NKD1 targeting PCM1 regulates the therapeutic effects of HHT on colorectal cancer cells

doi:10.21203/rs.3.rs-2739531/v1

Download PDF

Research Article

NKD1 targeting PCM1 regulates the therapeutic effects of HHT on colorectal cancer cells

https://doi.org/10.21203/rs.3.rs-2739531/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 20 Jun, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background: Colorectal cancer (CRC) is the most common primary malignancy. Homoharringtonine (HHT) has potential therapeutic effects on solid tumors. However, the regulatory target and mechanism of HHT in CRC progression remain elusive.

Methods: CCK-8, Edu staining, flow cytometry and Western blotting assay to detect the effect of HHT on proliferation and apoptosis of CRC cells. Transcriptome sequencing screened the drug delivery target of HHT. In vitro rescue experiment and in vivo tumorigenesis experiment detect the targeted interaction between HHT and NKD1. Quantitative proteomics combined with CO-IP and IF experiments to verify the targeted interaction between NKD1 and PCM1.

Results: HHT suppressed CRC cells proliferation by inducing cell cycle arrest and apoptosis in vitro and vivo. HHT inhibited NKD1 expression in a concentration and time dependent manner. NKD1 was overexpressed in CRC and its depletion enhanced the therapeutic sensitivity of HHT on CRC, which indicating that NKD1 plays an important role in the development of CRC as the drug delivery target of HHT. Furthermore, proteomic analysis revealed that PCM1 participated the process of NKD1-regulated cell proliferation and cell cycle. NKD1 interacted with PCM1 and promotes PCM1 degradation through the ubiquitin-proteasome pathway. The overexpression of PCM1 effectively reversed the inhibition of siNKD1 on cell cycle.

Conclusions: These results suggested that NKD1 targeting PCM1 to participate in regulating the therapeutic effects of HHT on CRC. Our findings provide evidence for clinical application of NKD1-targeted therapy in improving HHT sensitivity for CRC treatment

Colorectal cancer

NKD1

HHT

Cell cycle

Apoptosis

Colorectal cancer (CRC) is a common malignancy, which is associated with a high risk of incidence and mortality worldwide [1]. Despite significant advancements in the diagnosis and treatment of CRC, the prognosis of patients with advanced stage CRC is still poor [2]. It has been reported that recurrence, metastasis and drug resistance are the leading causes of poor outcomes in CRC patients [3]. Due to the lack of understanding of the pathological mechanisms, it is difficult to predict the tumorigenesis of CRC. Therefore, the development of potential targeted drugs and therapeutic biomarkers is of great significance to improve the clinical outcomes of CRC patients.

Homoharringtonine (HHT) is a plant alkaloid, which is also known as a protein synthesis inhibitor and is used in the treatment of acute and chronic myeloid leukemia [4, 5]. Mechanistic studies have shown that HHT can prevent aminoacyl binding to the ribosomal subunit during the process of protein elongation, thereby disrupting the translation of oncogenes and ultimately leading to the apoptosis of leukemia cells [6, 7]. Recently, it was reported that HHT could exert anticancer effects on several solid malignancies. For example, Guo et al [8] reported that HHT could show anti-neoplastic activities in lung cancer by regulating TMEM16A activity. Liu et al [9] proved that HHT could induce PSMD11 protein synthesis by activating MEK1/ERK1/2 signaling pathway in pancreatic cancer. Zhu et al [10] proved that HHT could inhibit the proliferation and migration of hepatocellular carcinoma (HCC) cells by regulating the loss of EphB4-mediated β-catenin. Our previous study suggested that HHT could suppress the growth of breast cancer cells and promote apoptosis through the miR-18a-3p-AKT-mTOR signaling pathway [11]. Moreover, Shi et al [12] found that HHT could inhibit the growth of LoVo cells by inhibiting EphB4 and its downstream signaling. Qu et al [13] also demonstrated that HHT could inhibit cell proliferation and promote apoptosis in CRC by activating the PI3K/AKT/mTOR signaling pathway. Therefore, it is necessary to investigate the pharmacological targets of HHT as well as its molecular mechanism in the tumor process.

Naked cuticle homolog 1 (NKD1), located on chromosome 16q12.1, is an antagonist of the canonical Wnt signaling pathway. It can affect the proliferation of cells by inhibiting the nuclear accumulation of β-catenin [14]. NKD1 is widely expressed in multiple tissues and plays a critical role in various tumors. The downregulation of NKD1 increased the invasive ability of non‑small‑cell lung cancer and correlates with a poor prognosis [15]. The NKD1 knockdown was associated with poor prognosis in invasive breast ductal carcinoma [16]. In HCC tissues, the low of NKD1 was associated with extrahepatic metastasis and histological differentiation [17]. Meanwhile, Wang et al [18] showed that NKD1 might be an important CRC biomarker and act as a curative target for the treatment of CRC. However, the specific function and mechanism of NKD1 in the progression of CRC remain poorly understood, and whether there is a link between HHT and NKD1 needs further investigation. This study aimed to elucidate the anti-CRC effects and molecular mechanisms of HHT.

This study aimed to elucidate the anti-CRC effects and molecular mechanisms of HHT. Our results demonstrated that HHT targeting NKD1 inhibits the proliferation of CRC cells by inducing cell cycle arrest and apoptosis. Silencing the NKD1 significantly improved the therapeutic sensitivity of HHT to CRC. Further mechanism revealed that NKD1 could interact with PCM1 and promote its degradation through the ubiquitin-proteasome pathway. The overexpression of PCM1 could effectively reverse the effects of NKD1 on promoting cell cycle arrest and apoptosis. These results suggested that HHT blocks CRC progression by inhibiting NKD1/PCM1 axis. Our study provided preliminary guidance for the treatment of CRC with HHT, and highlighting the inhibition of NKD1/PCM1 signals can improve the therapeutic effect of HHT, which will represent a promising therapeutic strategy for the diagnosis and treatment of CRC.

Cell culture and treatment

Human CRC cell lines, including HT29 and SW620, were purchased from the Shanghai Institute of Cell Biology at the Chinese Academy of Sciences. The cell lines were maintained in McCoy’s 5A modified medium (Gibco, USA) and Leibovitz’s L-15 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Australia) and 1% antibiotics (penicillin and streptomycin). Cells were cultured in a humidiﬁed incubator at 37 °C containing 5% CO2 concentration. HHT was obtained from Minsheng Pharmaceutical Co. Ltd (Zhejiang, China). The cells were treated with different concentrations of HHT (1.5 μM, 3 μM and 6 μM) to detect the cell cytotoxicity. The SW620 cells were transfected with the PCM1 plasmid using Lipofectamine 3000 transfection reagent (Invitrogen, USA), following the manufacturer’s instructions.

Cell viability and colony formation assays

For the CCK8 assay, the HT29 and SW620 cells (2×10³ cells/well) were seeded into 96-well plates and incubated overnight at 37°C. The cells were then treated with HHT at the 6 μM for another 24 h, 48 h and 72 h. Then, a 10 μL CCK8 solution (KeyGEN BioTECH, China) was added to each well and further incubated for an additional 2 h at 37°C according to the manufacturer’s instruction. The cell viability was assessed by measuring the absorbance at 450 nm using a microplate reader. For the colony formation assay, the SW620 cells, transfected with NKD1 or PCM1, were seeded into six-well plates and cultured for 2 weeks. Then, the cells were washed with cold PBS, followed by fixation with 100% methanol and staining with 0.5% crystal violet solution for 10 min. The number of coloies was counted using ImageJ software from the representative areas. All the experiments were performed in triplicates.

5‑Ethynyl-2’-deoxyuridine (EdU) staining assay

Cell proliferation ability and DNA synthesis were determined using the EdU staining assay. Briefly, the cells were treated with different concentrations of HHT for 48 h. Then the cells in the logarithmic growth phase were seeded on the coverslips (NEST, USA), and added with 10 uM EdU solution (Abcam, USA) to each well for incubation 2 h at 37°C. Subsequently, the cells were fixed with 4% paraformaldehyde for 20 min and treated with 2M HCl for 30 min at room temperature. After washing the cells with cold PBS three times, each well was supplemented with 0.5% Triton X-100 (Solarbio, China) and blocked with 10% goat serum (Solarbio, China) for 1 h. For the visualization of nuclei, the cells were stained with DAPI reaction solution (Sigma, USA) for 20 min in dark and then fixed with a fluorescence quenching agent (Solarbio, China). The EdU-positive cells were finally photographed and counted using a fluorescence microscope (Olympus, Japan) under different fields.

RNA extraction and quantitative real-time PCR (qRT–PCR)

Total RNA was extracted from tissues and cultured cells using TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. RT-PCR assay was carried out as described in our previous study [19]. The following primer sequences were used for RT-PCR: NKD1: F: ACCATTGCGTAGATGAGAACAT, R: CCAAATTGGGACGTGTAGTTTT. GAPDH: F: TGTTGCCATCAATGACCCCTT, R: CTCCACGACGTACTCAGCG.

RNA interference vectors and cell transfection

The lentivirus vectors, which contained the small interfering RNAs (siRNAs), specifically targeting the NKD1 mRNA were designed and synthesized by Shanghai Genechem Co, Ltd (Shanghai, China). For lentiviral transduction, the SW620 cells were seeded into 24-well plates and allowed to grow to a cell confluence to 50%, which were then transfected with three siRNAs vectors or negative control vectors following the manufacturer’s instructions. After culturing the cells in an incubator at 37°C for 8-12 h, the serum-free medium was replaced with a complete medium. The stably transfected siRNA-NKD1 cells were screened using 1 μg/mL puromycin reagent (Carlsbad, USA). Cell transfection efficiency was observed under a fluorescence microscope and examined using qRT-PCR and Western blot analyses. The NKD1 siRNA sequences are listed in Supplementary Table S1.

Cell cycle and apoptosis analyses using flow cytometry

For the cell cycle analysis, the HT29 and SW620 cells were seeded into a six-well plate and treated with 6 uM HHT for 48 h. The cells were then digested with trypsin without EDTA to prepare a single-cell suspension. After centrifugation, the supernatant was removed and the cells were resuspended in a cold PBS buffer. The cells were fixed by adding precooled 70% ethanol overnight at -20°C. The cells were then resuspended in 200 uL binging buffer and stained with PI staining solution for 30 min at room temperature. The apoptosis rate of the HT29 and SW620 cells was identified using AnnexinV-APC/PI double staining apoptosis detection kit (MULTI SCIENCE, China). The binding buffer containing 10 μL Annexin V-APC, was added to the cells and incubated for 15 min at room temperature in dark conditions, and then added 5 μL PI solution in dark for 10 min. The quantification of cell cycle distribution and cell apoptosis rate were examined using a flow cytometer system.

Protein extraction and Western blot analysis

In brief, the cells were collected, and the proteins were extracted using a whole protein extraction kit (KeyGEN BioTHCH, China), containing lysis buffer, Protease Inhibitor Cocktail and PMSF for 45 min on ice. Then, the lysates were centrifuged at 13,000g and 4°C for 20 min, and the concentration of total extracted protein was measured using a BCA detection kit (Thermofisher Scientific, Inc). Equal amounts of proteins were electrophoresed on a 10% SDS-PAGE and then transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% defatted milk for 1 h at room temperature and incubated with specific primary antibodies at 4°C overnight. Subsequently, the membrane was incubated with the HRP-conjugated goat anti-rabbit or anti-mouse IgG respective secondary antibodies (ab205718; 1:5000, Abcam) at room temperature for 1 h. The protein bands were visualized using BioImaging Systems (BIO-RAD, USA). Anti-GAPDH antibody was used as an internal control to the protein levels. Speciﬁc antibodies were listed in Supplementary Table S2.

Co-immunoprecipitation assay

The cells were harvested and lysed in cold lysis buffer. Equal amounts of cell lysates were incubated with normal IgG or special primal anti-NKD1 antibodies overnight at 4 °C. Protein A/G-agarose (Abcam) was washed with cold PBS, and then incubated with an antibody for 4 h. Then, the immunoprecipitated complex was washed three times with ice-cold PBS and the supernatant was removed. Then, 5X loading buffer was added to elute the proteins. The eluted proteins were separated using SDS-PAGE. The bound proteins were analyzed by Western blotting with an anti-PCM1 antibody (Santa cruz).

Immunofluorescence (IF) staining

The HT29 and SW620 cells were seeded on the coverslips in a12-well plate (NEST, USA) for 48 h. After washing with cold PBS, the cells were fixed in 4% paraformaldehyde for 20 min. Subsequently, the coverslips were permeabilized with 0.5% Triton X-100 for 10 min and blocked with 5% normal goat serum for 1 h at room temperature. Then, the cells were incubated at 4°C with primary antibodies against C-PARP (Abcam, 1:200, USA) overnight, and followed by incubation with fuorophore-conjugated respective secondary antibody (1:200, Invitrogen, USA) for 2 h. The nuclei of cells were visualized by staining with DAPI solution (Sigma, 1:500, USA) for 15 min in the dark. Finally, the slides were observed under a fluorescence microscope (Olympus, Japan), and the integrated fluorescence density was measured by the ImageJ software.

Immunohistochemistry (IHC) staining

The cells and tissue samples fixed in 10% formaldehyde were paraffinized and sliced into 5-μm-thick sections. The microarray sections were deparaffinized with xylene, rehydrated using graded alcohol solutions, and then treated with 0.3% hydrogen peroxide for 30 min. After repairing and blocking, the slides were incubated with primary antibodies, including anti-NKD1 (1:200, Abcam, USA), anti-Ki67 (1:200, Abcam, USA), anti-CDK4 (1:200, Abcam, USA), anti-Bax (1:100, CST, USA) at 4 °C overnight. The slides were then incubated with corresponding HRP-labeled secondary goat anti-rabbit antibodies at room temperature for 1 h. After the diaminobenzidine (DAB) reaction in dark, the slides were counterstained with hematoxylin. Typical images were captured under a microscope, and three equal-area non-repetitive fields were used for each slice to calculate the number.

Tumor xenograft model

BALB/C female nude mice (6-8 weeks old) were purchased from the Beijing Vital River Laboratory Animal Technology Co. Ltd (Beijing, China). The siNKD1- transfected cells were subcutaneously injected into the mice to establish the CRC xenograft model. The mice in the two HHT groups were intraperitoneally injected with 0.5 mg/kg HHT for 15 days to observe its inhibitory effects on tumor growth. The length and width of tumor regions were measured using electronic calipers. Subsequently, the mice were euthanized and tumor tissues were isolated and frozen in liquid nitrogen or fixed in formalin to perform IHC analysis. All the animal experiments were performed in accordance with the principles and guidelines approved by the Ethics Committee of Animal Research.

Statistical analyses

All the statistical analyses were performed using SPSS 18.0, GraphPad Prism version 8.0 and Illustrator 2017 software. The data were presented as the mean ± SD, and statistical differences among the groups were determined by a two-tailed Student t test or one-way analysis of variance (ANOVA). A P-value of <0.05 was considered statistically significant.

HHT potently inhibited the viability and proliferation of CRC cells

The inhibitory eﬀects of HHT on the viability of HT29 and SW620 cells were investigated by observing the cell morphology and CCK8 assay. The structures of both the cell lines became shattered and deformed with the increase in HHT concentration (0, 1.5 uM, 3 uM and 6 uM) (Fig. 1A), The HHT treatment significantly reduced cell viability in a concentration and time-dependent manner in comparison with the untreated cells (Fig. 1B). Meanwhile, the colony formation and Edu staining assays were performed to elucidate the cells proliferation abilities. As shown in Fig. 1C, the number of colonies decreased significantly with the increase in HHT concentration. Edu staining assay also showed that a significant decrease in the number of positively stained cells with the continuous increase in the HHT concentration (Fig. 1D, E). Taken together, these results suggested that HHT exhibited strong cytotoxic and cytostatic effects on CRC cells.

HHT accelerated the cell cycle arrest of CRC cells at the G0/G1 phase

The effects of HHT on the distribution of cell cycle were analyzed by flow cytometry. As shown in Fig. 2A, the cell divisions of the cell lines were arrested at G0/G1 phase, the HHT treatment increased the proportion of cells in a dose dependent manner. On the contrary, the proportion of the cells in S phase or G2/M phase decreased as compared to those in the control group. This suggested that HHT could cause the arrest of CRC cells in the G0/G1 phase. Additionally, Western blot assay was used to detect the cell cycle-related proteins and corresponding kinases. The results showed that the expression levels of CyclinE, Cyclind1, CDK2, CDK4 and CDK6 proteins decreased with the increase in the HHT concentration (Fig. 2B, C). HHT also decreased expression levels of above proteins in a time-dependent manner (Fig. 2D, E). Collectively, these data indicated that HHT could inhibit the growth and proliferation of CRC cell by inducing cell cycle arrest at G0/G1 phase.

HHT induced apoptosis of CRC cells

To determine the apoptotic effects of HHT, the HT29 and SW620 cells were exposed to various concentrations of HHT for 48 h and the apoptotic rates were evaluated by AnnexinV-FITC/PI staining assay. As shown in Fig. 3A, HHT remarkably increased the total proportion of apoptosis in both the cell lines in a dose-dependent manner as compared to that in the untreated group. Besides, the immunofluorescence staining assay demonstrated that HHT induced the nuclear accumulation of cleaved-PARP (Fig. 3B, C). Then, Western blot analysis was used to further investigate the levels of apoptosis-related proteins in CRC cells. The results indicated that HHT treatment increased the protein levels of cleaved-PARP and Bax, and decreased those of the Caspase3, Caspase9 and Bcl-2 expression (Fig. 3D, E). Taken together, these results strongly proved that HHT could induce the expression of pro-apoptotic proteins to activate the cascade reaction, which ultimately facilitated the apoptosis of CRC cells.

NKD1 expression was correlated with response to HHT

In order to illustrate the underlying molecular mechanism of HHT’s anti-cancer effects, transcriptomic sequencing analysis was performed on the HHT-treated SW620 cells. The results showed a total of 3201 upregulated genes and 3495 downregulated genes in HHT treatment groups as compared to the control group (fold change>2 and p<0.05). Cluster and volcano map analyses revealed that HHT treatment downregulated the NKD1 expression (Fig. 4A, B). Gene Ontology (GO) analysis revealed that downregulated genes were significantly enriched in GO terms including with cell cycle, DNA replication and apoptotic process (Fig. 4C). Reactome pathway database showed significant enrichment of the downregulated genes in cell cycle, G1/S transition, and apoptosis signaling pathway (Figure S1), this was largely consistent with our detection of the function of HHT in vitro. In order to verify the results of bioinformatics analysis, we completed the RT-PCR and Western blot experiment, and found that HHT reduced NKD1 mRNA and protein expression both in a concentration and time-dependent manner (Fig.4D, E). In addition, in order to prove the correlation between HHT and NKD1, xenograft tumorigenic experiments suggested that the tumor formation was reduced in the HHT group as compared to that in the control group (Fig. 4F), and the tumor weight and volume were also significantly reduced synchronously (Fig. 4G, H). As shown in Fig. 4I, HHT treatment decreased the mRNA and protein expression of NKD1 in nude mice tissues. The apoptosis-related protein Bcl-2 expression decreased, while that of Bax increased in HHT treated group (Fig. 4J). These results suggested that NKD1 might act as a drug delivery target of HHT and plays an important role in inhibiting CRC cell proliferation by HHT.

Expression of NKD1 in the CRC tissues and cell lines

In order to investigate the specific role of NKD1 in HHT, the Pan-cancer expression level of NKD1 was first analyzed using the TCGA database. The results demonstrated that NKD1 was highly overexpressed in COAD and READ (Fig. 5A). And NKD1 expression was significantly upregulated in 288 CRC tissues matching with 41 normal samples (Fig. 5B). However, there was no difference in the early stage (G1+G2) and late stage (G3+G4) patients (p=0.051) (Fig. 5C). RT-PCR and IHC analyses also confirmed that NKD1 was highly expressed in CRC (Fig. 5D, E). Furthermore, the NKD1 expression was also detected in CRC cell lines. As shown in Fig. 5F, G, NKD1 mRNA and protein were highly expressed in CRC cells as compared to normal cells (NCM460). Meanwhile, NKD1 siRNAs were designed and tested by RT-PCR and Western blot analyses. The results indicated the mRNA and protein levels of NKD1 siRNA1 decreased (Fig. 5H and 5I). The above results demonstrated that NKD1 acts as an oncogene to play an important role in regulating the development of CRC.

Sensitivity of CRC cells to HHT was associated with NKD1

SW620 cells were transfected with siNKD1 and exposed to the specified concentration of HHT to elucidated the correlations between NKD1 and HHT. The protein expression of NKD1 was lowest in NKD1 knockdown cells upon HHT treatment than in the control group (Fig. 6A). CCK8 and clone formation assays showed that the knockdown of NKD1 increased the inhibitory effects of HHT on the growth and proliferation of cells (Fig. 6B, C). Besides, as shown in Fig. 6D, E, the knockdown of NKD1 dramatically increased the sensitivity of SW620 cells to HHT, which was manifested in the increase of apoptosis rate and number of cells in the G0/G1 phase. For further validation, Western blot analysis was performed to detect the expression levels of cell cycle and apoptosis-related proteins. The results indicated that in the NKD1-knockdown cells, the HHT treatment significantly reduced the expression levels of CDK2, CDK4, CDK6, CyclinE and anti-apoptotic protein Bcl-2 expression and increased those of pro-apoptotic protein Bax and C-caspase9 (Fig. 6F, G). These results suggested that HHT induced the cell growth inhibition, cell cycle arrest and cell apoptosis largely attributed to the inhibitory effects of NKD1.

NKD1 deletion promoted CRC cells sensitivity to HHT in vivo

The xenograft nude mouse model was established to observe the inhibitory effects of HHT in combination with NKD1 depletion on tumor growth in vivo. The tumor cells were inoculated subcutaneously into the nude mice, and intraperitoneal injection 0.5 mg/kg HHT. Consistent with the in vitro results, the HHT treatment decreased the average tumor volume and weight as compared to those in the control group, and knockdown of NKD1 enhanced the suppressive effects of HHT against tumor growth (Fig. 7A-7C). Moreover, Western blot analysis demonstrated that the expression levels of NKD1, CDK2, CDK4, Cyclind1 and Bcl-2 decreased, while that of Bax increased in the NKD1 knockdown mice treated with HHT (Fig. 7D, E). IHC results also showed that the NKD1-knockdown mice treated with HHT decreased the protein levels of NKD1, Ki67 and CDK4 (Fig. 7F). These findings further highlighted the crucial roles of NKD1 deletion in impairing the CRC tumorigenesis and improving the HHT sensitivity.

PCM1 as a potential regulatory partner of NKD1

To reveal the potential mechanism of NKD1-mediated responses to HHT sensitivity, quantitative proteomics analysis was used (Fig. 8A). The number of differentially expressed (DE) upregulated and downregulated proteins in the three groups were identified (P value <0.05 and FC >1.2; Supplementary Fig. S2a). The downregulated proteins were analyzed and visualized using a heat map and Venn diagram, showing a total of 58 common intersected proteins (Fig. 8B, C). They were mainly associated with viral life cycle, viral transcription and DNA metabolic process by the ontology (GO) terms (Fig. S2b and S2c). The KEGG pathway enrichment analysis showed that the 58 common intersected proteins were mainly enriched cell cycle and apoptosis signaling pathways, these results were consistent with the previous experimental results (Fig. S2d and Fig. 8D). Next, we cluster four biological functions, including cell proliferation, viral process, cell cycle and apoptosis-related proteins, and found that PCM1, DHFR and PCNA were significantly enriched and decreased in the HHT combined with siNKD1 knockdown group (Fig. 8E). We confirmed with Western blot experiment that the expression of PCM1 was the lowest in both the isolated and combined groups (Fig. 8F). Taken together, these results demonstrated that PCM1 might be a target protein related to NKD1 and potential regulatory partner of NKD1.

NKD1-mediated PCM1 regulated the inhibitory effects of HHT on CRC

Further experiments were conducted to verify whether PCM1 was involved in the regulatory effects of NKD1 on the sensitivity of CRC cells to HHT. The intracellular localization of NKD1 and PCM1 was analyzed by immunofluorescent staining, and found that NKD1 and PCM1 were colocalized in the nucleus (Fig. 9A). Endogenous immune-precipitation showed that NKD1 interacted with PCM1 in SW620 cells (Fig. 9B, C). Meanwhile, depletion of NKD1 decreased the protein expression levels of NKD1 and PCM1, however, the overexpression of PCM1 could not affect the expression of NKD1 (Fig. 9D). Further examination showed that the NKD1 depletion decreased PCM1 protein levels in SW620 cells, and this effect was rescued by the treatment of the proteasome inhibitor MG132 (Fig. 9E). The results also indicated that NKD1 knockdown reduced the stability of PCM1 by acting through protein synthesis inhibitor CHX (Fig. 9F). Meanwhile, CCK8 and colony formation assays indicated that the overexpression of PCM1 could reverse the NKD1 knockdown-induced inhibition of cell growth (Fig. 9G, H). Western blot results also indicated that the knockdown of NKD1 could cause cell cycle arrest and reduce the expression levels of anti-apoptotic proteins. Conversely, these results were partially rescued by the overexpression of PCM1 (Fig. 9I, J). These data indicated that NKD1 targeting PCM1 regulates the therapeutic effects of HHT on CRC.

CRC is a common malignancy with high recurrence and drug resistance. Due to the lack of effective treatment strategies, this disease has become a heavy burden on human health. Seeking effective therapeutic drugs and action targets is the main direction and prerequisite for the treatment of CRC [20, 21]. Previous studies have reported HHT as a highly effective chemotherapeutic drug for the treatment of acute myeloid leukemia [22, 23]. Recent studies illuminated that HHT might also have therapeutic potential against solid tumors [24, 25]. The current study evaluated the effects of HHT and its potential underlying mechanism in CRC. Based on the experiments, this study demonstrated that HHT treatment could inhibit the proliferation of CRC cells in vitro as well as tumor growth in vivo. Further analysis suggested that the inhibitory effects might be attributed to HHT-induced cell cycle arrest and apoptosis. The results implied that HHT might be a potential therapeutic agent for the treatment of CRC.

Cell cycle arrest and apoptosis are the types of cell death with a series of regulated signaling cascades, which are essential for the initiation and progression of cancer [26, 27]. Understanding the mechanisms of how HHT induced CRC apoptosis is important for its possible applications in cancer treatment. Transcriptome sequencing was performed to analyze HHT targets and enrichment signaling pathways. The results showed that the concentration and time dependent expression of NKD1 was significantly decreased in HHT treatment group. Cell cycle and apoptosis signaling pathways were enriched after HHT treatment. NKD1 is a negative regulator of the canonical Wnt signaling pathway [28] and plays a key role in numerous tumors [29, 30]. However, the studies on the correlations between NKD1 and CRC progression are limited and require further investigation. The present study systematically analyzed the relationship between HHT, NKD1 and CRC. Based on the experimental results, it was suggested that NKD1 was highly expressed in CRC tissues and cell lines, the inhibition of NKD1 enhanced the sensitivity of cells to HHT exposure and promoted the HHT-induced cell cycle arrest and apoptosis of CRC cells. Similarly, the knockdown of NKD1 robustly suppressed tumor growth in xenograft tumor mouse models. These findings confirmed that NKD1 promoted CRC progression and served as a novel HHT drug delivery target for CRC patients.

In order to further explore the molecular mechanism by which HHT targeting NKD1 regulates the therapeutic efficiency of CRC, subcellular proteomic and bioinformatic analysis were performed to identify the candidate proteins which participated in the pathways affected by HHT treatment in combination with NKD1 knockdown. The result showed that PCM1 was related to HHT treatment and NKD1 expression. It is well known that PCM1 has a dynamic role in cell cycle distribution and is responsible for protein recruitment and cell division [31]. PCM1 also has been recognized as a key regulator of multiple malignancies. For example, PCM1 was shown to be involved in chromosomal mutations and was associated with glioblastoma and multiple hematological malignancies [32, 33]. A complex formed by the combination of PCM1 and canonical autophagy protein GABAPAP was involved in regulating apoptosis and autophagy [34]. Based on these observations, this study proposed that the targeting of NKD1 by HHT was mediated by the modulation of PCM1, and the NKD1-PCM1 axis might be a driver event in CRC. Mechanistic studies revealed a novel function of NKD1 based on its interaction with PCM1 in the nucleus, which led to the promotion of PCM1 degradation through the ubiquitin-proteasome pathway. Furthermore, the results indicated that the overexpression of PCM1 could effectively reverse the NKD1 knockdown-induced cell cycle arrest and apoptosis in CRC cells, thereby establishing a feedback loop between NKD1 and PCM1 to regulate the sensitivity of CRC to HHT. These findings provided an insight into potential role of NKD1 as a key factor in the regulation of the occurrence and development of CRC, and supported the possibility of HHT-targeting NKD1 for CRC treatment.

In summary, this study proved that HHT could inhibit CRC progression via an NKD1/PCM1 dependent mechanism. This study provided preliminary guidance on developing a potential drug using HHT as the lead compound for CRC treatment, and highlighting the inhibition of NKD1/PCM1 oncogenic signaling to improve HHT sensitivity, which represented a promising therapeutic strategy for the diagnosis and prognosis of CRC.

Data availability statement

The corresponding author will provide the original data used to support the ﬁndings of this study upon reasonable request.

Ethics statement

All animal experiments have complied with the ARRIVE guidelines and have been carried out in accordance with the U.K. Animals Act. Animal study was conducted after approval from the Ethics Committee of Ningxia Medical University.

Conflict of interest

The authors have declared that no competing interest exists.

Funding

This study was funded by First-Class Discipline Construction Founded Project of Ningxia Medical University and the School of Clinical Medicine (No. NXYLXK3020071). Ningxia Natural Science Foundation (No. 2021AAC03350). Special Talent Introduction Project of Ningxia Autonomous Region Key R&D Programs (No. 2021BEB04046). The sixth group of Ningxia Autonomous Region Young Scientific and Technological Talent Lifting Project (No. NXKJTJ2021119). Ningxia high level science and technology innovation leading talent project (Grant No. KJT2019003). The Scientific Research Platform Open Project of the General Hospital of Ningxia Medical University (Grant No.2020-146).

Author contributions

Jia Cao contributed to the experimental work, paper writing and editing, performed the data evaluation and material management. Xiang Tao and Rong Ma were mainly responsible for completing some cell experiments. Jia Wang and Jufen Zhao contributed to the molecular experiments. Bin Shi collected and reviewed clinical data. Jinhai Tian was mainly responsible for biological information analysis. Jingjing Yu and Qi Huang contributed to the data evaluation and data sorting. Libin Wang contributed to the funding acquisition, data evaluation, paper editing and project administration.

Fu, M., S. Pan, X. Cai, Y. Hu, W. Zhang, et al. Analysis of ARHGAP4 Expression With Colorectal Cancer Clinical Characteristics and Prognosis. Frontiers in oncology. 2022. 12:899837.
Xu, M., X. Xu, B. Pan, X. Chen, K. Lin, et al. LncRNA SATB2-AS1 inhibits tumor metastasis and affects the tumor immune cell microenvironment in colorectal cancer by regulating SATB2. Molecular cancer. 2019. 18(1):135.
Micu, B., Ş. Vesa, T. Pop, and C. Micu. Evaluation of prognostic factors for 5 year-survival after surgery for colorectal cancer. Annali italiani di chirurgia. 2020. 91:41-48.
Li, C., L. Dong, R. Su, Y. Bi, Y. Qing, et al. Homoharringtonine exhibits potent anti-tumor effect and modulates DNA epigenome in acute myeloid leukemia by targeting SP1/TET1/5hmC. Haematologica. 2020. 105(1):148-160.
Gandhi, V., W. Plunkett, and J. Cortes. Omacetaxine: a protein translation inhibitor for treatment of chronic myelogenous leukemia. Clinical cancer research : an official journal of the American Association for Cancer Research. 2014. 20(7):1735-1740.
Yakhni, M., A. Briat, A. El Guerrab, L. Furtado, F. Kwiatkowski, et al. Homoharringtonine, an approved anti-leukemia drug, suppresses triple negative breast cancer growth through a rapid reduction of anti-apoptotic protein abundance. American journal of cancer research. 2019. 9(5):1043-1060.
Chen, X., W. Zhang, B. Chen, W. Xi, Y. Lu, et al. MYCHomoharringtonine deregulates transcriptional expression by directly binding NF-κB repressing factor. Proceedings of the National Academy of Sciences of the United States of America. 2019. 116(6):2220-2225.
Guo, S., X. Bai, S. Shi, Y. Deng, X. Kang, et al. TMEM16A, a Homoharringtonine Receptor, as a Potential Endogenic Target for Lung Cancer Treatment. International journal of molecular sciences. 2021. 22(20):10930.
Wang, L., L. Zhao, G. Wei, D. Saur, B. Seidler, et al. Homoharringtonine could induce quick protein synthesis of PSMD11 through activating MEK1/ERK1/2 signaling pathway in pancreatic cancer cells. Journal of cellular biochemistry. 2018. 119(8):6644-6656.
Zhu, M., Z. Gong, Q. Wu, Q. Su, T. Yang, et al. Homoharringtonine suppresses tumor proliferation and migration by regulating EphB4-mediated β-catenin loss in hepatocellular carcinoma. Cell death & disease. 2020. 11(8):632.
Wang, L., D. Wang, L. Wu, J. Cao, J. Tian, et al. Homoharringtonine inhibited breast cancer cells growth via miR-18a-3p/AKT/mTOR signaling pathway. International journal of biological sciences. 2021. 17(4):995-1009.
Shi, X., M. Zhu, Z. Gong, T. Yang, R. Yu, et al. Homoharringtonine suppresses LoVo cell growth by inhibiting EphB4 and the PI3K/AKT and MAPK/EKR1/2 signaling pathways. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association. 2020. 136:110960.
Qu, M., J. Li, and L. Yuan. Uncovering the action mechanism of homoharringtonine against colorectal cancer by using network pharmacology and experimental evaluation. Bioengineered. 2021. 12(2):12940-12953.
Katoh, M. Molecular cloning, gene structure, and expression analyses of NKD1 and NKD2. International journal of oncology. 2001. 19(5):963-969.
Zhang, S., Y. Wang, S. Dai, and E. Wang. Down-regulation of NKD1 increases the invasive potential of non-small-cell lung cancer and correlates with a poor prognosis. BMC cancer. 2011. 11:186.
Lv, Z., L. Zhang, X. Liu, L. Jin, Q. Dong, et al. NKD1 down-regulation is associated with poor prognosis in breast invasive ductal carcinoma. International journal of clinical and experimental pathology. 2015. 8(4):4015-4021.
Zhang, S., J. Li, Z. Yin, P. Liu, W. Zhao, et al. Expression pattern and clinicopathologic significance of NKD1 in human primary hepatocellular carcinoma. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica. 2015. 123(4):315-320.
Wang, Y., C. Yang, W. Li, Y. Shen, J. Deng, et al. Identification of colon tumor marker NKD1 via integrated bioinformatics analysis and experimental validation. Cancer medicine. 2021. 10(20):7383-7394.
Jia Cao, Xi Wang, Danni Wang, Rong Ma et al. PGC-1β cooperating with FOXA2 inhibits proliferation and migration of breast cancer cells. Cancer Cell Int. 2019, 19:93.
Durinikova, E., N. Reilly, K. Buzo, E. Mariella, R. Chilà, et al. Targeting the DNA Damage Response Pathways and Replication Stress in Colorectal Cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2022. 28(17):3874-3889.
Haider, M., K. Zaki, M. El Hamshary, Z. Hussain, G. Orive, et al. Polymeric nanocarriers: A promising tool for early diagnosis and efficient treatment of colorectal cancer. Journal of advanced research. 2022. 39:237-255.
Wei, W., S. Huang, Q. Ling, S. Mao, Y. Qian, et al. Homoharringtonine is synergistically lethal with BCL-2 inhibitor APG-2575 in acute myeloid leukemia. Journal of translational medicine. 2022. 20(1):299.
Yuan, F., D. Li, G. Li, C. Cheng, and X. Wei. Synergistic efficacy of homoharringtonine and venetoclax on acute myeloid leukemia cells and the underlying mechanisms. Annals of translational medicine. 2022. 10(8):490.
Porcù, E., F. Maule, L. Manfreda, E. Mariotto, S. Bresolin, et al. Identification of Homoharringtonine as a potent inhibitor of glioblastoma cell proliferation and migration. Translational research : the journal of laboratory and clinical medicine. 2022. (22):151-157.
Zhang, J., Y. Gan, H. Li, J. Yin, X. He, et al. Inhibition of the CDK2 and Cyclin A complex leads to autophagic degradation of CDK2 in cancer cells. Nature communications. 2022. 13(1):2835.
Sun, Y., Y. Liu, X. Ma, and H. Hu. The Influence of Cell Cycle Regulation on Chemotherapy. International journal of molecular sciences. 2021. 22(13):6923.
D'Arcy, M. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell biology international. 2019. 43(6):582-592.
Kleeman, S., V. Koelzer, H. Jones, E. Vazquez, H. Davis, et al. Exploiting differential Wnt target gene expression to generate a molecular biomarker for colorectal cancer stratification. Gut. 2020. 69(6):1092-1103.
Huang, J., M. Shen, M. Yan, Y. Cui, Z. Gao, et al. Exosome-mediated transfer of miR-1290 promotes cell proliferation and invasion in gastric cancer via NKD1. Acta biochimica et biophysica Sinica. 2019. 51(9):900-907.
Wang, C., L. Mou, H. Chai, F. Wang, Y. Yin, et al. Long non-coding RNA HNF1A-AS1 promotes hepatocellular carcinoma cell proliferation by repressing NKD1 and P21 expression. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2017. 89:926-932.
Balczon, R., L. Bao, and W. Zimmer. PCM-1, A 228-kD centrosome autoantigen with a distinct cell cycle distribution. The Journal of cell biology. 1994. 124(5):783-793.
Wouters, Y., L. Nevejan, A. Louwagie, H. Devos, B. Dewaele, et al. Efficacy of ruxolitinib in B-lymphoblastic leukaemia with the PCM1-JAK2 fusion gene. British journal of haematology. 2021. 192(4):e112-e115.
Hoang-Minh, L., L. Deleyrolle, N. Nakamura, A. Parker, R. Martuscello, et al. PCM1 Depletion Inhibits Glioblastoma Cell Ciliogenesis and Increases Cell Death and Sensitivity to Temozolomide. Translational oncology. 2016. 9(5):392-402.
Joachim, J., M. Razi, D. Judith, M. Wirth, E. Calamita, et al. Centriolar Satellites Control GABARAP Ubiquitination and GABARAP-Mediated Autophagy. Current biology : CB. 2017. 27(14):2123-2136.

Supplementarymaterials.docx

Download PDF

Journal Publication

published 20 Jun, 2023

Read the published version in Molecular Biology Reports →

Editorial decision: Minor Revisions Needed
09 May, 2023
Reviewers invited by journal
03 May, 2023
Reviewers agreed at journal
04 Apr, 2023
Editor assigned by journal
30 Mar, 2023
First submitted to journal
29 Mar, 2023

You are reading this latest preprint version

NKD1 targeting PCM1 regulates the therapeutic effects of HHT on colorectal cancer cells

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell culture and treatment

Cell viability and colony formation assays

5‑Ethynyl-2’-deoxyuridine (EdU) staining assay

RNA extraction and quantitative real-time PCR (qRT–PCR)

RNA interference vectors and cell transfection

Cell cycle and apoptosis analyses using flow cytometry

Protein extraction and Western blot analysis

Co-immunoprecipitation assay

Immunofluorescence (IF) staining

Immunohistochemistry (IHC) staining

Tumor xenograft model

Statistical analyses

Results

HHT potently inhibited the viability and proliferation of CRC cells

HHT accelerated the cell cycle arrest of CRC cells at the G0/G1 phase

HHT induced apoptosis of CRC cells

NKD1 expression was correlated with response to HHT

Expression of NKD1 in the CRC tissues and cell lines

Sensitivity of CRC cells to HHT was associated with NKD1

NKD1 deletion promoted CRC cells sensitivity to HHT in vivo

PCM1 as a potential regulatory partner of NKD1

NKD1-mediated PCM1 regulated the inhibitory effects of HHT on CRC

Discussion

Conclusions

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1