugs boost glucose absorption by activating AMPK and fueling the GLUT4 translocation to the membrane[18]. Moreover, coffee intake may lower blood glucose levels and modify IR conditions by improving Akt phosphorylation in the skeletal muscles[19]. Given the significance of PD and its role in public health, and the fact that this health condition is a warning sign of T2D, its timely diagnosis and treatment through lifestyle modifications with non-pharmacological methods, such as natural remedies, biodrugs, and exercise seem necessary. Accordingly, the present study aimed to evaluate the effects of exercise as well as GC and CGA intake on ameliorating PD by modulating the MondoA activity.

Study Design

After obtaining the approval by the Ethics Committee of, with the code no. IR.UI.REC.1400.080, this study was conducted under the supervision of the Biomedical Research Ethics Committee. In total, 35 male C57 black 6 (C57BL/6) mice, aged four weeks and weighing between 12 and 14 g were used in this study. The mice were kept at 23 ± 3°C with the cycle of 12-h light and 12-h darkness, and had ad libitum access to food and water. Following the one-week adaption, the animals were randomized into a control group (Con, n = 5) and an HFD one (n = 30). The Con group had a regular diet (namely, carbohydrates = 47.7%, fat = 12.5%, and protein = 20.5%), whereas the other mice received an HFD (that is, carbohydrates = 25%, fat = 60%, and protein = 15%) of saturated fats. Upon the PD development, the HFD group was divided into six subgroups (with five mice in each group), viz., prediabetic mice (PD group) the PD mice treated with Exe, CGA, GC, Exe + CGA, and Exe + GC (Fig. 1)[20–22].

Interventions

Green Coffee and CGA Supplements

GC tablets were purchased from Bonyan Salamat Kasra (BSK) Co. (Zist Takhmir, Tehran, Iran). These tablets contained 400 mg of standardized GC bean extract powder, with 2% caffeine and 50% CGA. GC (200 mg/kg) and CGA (100 mg/kg) were thus prescribed as gavage supplements three times a week for 10 weeks.

Aerobic Exercise Protocol

The animals were subjected to Aerobic exercise for 10 weeks (that is, five days a week). All the mice got used to exercise by running on a treadmill for 10 min at different speeds for a week. In addition, an electric shock was given to the animals on the first day to get them running. The Exercise routine was carried out as follows, low-to-moderate intensity = 50–60%, maximal aerobic velocity (MAV)/45 min each day, five days per week, 10 weeks. The exercises were performed between 10 and 11 p.m. The training room was also a calm, well-ventilated space with low humidity at the temperature of 18 ± 2°C. Similar to the mice in the training group, those in the Con group were subjected to irregular Exercise. Each training session consisted of three min of warm-up, 40 min of primary training, and 2 min of recovery. The starting training intensity was 15 m/min, which was raised by 2 m/min every two weeks, until it reached 23 m/min in the last week[23, 24].

Sampling

The mice were weighed every week throughout the study. After 12 h of fasting, the animals were finally sedated with xylazine and ketamine. The serum and tissue of the Gastrocnemius muscle were immediately taken and stored at -80°C for later examinations.

Measurement Of Pd-related Indices (Biochemical Measurements)

Using a glucometer (AlphaTRAK glucometer, Zoetis, USA), an FBS test and a GTT were carried out at the end of weeks 12 and 22. The mice fasted for 6 h before the GTT, and 200 µL of glucose solution was subsequently gavaged into their mouth. The blood glucose level was further tested at 0, 30, 60, 90, and 120 min. Following the manufacturer’s instructions, the plasma insulin levels were measured using a mouse insulin ultrasensitive enzyme-linked immunosorbent assay (ELISA) kit (ALPCO 80-INSMSE01, Keewaydin Drive, USA).

Ribonucleic Acid (Rna) Extraction And Rt-qpcr Analysis

The whole RNA was extracted from the Gastrocnemius muscle tissue using the TRIzol-based method (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, the purity and concentration of the isolated RNA were evaluated with a NanoDrop instrument. Each RNA sample was further treated with the enzyme deoxyribonuclease I (DNaseI) for 30 min at 37°C to eliminate the possibility of genomic DNA contamination of the RNA extracted. In order to neutralize the DNaseI, each sample was treated with 1 µL ethylenediaminetetraacetic acid (EDTA) and incubated at 65°C for 10 min. Reverse vector transcription enzyme was then exploited to create complementary deoxyribonucleic acid (cDNA) from the template RNA. The cDNA was also synthesized, using the Biotechrabbit cDNA Synthesis Kit, Germany, Berlin. Moreover, the exact primers of each gene were employed by the Beacon Designer software program (Version 7.2, USA) to verify gene expression. Table 1 illustrates the primer sequences. The Cyber Green software program was further utilized to quantitatively assess the gene expression level, using real-time PCR (RT-PCR, ABI Applied Biosystems, USA, and TaKaRa, Japan). After determining ΔCt, the ratio of the target gene expression in each sample relative to the Con group was calculated via the 2-ΔΔCt formula. As a result, the relative gene expression was calculated relative to 18S ribosomal RNA (rRNA), which served as an internal control gene.

Table 1

Sequence of designed primers
Gene	Forward Primer	Reverse Primer	Anneling temperature(˚C)
TXNIP	ACCTAAACATCCCAGATACCCCA	CTTGAGAGTCGTCCACATCGTC	60
ARRDC4	CACCGCCCTTATTGACTCC	TTCTCCGTTACAGTAGCCCTT	52

Immunohistochemical Methods

Using kits (Santa Cruz Bio Technologies, Inc., USA), the location and expression of the GLUT4 and MondoA proteins were examined by immunohistochemical methods. the Gastrocnemius muscle tissue was first preserved with formalin before being embedded in paraffin. The tissue was then placed in 70, 90, and 100% ethanol, and dehydrated. After washing with xylene, it was sliced using a microtome into a 5 to 15-µm-sized sections. Upon being disinfected with xylene and ethanol, the tissue was washed with buffer, and paraffin was removed. Using an autoclave, the tissue samples were subsequently placed in citrate buffer and heated for 20 min at an average power of 600 watts. Each slide also received the necessary quantity of blocking buffer (10% bovine serum albumin in Tris-buffered saline [TBS]), which was then placed at room temperature for 1 h before being washed with TBS. 3,3’-diaminobenzidine (DAB) was also added to the tissue to guarantee its peroxidase activity. The optimum blocking agent, hydrogen peroxide (H₂O₂), was further added to the tissue for 10–15 min. The tissue was then stained with the primary antibody, MondoA (P-14) (namely, the purified rabbit polyclonal antibody), and the secondary antibody, GLUT4 (H-61) (i.e., the purified rabbit polyclonal antibody), and incubated for 10 min. The slides were further washed with TBS and Triton X-100 buffer for 10 min after incubation. A secondary antibody, the biotinylated goat polyvalent, was further added and maintained at room temperature, and the compartment was incubated for 10 min. The slides were subsequently washed for 10 min with Triton X-100 and TBS. For 2–3 min, the slides were placed in hematoxylin, and then washed with TBS and Triton X-100 for 10 min. Next, the slides were dehydrated, and finally examined using a light microscope (BM-600 LED, Epifluorescence/AXIOM, Germany). After that, they were photographed using the MSHOT Microscope Camera, China. The location and expression levels of the proteins were consequently determined using the Image J software. Based on the proportion of the picture, this software program could reveal the expression of proteins. Statistical tests were further performed on the data generated by this software program.

Statistical Analysis

The indices of the measure of central tendency and standard error of the mean (SEM) were utilized to characterize the data via descriptive statistics. The effect of the independent variables on the dependent ones were then investigated using the one-way analysis of variance (ANOVA). The GraphPad Prism software (Version 8) was also used to analyze the data, considering the significance threshold at p < 0.05.

Exe along with GC and CGA intake modified the PD parameters induced by an HFD. In this line, the mice were given a 60% HFD for 12 weeks to produce a PD model, as previously described. Later, the PD mice got 10 weeks of Exe, GC, and CGA intake, and a combination of these interventions. The findings regarding the assessments of the biochemical composition of the blood, including blood sugar (Fig. 2A), plasma insulin (Fig. 2B), the HOMA-IR index (Fig. 2-C), GTT (Fig. 2E), the area under the curve (AUC, Fig. 2F), and the weight diagram (Fig. 2D), are presented in Fig. 2. Compared with the Con group, the parameters identified in the PD group significantly increased; however, the interventions could lower plasma insulin levels, the HOMA-IR index, and AUC as compared with the PD model mice. In the treated groups, compared with the PD one, the body weight of the mice was also modified.

The nuclear localization of MondoA in myocytes reduced by Exe as well as GC and CGA intake. To reflect on the potential function of MondoA in PD, the presence of this transcription factor in the nucleus of the Gastrocnemius muscle cells of the PD mice and those treated with various interventions was evaluated by immunohistochemistry. The findings are presented in Figure (3A-3B). As can be observed, the presence of MondoA in the nucleus of the myocytes of the PD group is greater than that of the intervention ones (shown by arrows). A considerable drop in the nuclear level of this transcription factor is further seen in the treatment groups, except for the GC one, as compared with the PD mice. Moreover, the entry of MondoA into the nucleus was dramatically decreased in the combination therapy groups (namely, Exe + CGA and Exe + GC), as compared with the PD group.

Exe as well as GC and CGA intake reduced the TXNIP and ARRDC4 expression. Assuming that MondoA could boost IR by promoting the expression of TXNIP and ARRDC4, their expression levels as two members of the α-arrestin family were evaluated in various groups using RT-PCR. Figure 4A (TXNIP) and Fig. 4B (ARRDC4) depict the findings of the expression variations of these two genes. The expression of TXNIPA and ARRDC4 in the HFD-fed mice rose dramatically compared with the animals having a normal diet, and all interventions significantly lowered the expression of both genes in comparison with the PD group. Accordingly, the combination of Exe with GC and CGA intake had a synergistic impact on mitigating the expression of TXNIP and ARRDC4 genes.

Exe along with GC and CGA intake also enhanced the membrane localization of GLUT4 caused by an HFD. In this vein, Exe, GC, and CGA ameliorated PD by transferring GLUT4 from the cytoplasm to the myocyte membranes. Immunohistochemistry was further used to analyze the cellular localization of GLUT4 in several groups and shed light on the validity of this hypothesis. Figure 5A displays the outcomes of this experiment. Of note, GLUT4 was localized to a reduced degree in the cell membrane in the PD group compared with the Con one (shown by an arrow). The Exe, Exe + GC, and Exe + CGA groups, on the other hand, experienced a significant increase in the quantity of GLUT4 in the muscle cell membrane, while the elevated presence of GLUT4 in both groups of GC and CGA was not significant as compared with the PD one.

The present study investigated the effects of aerobic exercise in combination with green coffee and chlorogenic acid intake in the HFD-fed PD mouse model[25]. Since one of the underlying processes in insulin resistance and PD pathophysiology was decreased muscle glucose uptake, the growing trend in the activity of MondoA, as an essential glucose-responsive transcription factor, followed by the escalated expression of insulin-pathway suppressor genes, such as TXNIP and ARRDC4, seemed to contribute significantly to the formation of this condition[26]. The study findings here indicated developments in the activity of MondoA and the expression of its downstream genes, TXNIP and ARRDC4, in the myocytes after 12 weeks of the HFD and the PD induction. In the HFD-fed mice, the PD symptoms also improved thanks to aerobic exercise as well as green coffee and chlorogenic acid intake, by inhibiting the Mondo A activity. Under the PD and type 2 diabetes conditions, the variation in the glycolytic flow rate might be among the factors affecting the MondoA activity. Moreover, the accumulation of fatty acids within the muscle cell could rise under excess energy, as reported by Chai et al. which was likely to hinder the GADPH activity. This enzyme could catalyze the sixth step of glycolysis, and its inhibition might result in the accumulation of the downstream metabolites, including G6P and GADP. Accordingly, the substrate required to translocate the Mondo A-MLX complex to the cell nucleus augmented[27]. The relationship between glycolytic rate and MondoA activity might further explain another mechanism[28]. The increase in the metabolites, caused by an excessive substrate supply to the mitochondria during the HFD, would thus enhance the ATP generation. The inhibition of PFK-1, as the primary enzyme of glycolysis, was accordingly among the mechanisms that occurred following the excessive generation of ATP. Therefore, the substrate involved in the MondoA activation was made accessible due to reduced glycolysis, which resulted in the accumulation of glucose 6-phosphate[29]. In Hirosumi et al. an HFD, comprising 50% fat, had further promoted the excessive activation of JNK, and then inhibited insulin receptor phosphorylation, thereby giving rise to insulin resistance[30]. In contrast, Kawamoto et al. had studied the effect of immobility on the JNK and TXNIP activation, and reported that thioredoxin could suppress the JNK activation by reducing the ASK1 activity. In view of the TXNIP gene as a natural inhibitor of thioredoxin, it was assumed that one of the mechanisms of insulin resistance and blood glucose increase after the HFD for 12 weeks in this study was the effect of TXNIP on the JNK mechanism[31]. Besides, the TXNIP and ARRDC4 proteins could directly impede glucose absorption by binding to glucose transporters and preventing excessive glucose accumulation within the cells to avoid an excessive increase in glucose inside the cell[32]. After the insulin release, the proteins mentioned above could be separated from the glucose transporters, and the entry of glucose into the cell was promoted by the placement of Glut4 on the cell membrane. Accordingly, any disruption in the Glut4 placement in the muscle cell membrane led to increased blood glucose associated with PD and type 2 diabetes[9]. The findings of the immunohistochemistry operated in this study correspondingly indicated a rising trend in the Glut4 endocytosis after the HFD and the diabetes induction. In line with the present study, Ahn et al. had established that the overactivation of MondoA and its downstream genes could reduce the Glut4 activity and glucose absorption into the muscle cells under the PD conditions and insulin resistance[7]. In this study, all PD parameters, including blood glucose and insulin, HOMA-IR index, and AUC, dropped after 10 weeks of aerobic exercises as well as green coffee and chlorogenic acid intake and their combinations. Moreover, aerobic exercise alone and combined with other therapies dramatically decreased the expression of the TXNIP and ARRDC4 genes. Upon analyzing the presence of MondoA in the nucleus, it was taken for granted that aerobic exercise alone and in combination with green coffee and chlorogenic acid intake resulted in the MondoA nuclearization, so reducing its binding to the promoter of target genes and lowering their expression. Stanford et al. had similarly demonstrated that aerobic exercise could lead to an increase in the entry of glucose into the muscle cell nucleus via the activation of AMPK, as an energy sensor to control cell homeostasis and glucose together with lipid metabolism by regulating gene expression and the phosphorylation of critical proteins involved in these processes[13, 33]. Evidence from human and animal models have further indicated that green coffee and chlorogenic acid intake have so far accelerated glucose transport into the cell via the AMPK activation. Likewise, Khang Wei et al. had reported that the reduced expression of AMPK after its knockdown had substantially inhibited green coffee- and chlorogenic acid-induced glucose transport[34]. After 6 hours of immobility in the hind limbs of mice, Kawamoto et al. had also found a downward trend in the TXNIP gene expression and protein expression by giving Actinomycin D, as an AMPK activator. Phosphofructokinase-2 was also one of the AMPK’s critical targets. The AMPK-dependent activation of this enzyme accordingly increased fructose-2,6-bisphosphate concentration and glycolysis rate. Consequently, the substrate required for the MondoA activation would not be available[31]. This mechanism might account for the effects of the treatments applied in this study on reducing the MondoA nuclear entry. In addition, Waldhart et al. had stated that the rise in the AKT activity, generated by aerobic exercise and the entry of more glucose into the cell, as some negative feedback, had downgraded the entry of MondoA. The amount of substrates, such as G6P and GADP, facilitating the formation of the MondoA-MLX complex and its entry into the nucleus, had also diminished owing to the upsurge in glycolytic rate and cellular glycolysis, and thus, the amount of glucose transcription suppressor genes had declined[9]. One other potential mechanism for the effect of aerobic exercise on the lower expression of insulin suppressor genes was the HIF-1a gene, as a crucial transcription factor for glucose metabolism and insulin action in skeletal muscles. This factor further reduced the binding of MondoA to the promoter of target genes, including TXNIP and ARRDC4, henceforth facilitating the entry of glucose into the cell. In this respect, Gorgens et al. had reported that exercise could activate HIF-1a in the muscles of C57BL/6J mice by moderating the amount of intramuscular oxygen[35].

To come to the point, the study results established that aerobic exercise alone and in combination with green coffee and chlorogenic acid intake might help modify the alterations produced by PD Through the MondoA-TXNIP/ARRDC4-GLUT4 axis. Accordingly, a novel mechanism was found to improve PD via aerobic exercise as well as green coffee and chlorogenic acid intake ( Fig. 6).

AMPK

AMP-activated protein kinase

ARRDC4

Arrestin Domain Containing 4

ASK1

Apoptosis signal-regulating kinase 1

BSK

Bonyan Salamat Kasra

CGA

Chlorogenic acid

Exe

Exercise Training

FBS

Fasting blood suger

Green coffee

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

GADP

Glyceraldehyde-3-phosphate

GLUT

glucose transporter

G6P

Glucose-6-phosphate

GTT

Glucose tolerance test

HFD

High-fat diet

HOMA

Homeostatic model assessment of insulin resistance

HIF-1a

Hypoxia-inducible factor 1

Ethical Approval

The approval of mouse usage in this study was obtained by the Ethics Committee of Royan Institute.

Competing interests

The authors declare that they have no conflicts of interest to declare.

Authors’ Contributions

N.S.R. contributed to the study design, data collection, analyses, data mining, data interpretation, and manuscript writing.

SM.M. contributed to the study design, data collection, data analysis, data interpretation, and manuscript writing.]

J.R. manuscript writing,data collection.

Z. S.contributed to the data interpretation, technical assistance, manuscript writing, and final approval of the manuscript.

All authors read and approved the final manuscript.

Funding

All costs were covered by the first author.

Availability of data and materials

Data and material are available on request.

Acknowledgments

We are highly grateful to Milad Abdollahi for general advice.

Andes LJ, et al. Prevalence of prediabetes among adolescents and young adults in the United States, 2005–2016. JAMA Pediatr. 2020;174(2):e194498–8.
Echouffo-Tcheugui JB, Selvin E. Prediabetes and what it means: the epidemiological evidence. Annu Rev Public Health. 2021;42:59–77.
Yan Y, Kover KL, Moore WV. New insight into metformin mechanism of action and clinical application, in Metformin. 2020, IntechOpen London, UK.
Song Z, et al. Glucose-sensing transcription factor MondoA/ChREBP as targets for type 2 diabetes: opportunities and challenges. Int J Mol Sci. 2019;20(20):5132.
Cade WT. The manifold role of the mitochondria in skeletal muscle insulin resistance. Current opinion in clinical nutrition and metabolic care, 2018. 21(4): p.267.
Richards P, et al. MondoA/ChREBP: The usual suspects of transcriptional glucose sensing; Implication in pathophysiology. Metabolism. 2017;70:133–51.
Ahn B et al. MondoA drives muscle lipid accumulation and insulin resistance.JCI insight, 2019. 4(15).
O’Donnell AF, Schmidt MC. AMPK-mediated regulation of alpha-arrestins and protein trafficking. Int J Mol Sci. 2019;20(3):515.
Waldhart AN, et al. Phosphorylation of TXNIP by AKT mediates acute influx of glucose in response to insulin. Cell Rep. 2017;19(10):2005–13.
Rachek LI. Free fatty acids and skeletal muscle insulin resistance. Prog Mol Biol Transl Sci. 2014;121:267–92.
Stevanović J, et al. Physical exercise and liver “fitness”: Role of mitochondrial function and epigenetics-related mechanisms in non-alcoholic fatty liver disease. Mol metabolism. 2020;32:1–14.
Tsuda S, et al. Coffee polyphenol caffeic acid but not chlorogenic acid increases 5′ AMP-activated protein kinase and insulin-independent glucose transport in rat skeletal muscle. J Nutr Biochem. 2012;23(11):1403–9.
Stanford KI, Goodyear LJ. Exercise and type 2 diabetes: molecular mechanisms regulating glucose uptake in skeletal muscle. Adv Physiol Educ. 2014;38(4):308–14.
Park SS, Seo Y-K. Excess accumulation of lipid impairs insulin sensitivity in skeletal muscle. International Journal of Molecular Sciences, 2020. 21(6): p. 1949.
Shahmohammadi HA et al. Effects of green coffee bean extract supplementation on patients with non-alcoholic fatty liver disease: a randomized clinical trial.Hepatitis Monthly, 2017. 17(4).
Nachar A, et al. Phenolic compounds isolated from fermented blueberry juice decrease hepatocellular glucose output and enhance muscle glucose uptake in cultured murine and human cells. BMC Complement Altern Med. 2017;17(1):1–10.
Meng S et al. Roles of chlorogenic acid on regulating glucose and lipids metabolism: a review. Evidence-based complementary and alternative medicine: eCAM, 2013. 2013.
Zuniga LY, et al. Effect of chlorogenic acid administration on glycemic control, insulin secretion, and insulin sensitivity in patients with impaired glucose tolerance. J Med Food. 2018;21(5):469–73.
Dirks-Naylor AJ. The benefits of coffee on skeletal muscle. Life Sci. 2015;143:182–6.
Shin J-W, Seol I-C, Son C-G. Interpretation of animal dose and human equivalent dose for drug development. J Korean Med. 2010;31(3):1–7.
Shimoda H, Seki E, Aitani M. Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain in mice. BMC Complement Altern Med. 2006;6:1–9.
Choi B-K, et al. Green coffee bean extract improves obesity by decreasing body fat in high-fat diet-induced obese mice. Asian Pac J Trop Med. 2016;9(7):635–43.
Dougherty JP, Springer DA, Gershengorn MC. The treadmill fatigue test: a simple, high-throughput assay of fatigue-like behavior for the mouse.JoVE (Journal of Visualized Experiments), 2016(111): p.e54052.
Abdollahi M et al. Insulin-Related Liver Pathways and the Therapeutic Effects of Aerobic Training, Green Coffee, and Chlorogenic Acid Supplementation in Prediabetic Mice. Oxidative Medicine and Cellular Longevity, 2022. 2022.
Watt MJ, Hoy AJ. Lipid metabolism in skeletal muscle: generation of adaptive and maladaptive intracellular signals for cellular function. Am J Physiology-Endocrinology Metabolism. 2012;302(11):E1315–28.
Ahn B, et al. MondoA coordinately regulates skeletal myocyte lipid homeostasis and insulin signaling. J Clin Investig. 2016;126(9):3567–79.
Chai TF, et al. A potential mechanism of metformin-mediated regulation of glucose homeostasis: inhibition of Thioredoxin-interacting protein (Txnip) gene expression. Cell Signal. 2012;24(8):1700–5.
Ye J. Mechanism of insulin resistance in obesity: a role of ATP. Front Med. 2021;15(3):372–82.
Han K-S, Ayer DE. MondoA senses adenine nucleotides: transcriptional induction of thioredoxin-interacting protein. Biochem J. 2013;453(2):209–18.
Hirosumi J, et al. A central role for JNK in obesity and insulin resistance. Nature. 2002;420(6913):333–6.
Kawamoto E, et al. Immobilization rapidly induces thioredoxin-interacting protein gene expression together with insulin resistance in rat skeletal muscle. J Appl Physiol. 2018;125(2):596–604.
Yoshihara E. TXNIP/TBP-2: a master regulator for glucose homeostasis. Antioxidants. 2020;9(8):765.
Joshi T, et al. Targeting AMPK signaling pathway by natural products for treatment of diabetes mellitus and its complications. J Cell Physiol. 2019;234(10):17212–31.
Ong KW, Hsu A, Tan BKH. Chlorogenic acid stimulates glucose transport in skeletal muscle via AMPK activation: a contributor to the beneficial effects of coffee on diabetes. PLoS ONE. 2012;7(3):e32718.
Görgens SW, et al. Hypoxia in combination with muscle contraction improves insulin action and glucose metabolism in human skeletal muscle via the HIF-1α pathway. Diabetes. 2017;66(11):2800–7.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Ameliorating Prediabetes Symptoms via Aerobic Exercise Combined with Green Coffee and Chlorogenic Acid Intake by Targeting MondoA-TXNIP/ARRDC4-GLUT4 Axis inHigh Fat Diet-Induced Prediabetic Mice

Status:

Version 1

Abstract

Background and Aim:

Materials and Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Study Design

Interventions

Green Coffee and CGA Supplements

Aerobic Exercise Protocol

Sampling

Measurement Of Pd-related Indices (Biochemical Measurements)

Ribonucleic Acid (Rna) Extraction And Rt-qpcr Analysis

Immunohistochemical Methods

Statistical Analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1