Ovarian tissue collection and cell culture
A total of 160 paired OC tissues with matched adjacent normal tissues were obtained from clinical patients between November 2009 and March 2018. Patients were diagnosed based on clinical and pathological evidence, and samples were immediately quick-frozen and stored in liquid nitrogen tanks. All patients signed informed consent to use the clinical data for research purposes.
OC cell lines, including HO-8910 and OVCAR-3 were obtained from Shanghai Chinese Academy of Sciences cell bank (China), and they were cultured in RPMI-1640 medium (Life Technologies, Carlsbad, CA, USA), supplemented with 10% fetal bovine serum (FBS, Life Technologies) and cultured at 37 °C in a humidified atmosphere with 5% CO2. The medium was changed every 72 h, and passaged at 80% concentration with 0.05% trypsin and 0.02% EDTA.
Immunohistochemical Staining (IHC)
160 individual paraffin-embedded OC tissues were purchased from Shanghai Outdo Biotech Company. The tissue sections were deparaffinized, repaired and blocked with citric acid antigen. Further, they were incubated with ZNF280A antibody at 4 °C overnight. After elution with PBS, secondary antibody IgG (1: 400, Abcam, USA, Cat. # ab6721) was added and incubated. Tissue sections were subsequently stained with DAB and hematoxylin for visualization.
The IHC scoring of ZNF280A expression levels were performed as follow described. The proportion of tumor cells was scored as follows: no positive tumor cells, 0; 0–25% positive tumor cells, 1; 25% – 50% positive tumor cells, 2; 50% – 75% positive tumor cells, 3; and > 75% positive tumor cells, 4. No staining of cytoplasm, membrane or nucleus and interstitium was negative, 0; light yellow, 1; yellow brown, 2; and strong brown 3. Scores given by two independent investigators were averaged for further comparative evaluation of ZNF280A expression. IHC results were determined by adding positive cell score and staining intensity score, and a high score indicated high expression level of ZNF280A in OC tissue.
Lentiviral shRNA Vector Construction And Cell Transfection
Three RNA interference target sequences were designed with ZNF280A as the template, and the optimal kinetic parameter target was selected for subsequent experiments. Oligo single stranded DNA containing RNA interference target sequences was synthesized and annealed to produce double stranded DNA. The linearized vector BR-V108 (Shanghai bioscienceres Co. Ltd., Shanghai, China) was obtained by digestion with restriction enzyme (AgeI, NEB, Cat. # R3552L; EcoRI, NEB, Cat. # R3101L). The reaction system was prepared with linearized vector BR-V108 and annealed product. In this way, the target sequence was connected to the linearized vector BR-V108. Clones on the plate were selected for PCR identification, and the positive clones were sequenced and analyzed. The positive clones were cultured and extracted to obtain high purity plasmids (EndoFree midi Plasmid Kit, TIANGEN, Cat. # DP118-2) for downstream virus packaging. 293T cells were co-transfected with three plasmids (BR-V108, Helper 1.0 and Helper 2.0) to obtain lentivirus. After 48 h the transfected lentivirus was collected for concentration, purification and quality testing, including physical status (color, viscosity), aseptic and virus titer. The prepared lentivirus was used to transfect the HO-8910 and OVCAR-3 cells. The negative control group was transfected with negative lentivirus shCtrl, and the positive group was transfected with shZNF280A. After 72 h, the expression of green fluorescent protein was observed with a fluorescence microscope to evaluate the transfection efficiency.
| Target Number | Target Sequence (5’-3’) |
| Human-ZNF280A-1 | CTGTCACTATGAAGTCTTCAT |
| Human-ZNF280A-2 | TTGTGTAAGAAAGTGGAATCA |
| Human-ZNF280A-3 | GCCGGAGCAACTGCAAGGGTT |
Quantitative Real-time -PCR (qRT-PCR)
First, HO-8910 and OVCAR-3 cells were collected and RNA was extracted by Trizol (Thermo Fisher Scientific Cat. # 204211) according to the manufacturer’s instructions. Concentration and quality of extracted RNA were determined by Nanodrop 2000/2000C spectrophotometer. The cDNA was obtained by reverse transcription with the Promega M-MLV kit. Finally, qRT-PCR was performed using cDNA as the template and fusing curve was made.
| Primer Name | Upstream Primer Sequence (5’-3’) | Downstream Primer Sequence (5’-3’) |
| ZNF280A | GATCTGATCTATGTTGGGGTGGA | CGTGAGCAGGATATTGACGGA |
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
Western Blot
Firstly, total proteins of HO-8910 and OVCAR-3 cells were extracted and quantified using BCA protein assay kit (Thermo Fisher Scientific, Cat. # A53227). Then proteins were separated via 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Next, samples were transferred to polyvinylidene difluoride (PVDF) membranes at 4 °C. After blocking, membranes were incubated first with primary antibodies ZNF280A (1:1000, Abcam, USA, Cat. # ab169117) and GAPDH (1:3000, Bioworld, USA, Cat. # AP0063) and then with secondary antibody IgG (Goat Anti-Rabbit, 1:3000) (Beyotime, Beijing, China, Cat. # A0208). Finally, immunoreactions were visualized using Amersham ECL + plusTM Western Blot system and the blots were imaged using a luminescent image analyser.
Colony Formation Assay
After transfection 4 days, HO-8910 and OVCAR-3 cells were digested with trypsin, resuspended, counted and inoculated on 6-well plates with 800 cells per well. Cells were incubated for 10 days to form colonies and the mediums were replaced every 3 days. Then cells were washed by PBS, fixed by Paraformaldehyde for 1 h, stained with Giemsa for 20 min, washed three times by ddH2O and then photographed with a digital camera. Finally, the number of colonies (> 50 cells/colony) was counted under fluorescence microscopy (MicroPublisher 3.3RTV; Olympus, Tokyo, Japan).
MTT Assay
HO-8910 and OVCAR-3 cells (2 × 103/well) were seeded in 24-well plates. After digestion with trypsin, the medium was completely resuspended. Subsequently, 5 mg/mL 3 (4, 5 dimethylthiazole 2yl) 2, 5 diphenyltetrazole bromide (MTT) (Genview, Beijing, China; Cat. # JT343) 20 µL was added. After 4 h, the medium was completely removed, 100 µL dimethyl sulfoxide (DMSO) was added. The mixed solution was oscillated for 5 min, OD value was detected by the enzyme-connected immunodetector 490/570 nm and the data was recorded for analysis.
Flow Cytometry Apoptotic Assay
HO-8910 and OVCAR-3 cells transfected with lentivirus were inoculated in a 6 cm culture dish for 5 days, which were digested with trypsin and resuspended. Annexin V-APC was added and stained in dark for 15 min. The percentage of cell phase was determined by Flow Cytometry to evaluate the apoptosis rate and the results were analyzed.
Transwell Assay
The chambers were placed in an empty 24-well plate, 100 µL serum-free medium was added to the chamber. HO-8910 and OVCAR-3 cells were digested with trypsin and resuspended with low serum culture medium. Subsequently, the Transwell chamber was removed and washed with PBS. Then methanol was fixed for 30 min and 0.1% crystal violet was stained for 20 min. Finally, the cells under the microscope was observed, photographed and counted.
Wound-healing Assay
Approximately 5 × 104 HO-8910 and OVCAR-3 cells were added into the hole, and the confluence of cells reached more than 90%. The next day, the low concentration serum medium (e.g. 0.5% FBS) was changed and the scratch instrument was used to aim at the central part of the lower end of the 96-well plate and push it up gently to form a scratch. After gently rinsing with serum-free medium 3 times, low concentration serum medium was added and photographed.
Animal Xenograft Model
Animal experiment was approved by the Ethics committee of Shanghai Tongji University conducted in accordance with guidelines and protocols for animal care and protection. BALB/c female nude mice (4 weeks old) were purchased from Beijing Wei Tong Li Hua experimental animal technology Co., Ltd. Adequate HO-8910 cells were digested with trypsin and resuspended. The 10 mice were randomly divided into two groups, the negative group was shCtrl, and the experimental group was shZNF280A. The right forearm armpit of each mouse was subcutaneously injected with 200 µL HO-8910 cells. Tumor size and mouse weight were measured every other day until 17 days after subcutaneous injection. The mice were anesthetized with 0.7% pentobarbital sodium intraperitoneally at a dose of 10 µL/g. Subsequently, the tumor load was evaluated with bioluminescence imaging and analyzed with the IVIS spectral imaging system (emission wavelength 510 nm). After 53 days, the mice were executed with cervical spine, tumor was removed from the mice. Finally, the tumor was weighed and photographed.
Ki67 Staining
Tumor tissues were sectioned from the sacrificed mice. Afterwards, they were repaired and blocked with the citrate antigen. Antibody Ki67 (1: 200, Abcam, USA, Cat. # ab16667) was added to the shCtrl or shZNF280A, respectively. Subsequently, they were mixed and incubated overnight. PBS elution was performed several times before and after antibody addition. Secondary antibody IgG (1: 400, Abcam, USA, Cat. # ab6721) was added and incubated at room temperature for 30 min. Tissue slices were first stained with DAB, and then with hematoxylin. Images were collected with a photomicroscope and analyzed.
Statistical analysis
The data were expressed as mean ± SD (n ≥ 3) and analyzed with GraphPad Prism 6.0 software (GraphPad Software Inc., San Diego, CA, USA). The qRT-PCR was analyzed by 2−∆∆CT method. T-test were used to compare the difference. P values less than 0.05 were considered statistically significant.