The downregulation of linc-RECK-3 in T1 stage non small cell lung cancer

doi:10.21203/rs.3.rs-2740939/v1

Download PDF

Research Article

The downregulation of linc-RECK-3 in T1 stage non small cell lung cancer

https://doi.org/10.21203/rs.3.rs-2740939/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Lung cancer, with the highest mobidity of malignancies, is the leading cause of cancer-related deaths. According to AJCC staging, T1 stage is the earliest stage. Gene research on T1 stage may reveal the molecular factor about tumorigenesis in the NSCLC. LncRNA is a kind of non-coding RNA, which is related to cell cycle, differentiation, metabolism and disease formation.

Methods

We conducted a retrospective study. 56 patients who underwent surgery at Zhejiang Cancer Hospital from August 2008 to October 2012 with T1 stage non-small cell lung cancer were enrolled. We conducted a survey using real-time quantitative PCR linc-RECK-3 in tumor tissues and normal lung tissues. And then we used SPSS 25.0 for statistical analysis of the data. Wilcoxon Paired Test and Mann-Whitney-U Test was used to analyze Statistical differences(P < 0.05).

Results

We enrolled 56 patients, including 41 males and 15 females, with a median age of 62.5 years. The tumor was no more than 3 cm in diameter and was defined as stage T1. The level of linc-RECK-3 in tumor tissues was significantly lower than that in normal tissues (P = 0.001). And we found there is no significant difference in clinicopathological data(P > 0.05).

Conclusion

Linc-RECK-3 may be associated with the occurrence of non-small cell lung cancer.

linc-RECK-3

lncRNA

lung cancer

According to the American Cancer Society, lung cancer is the leading cause of cancer-related deaths and the most frequently diagnosed cancer[1]. It accounts for about 11.4% of all cancers and its mortality is about 18%. Lung cancer can be divided into two types, namely small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Furthermore, there are two main pathological types of NSCLC, squamous cell carcinoma (SCC) and adenocarcinoma (AD)[2].

Tumor grows gradually. According to the 8th International Union for Cancer Control[3], tumor dimension is an important factor for T staging in non-small cell lung cancer. T1 stage, defined as less than 3 cm in dimension is the earliest stage with the best prognosis. Some T1 stage lung cancer is more invasive which leads to the aggression of tumor. However, relying on traditional pathological diagnose, it`s hard to identify the high-risk tumor. Gene research on T1 stage may reveal the molecular factor about tumorigenesis in NSCLC.

We have conducted two studies to explore the relationship between gene and non-small cell lung cancer. One publication found that VIM was down-regulated in stage T1 NSCLC, the pathological type and lymph node metastasis were correlated with VIM at the transcriptional level, pathological type and smoke index were correlated with VIM at the translational level, and the work had suggested that visceral pleura involvement was associated with E-cad at the translational level[4]. Another research found that CDK-6 had an elevated transcriptional level in T1 NSCLC tumor tissues compared to normal tissues [5].

LncRNA is a type of non-coding RNA, consisting of 200-100000 nucleotides[6], it cannot be translated into proteins, but plays an important role in cells. For example, it is related to cell cycle, differentiation, metabolism and disease formation[7]. More and more reports on the dysregulation of lncRNA expression in various cancer types suggest that abnormal lncRNA expression may be a major factor in tumorigenesis. Some first-discovered lncRNAs, such as H19 and MALAT1, were highly expressed in tumor tissues, suggesting that they were related to the occurrence and development of tumors [8, 9].

We have already studied the relationship between linc-RECK-3 and the occurrence and development of ovarian cancer, and found that the expression of linc-RECK-3 was enhanced in cisplatin-resistant A2780-DR cells. In this study, we researched the expression of linc-RECK-3 in stage T1 non-small cell lung cancer to reveal the role of linc-RECK-3 in the development and progression of lung cancer.

2.1 Cases

We enrolled 56 patients with pathologically diagnosed T1 stage NSCLC in Zhejiang Cancer Hospital from August 2008 to October 2012, whose exclusion criteria were multiple site tumors, chemotherapy or radiotherapy, and other malignant diseases. Tumor grade and staging were defined according to World Health Organization (WHO) standards and the International Union for Cancer Control (UICC, Edition 8) primary tumor, regional lymph node metastasis, and distant metastasis (TNM) grades. This study was a prospective study, using medical records and archived tissue sample data. Prior to study enrollment, each patient had signed a written informed consent.

2.2 Tissue samples

56 patients with stage T1 NSCLC were enrolled. After the lung tissue was resected, tumor and distal normal tissue samples were collected under aseptic conditions and immediately frozen with liquid nitrogen. To extract RNA, specimens are stored at -80°C.

2.3 RNA extraction and cDNA synthesis

Total RNA was extracted from frozen sections of tumor and distal normal samples using NucleoSpin TriPrep kit (MACHEREYNAGEL, Duren, Germany) according to the protocol provided by the manufacturer. RNA purity and concentration were measured using NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA). According to the manufacturer's instructions, cDNA was synthesized from total RNA (1g) using PrimeScript RT reagent kit (TaKaRa, Dalian, Liong, China).

2.4 Real-time fluorescence quantitative PCR analysis

The amplification and melt curves were analyzed using ABI 7500 PCR system (Applied Biosystems). The reaction was performed in a total volume of 20ul using a SYBR premixed Ex Taq kit (Ta KaRa). Linc-RECK-3 primer for 5 -ACAAAAACATACGACACCAC − 3 (forward) and 5 - GCACAGCCGCTTCCCTCACTACCAC − 3 (reverse).

The PCR cycle was set as follows: denaturation at 95℃ for 1 min, and 40 amplification cycles were performed for the sample, each cycle included denaturation (95℃ for 15 s), annealing and extension (60℃ for 1 min). All PCR reactions were three cycles, with ACTB as reference. Eight cases of cDNA were hybridized, packaged and stored at 4℃. A premixed template was used for each PCR experiment. In terms of expression analysis, the experimental design was compared with the reference template. Then, the relative quantification of gene expression in the tested tissues was calculated using the formula: f target = 2-ΔΔCt, ΔΔ Ct = (Ct gene – Ct ACTB) test- (Ct gene – Ct ACTB) reference. To confirm the specificity and accuracy of PCR experiments, PCR products were electrophoretized on 2% agarose gel and sequenced (Shanghai Gene-Nuclear Biotechnology Co., LTD., Shanghai, China).

2.5 Statistical analysis

Since this data was not normally distributed, we chose nonparametric tests for statistical analysis. Wilcoxon Paired Test was used to compare linc-RECK-3 RNA levels in normal and tumor tissues. Mann-Whitney-U Test was used to analyze the correlation between clinicopathological parameters and the level of linc-RECK-3. Statistical significance criteria were P < 0.05. SPSS 25.0 software was used for analysis.

Ethics approval and consent to participate: Ethical approval was obtained for this study. Approval ID: IRB-2015-176. Approval date:2015-01-25. Prior to study enrollment, each patient had signed a written informed consent.

3.1 Cases

We enrolled 56 patients, including 41 males and 15 females, with a median age of 62.5 years. The tumor was no more than 3 cm in diameter and was defined as stage T1. There were 32 cases of squamous cell carcinoma and 24 cases of adenocarcinoma. Thirty-five of the patients had a history of smoking. There were 20 cases with low differentiation and 36 cases with moderate differentiation. There were 8 cases of visceral pleura infiltration and 4 cases of venous invasion. In addition, there were 11 patients with lymph node metastasis.

Table 1: The basic data information of the included patients.

Clinical and pathological parameters	Result
Sample size	56
Gender
Male	41
Female	15
Age
>60	35
<60	21
Smoke index
≥400 pack-years	32
<400 pack-years	24
Tumor diameter
>2cm	29
<2cm	27
Pathological type
Adenocarcinoma	24
squamous cell carcinoma	32
differentiation
poor	20
Well	36
Visceral pleura involvement
yes	8
no	48
Venous invasion
yes	4
no	52
Lymph node metastasis
yes	11
no	45

3.2 The relationship between lnc-RECK-3 and T1 stage

We detected the expression of linc-RECK-3 in normal lung and tumor tissues of 56 patients with T1 stage NSCLC, and the results showed that the level of linc-RECK-3 in tumor tissues was significantly lower than that in normal tissues (P =0.001).

Table 2. Expression and difference of linc-RECK-3 in lung tumor tissues and normal tissues of the included patients.

Tissues	N	M	IQR	Z	P
Tumor	56	0.053	0.103	-	-
Normal	56	0.755	0.931	-	-
Tumor minus normal	56	-0.707	0.874	-5.294	0.001

3.3 The relationship between linc-RECK-3 and clinicopathological data

Some clinicopathological data were analyzed between tumor tissue and normal lung tissue, such as gender, age, smoking index, tumor size, pathological type, differentiation degree, visceral pleura involvement, vascular tumor thrombus and lymph node metastasis, and we found there is no significant difference (P>0.05).

Table 3. The association of linc-RECK-3 expression between tumor or normal tissues and clinicopathological features

Variable	P
Variable	normal	tumor
Gender	0.058	0.554
Age	0.548	0.069
Smoke index (pack-years)	0.070	0.740
Tumor diameter (cm)	0.825	0.706
Pathological type	0.062	0.734
Differentiation	0.209	0.732
Visceral pleura involvement	0.174	0.215
Vascular tumor thrombus	0.346	0.771
Lymph node metastasis	0.248	0.536

RNA is made up of nucleotides and can be divided into two main categories, coding and non-coding RNA. Coding RNA encodes proteins and performs their biological functions. Although non-coding RNA cannot be translated into proteins, it has some other functions. The ENCODE project revealed that the human genome is actively transcribed. However, coding genes account for only 1.5% to 2% of human transcripts, and the vast majority are non-coding RNA[10]. Non-coding RNA is divided into two categories, namely constituent non-coding RNA and regulatory non-coding RNA. Constituent non-coding RNA performs amino acid transport and provides services for protein translation. Regulatory non-coding RNA consists of small non-coding RNA (sncRNA), long non-coding RNA (lncRNA) and circular RNA (circRNA).

Based on the ENCODE project, it is estimated that the human genome encodes over 28,000 different long non-coding RNA[11], many of which remain to be discovered. They participate in gene regulation by controlling protein synthesis, RNA maturation and transport, and regulating chromatin structure[12, 13].LncRNA can be divided into different types according to different definitions: lncRNA transcribed from Intergenic regions are called Intergenic lncRNA, and lncRNAs transcribed completely from introns of protein-coding genes are called Intronic lncRNA. Sense lncRNA are transcribed from the Sense chain of protein-coding genes and contain exons of protein-coding genes, whereas antisense lncRNA are transcribed from the antisense chain of protein-coding genes.[14]

So far, lncRNA has been considered as an important regulator of cancer occurrence and progression. It regulates gene expression at epigenetic, transcriptional, translational, and post-transcriptional levels[6]. In addition, the involvement of lncRNA in lung cancer has attracted the attention of lung cancer researcher. At present, many RNAs have been found in lung cancer and extensive studies have been conducted, for example LncRNA chromatin associated RNA 10 (CAR10) is upregulated in lung adenocarcinoma and promotes tumor metastasis in vitro and in vivo[15]；LncRNA ANRIL was up-regulated in NSCLC tissues and positively correlated with metastasis and poor prognosis[16].The expression of AFAP1-AS1 in NSCLC tissues was significantly higher than that in normal adjacent tissues, and its expression was positively correlated with the tumor pathological grade, TNM stage, distant metastasis and clinical outcome of NSCLC patients [17]. These surveys suggest that many lncRNA expressions are related to lung cancer.

The results of our research showed that the expression of linc-RECK-3 in tumor tissues of patients with T1 stage non-small cell lung cancer is lower than that in normal tissues, and T1 stage is the initial stage of tumor, indicating that linc-RECK-3 has changed in the early stage of tumor, and some genes are changed, indicating that linc-RECK-3 may be related to the occurrence of non-small cell lung cancer, and predicts the occurrence of non-small cell lung cancer in the early stage.

What’s more, pathological type, degree of differentiation, lymph node metastasis, smoking index and visceral pleural invasion of tumor are important clinicopathological data, and are related to the biological behavior of tumor. The results showed that there is no significant difference (P>0.05) between different clinicopathological data, suggesting that there was no significant relationship between linc-RECK-3 and the progression and metastasis of lung cancer.

However, the mechanism of linc-reck-3 downregulation that contributes to lung cancer has not been solved, the specific mechanism and signal pathway of abnormal expression of linc-RECK-3 still need to be further explored. We hope that there will be more studies on this aspect in the future to explore its mechanism of action in non-small cell lung cancer and even other tumors, so as to provide new ideas for the diagnosis or treatment of malignant tumors.

Acknowledgements: This work was supported by Basic Public Welfare Research Project of Zhejiang Province, China (No. LGF20H160005), Project of Zhejiang Administration of Traditional Chinese Medicine(2022ZB047) and 1022 Talent Training Project of Zhejiang Cancer Hospital.

Conflict of Interest Statement

The authors have no conflict of interest.

Authors' contributions: Xiaohui Ding completed the statistical analysis of the data and wrote the first draft of the manuscript. Hongguang Zhao contributed to the trial design and revision of the manuscript. Lifang Wang contributed to the revision of the article.

Thai, A.A., et al., Lung cancer. Lancet, 2021. 398(10299): p. 535–554.
Maghfoor, I. and M.C. Perry, Lung cancer. Ann Saudi Med, 2005. 25(1): p. 1–12.
Lim, W., et al., The 8(th) lung cancer TNM classification and clinical staging system: review of the changes and clinical implications. Quant Imaging Med Surg, 2018. 8(7): p. 709–718.
Luo, T., et al., Downregulated vimentin and upregulated E-cadherin in T1 stage non-small-cell lung cancer: does it suggest a mesenchymal-epithelial transition? Neoplasma, 2017. 64(5): p. 693–699.
Gong, W., et al., Cyclin-dependent kinase 6 (CDK6) is a candidate diagnostic biomarker for early non-small cell lung cancer. Transl Cancer Res, 2020. 9(1): p. 95–103.
Bridges, M.C., A.C. Daulagala, and A. Kourtidis, LNCcation: lncRNA localization and function. J Cell Biol, 2021. 220(2).
Gibb, E.A., C.J. Brown, and W.L. Lam, The functional role of long non-coding RNA in human carcinomas. Mol Cancer, 2011. 10: p. 38.
Zhang, Y., et al., Imprinting of human H19: allele-specific CpG methylation, loss of the active allele in Wilms tumor, and potential for somatic allele switching. Am J Hum Genet, 1993. 53(1): p. 113–24.
Luo, J.H., et al., Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology, 2006. 44(4): p. 1012–24.
Derrien, T., et al., The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome Res, 2012. 22(9): p. 1775–89.
Tragante, V., J.H. Moore, and F.W. Asselbergs, The ENCODE project and perspectives on pathways. Genet Epidemiol, 2014. 38(4): p. 275–80.
Bernstein, E. and C.D. Allis, RNA meets chromatin. Genes Dev, 2005. 19(14): p. 1635–55.
Whitehead, J., G.K. Pandey, and C. Kanduri, Regulation of the mammalian epigenome by long noncoding RNAs. Biochim Biophys Acta, 2009. 1790(9): p. 936–47.
Ma, L., V.B. Bajic, and Z. Zhang, On the classification of long non-coding RNAs. RNA Biol, 2013. 10(6): p. 925–33.
Ge, X., et al., Long noncoding RNA CAR10 promotes lung adenocarcinoma metastasis via miR-203/30/SNAI axis. Oncogene, 2019. 38(16): p. 3061–3076.
Lin, L., et al., Increased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates with poor prognosis. Diagn Pathol, 2015. 10: p. 14.
Zhang, F., et al., AFAP1-AS1: A novel oncogenic long non-coding RNA in human cancers. Cell Prolif, 2018. 51(1).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The downregulation of linc-RECK-3 in T1 stage non small cell lung cancer

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Introduction

Materials And Methods

2.1 Cases

2.2 Tissue samples

2.3 RNA extraction and cDNA synthesis

2.4 Real-time fluorescence quantitative PCR analysis

2.5 Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1