Oxidative stress, DNA damage, and gene expression in earthworms (Eisenia fetida) exposure to ethiprole

doi:10.21203/rs.3.rs-2744738/v1

Download PDF

Research Article

Oxidative stress, DNA damage, and gene expression in earthworms (Eisenia fetida) exposure to ethiprole

https://doi.org/10.21203/rs.3.rs-2744738/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 22 Mar, 2024

Read the published version in Environmental Science and Pollution Research →

Version 1

posted

You are reading this latest preprint version

To evaluate the potential ecotoxicity of ethiprole and early warning to earthworms (Eisenia fetida), different concentrations (0, 416, 625, and 1 000 mg kg^− 1) of ethiprole were added to artificial soil. The key bioindicators were measured and screened at 3, 7, 14, 21, and 28 d. The results show that the activity of catalase (CAT) was inhibited for all treatments during the whole exposure period. Besides, the olive tail moment (OTM) value increased gradually as the concentration got higher, which exhibited a dose-time-dependent relationship. Superoxide dismutase (SOD) gene reaching the maximum on the 7th d. Mitochondrial large ribosomal subunit (l-rRNA) gene was always in a down-regulated state as the concentration increased. Our results show that different concentrations of ethiprole induced certain oxidative stress, DNA damage, and genotoxicity in earthworms. The CAT activity, OTM, and SOD gene could be the most sensitive biomarkers to monitor the toxicity of ethiprole in the soil.

Ethiprole

Eisenia fetida

DNA damage

Oxidative stress

Gene expression

Biomarker

Pesticides play a significant role in plant protection and agricultural production. However, 80–90% of pesticides will eventually flow into the soil, producing a certain toxic effect on the ecological environment that impacts non-target organisms and even human beings. In recent years, the environmental safety problems caused by phenylpyrazole insecticides particularly prominent, such as fipronil, ethiprole, flufiprole, and so on (Liu et al. 2020; Gao et al. 2021; Zhou et al. 2022).

Fipronil is a systemic and broad-spectrum insecticide, but it degraded slowly and posed serious threats to bees and aquatic organisms which has been restricted by the European Commission and China (Singh et al. 2021; Zhou et al. 2021). As a significant substitute for fipronil, ethiprole has similar chemical properties and insecticidal activities to fipronil but lower toxicity to mammals, which is widely promoted in China (Liu et al. 2018). Ethiprole is a new phenylpyrazole insecticide, which has been widely used on rice, soybean, and stored grains to control various chewing and sucking pests (Caboni et al. 2003). The machinery of ethiprole is that GABA (γ-aminobutyric acid) interferes with the chloride channels, then destroys the insect's central nervous system and killing them (Pierluigi 2010). Due to its weak adsorption onto the soil, ethiprole is easy to residue in farmland and poses a threat to non-target earthworms. Tian (2016) investigated that some of the derivative toxicity is higher than the parent compound, the degradation half-life of ethiprole in aerobic and anaerobic conditions was 20.4 d and 11.9 d, respectively. Cang et al. (2016) found that the enantio-selectivity of ethiprole for acute toxicity to earthworms is not obvious. At present, the research focused on ethiprole is mainly focused on the degradation trend, dynamics, and enantiomeric difference (Zhang et al. 2016a; Elzaki et al. 2015), and most of them only consider the lethal effect, few studies have been carried out on the toxicity mechanism of sublethal concentrations of ethiprole to earthworms. In fact, the potential effect of pollutants at non-lethal concentrations to non-target organisms, such as behavior, tissue, and activities of enzymes, are closer to the actual situation in the field.

Earthworms, as the most abundant terrestrial species in soil, are widely used as model organisms for the diagnosis of potential contaminant effects (Sanchez-Hernandez 2006). Changes in various biochemical indexes caused by pesticide pollutants in earthworms can be used as important biomarkers for the safe use of pesticides (Zhang et al. 2014). A large number of studies have shown that pesticide stress can result in oxidative stress and the production of excessive ROS (reactive oxygen species), which leads to protein denaturation, DNA replication errors, enzyme inactivation, and so on (Neuparth et al. 2005; Yang et al. 2018). To maintain the balance of ROS, some antioxidant and detoxification enzymes can be activated to scavenge excess ROS. SOD is a specific enzyme that can disproportionate O₂⁻ to H₂O₂ rapidly, then transform H₂O₂ into H₂O and O₂ under the action of CAT and guaiacol peroxidase (POD) (Singh et al. 2006). Malondialdehyde (MDA), as a product of lipid peroxidation, has been widely used as an indicator of oxidative stress (Lin et al. 2010). In addition, molecular biomarkers’ changes are always earlier signals exposed to pollutants (Oost et al. 2003). The SOD gene is a kind of "antioxidant protective gene" that controls oxidative stress by regulating antioxidant enzyme activities (Chen et al. 2011). Translationally controlled tumor protein (TCTP), is a highly conserved protein associated with cell cancer (Di et al. 2002). Heat shock protein 90 (HSP90) is one of the most highly conserved proteins that are easily expressed under environmental stressors and play an important role in maintaining intracellular stability (Zhang et al. 2015b). The mitochondrial large ribosomal subunit (l-rRNA) gene is located in mitochondria, which involves in the synthesis of mitochondrial proteins and is closely related to its energy metabolism (Bommer and Thiele 2004). However, the data on the toxicity mechanism of ethiprole in the soil remains largely unknown. It is essential to screen sensitive biomarkers and establish a risk assessment system for ecotoxicological diagnosis.

In this study, the acute toxicity of different concentrations of ethiprole to earthworms (Eisenia fetida) was investigated, and the effect of ethiprole on oxidative stress, DNA damage, and the expression of related genes (SOD, TCTP, l-rRNA, HSP90) to earthworms were measured, and the most sensitive biomarkers were screened. In addition, it is the first co-toxicological experiment to study the effect of ethiprole on earthworms. The results of this research are of great significance for establishing a risk assessment system, guiding people to use ethiprole, and reducing the environmental pollution.

Chemicals and reagents

Ethiprole (purity ≥ 96%) was obtained from Bayer Crop Science Hangzhou Co., Ltd (Hangzhou, China). All other chemicals were purchased from Tianjin Biotai Technology Co., Ltd. (Tianjin, China).

Earthworms and test soil

The earthworms Eisenia fetida were purchased from Jialiming Earthworm-Breeding Company (Tianjin, China). To ensure the consistency of earthworm activity, the earthworms were preincubated in a large frame (natural soil: peat moss 1:1 (v: v), temperature: 20 ± 1℃, continuously illuminated) and covered with a black towel. The cattle manure and water were added to it every 3–4 days until the second generation. Healthy adult earthworms with obvious clitellum, uniform size, and weight of 300–500 mg were selected for the toxicological test.

The artificial soil was composed of 68% sand, 20% kaolin clay, and 10% sphagnum peat moss, and the pH of it was adjusted to 6.0 ± 0.5 by CaCO₃ (OECD 1984).

Acute toxicity test

Ethiprole was dissolved in acetone and added of 10 g quartz sand. After the acetone evaporated, 490 g of dry artificial soil was mixed thoroughly. According to the results of the pre-experiment, seven concentrations (10 125, 6 750, 4 500, 3 000, 2 000, 1 333.33, 888.66 mg kg^− 1) were set, and each concentration gradient was repeated in three groups. Before the experiments, earthworms were placed in the artificial soil without cattle manure under dark conditions for 24 h. The beakers were covered with plastic wrap with holes and tightened with rubber bands to keep the soil moist and placed in a climate chamber (12 h light:12 h dark, 20 ± 1°C). The mortality of earthworms was 0%.

Extraction of enzymes

According to the OECD guidelines No 222 (OECD, 2016), 1/5, 1/8, and 1/12 of the LC₅₀ of ethiprole were added to the soil. Earthworms were pestled under ice-cold conditions in 9 times the volume of saline (pre-chilled in advance, 1:9, w/v). The 10% homogenate was centrifuged at 3 000 g at 4°C for 10 min. The supernatant was used for the determination of enzyme activities and MDA content. All of the samples were stored at 80°C.

Determination of MDA content and SOD, POD, and CAT activity

The determination of enzyme activities was carried out according to the instructions of the kits (Nanjing Jiancheng, China). The POD activity was determined as described by Song et al. (2008) with slight modifications. The absorbance was recorded every 30 seconds and measured at 470 nm. All the enzymes’ activities were measured using the multi-function microplate reader (Epoch, Biotek, USA).

Comet assay

The comet assay was performed as described by Yang et al. (2018) with modifications. E. fetida coelomocytes were obtained according to the non-invasive extrusion method. After the earthworms spit out a large amount of yellow liquid, the extractions were collected by centrifugation at 4℃, 3 000 rpm for 10 min and washed twice with phosphate-buffered saline (PBS, 4℃, pH = 7.4). 100 µL PBS was added to it and mixed evenly to obtain the extraction.

The first layer of 150 µL 0.65% normal melting agar (NMA) was added to the glass surface slide. After solidification at 4℃ for 20 min, another layer of 50 µL of 1% low melting agar (LMA) and 50 µL of cell suspension were mixed and pipetted onto the first layer of gel. Finish solidification,

the slides were lysed into a lysis solution for 1.5 h and washed with PBS for 3 times, then incubated for 20 min and electrophoresis for 15 min at 15 V. Then neutralized in Tris-HCl solution 3 times at 5 min intervals and dehydrated in ethanol for 30 min. Finally, they were stained with ethidium bromide for 20 min and observed using the fluorescence microscope (Olympus BX51). The comet assay was measured by a comet electrophoresis instrument (COMPAC50-CS300, Cleaver, UK) and analyzed by the CASP software. The olive tail moment (OTM) and tail DNA content (TD%) were used as the parameter to quantify the extent of DNA damage.

Real-time RT- qPCR analysis

Total RNA was isolated using RNAiso Plus (Takara, Japan), according to the manufacturer’s instructions. The first-strand cDNA synthesis was performed using the PrimeScript ^TM RT reagent Kit (Takara, Japan) and stored at -20℃.

RT-qPCR was performed using the TB Green ^TM Premix Ex Taq^TMⅡ kit (Takara, Japan), according to the manufacturer’s instructions. The primers (Table 1) were designed based on known sequences of reference genes and target genes (Brulle et al. 2006). The RT-qPCR was performed in a PCR instrument (qTower 2.2 Real-Time PCR, Jena, Germany). The reaction conditions were as follows: initial denaturation at 95°C for 30 s, followed by 40 amplification cycles (95℃ for 5 s, 60℃ for 20 s). The clones were sequenced by Beijing Genomics Institute (China) and confirm the fragments of the target genes. Gene expression levels were calculated using the 2^−△△Ct method (Livak and Schmittgen 2001). The β-actin was selected as a housekeeping gene to normalize the expression levels of target genes.

Table 1

Sequences of primer used for RT-qPCR
Gene name	Accession No.	Forward primer	Reverse primer
β-actin	Y09623	CGCCTCTTCATCGTCCCTC	GAACATGGTCGTGCCTCCG
SOD	GU177856	TGCTCACTTCAACCCATTT	TTGGCAACACCACTTTCA
CAT	GU177857	TACAAACTGGTGAACGCCGA	AAAGGTCACGGGTCGCATAG
TCTP	GU588158.1	TTGATGACAAGGCGATTGGAGGC	TACGGCGTTTCTCCATCCCATTT
HSP90	CO047078	CGCCGACAAGAACGACAAAT	ATGCCGAGACCGAGCTTGAT
l-rRNA	Y08157	GCGTCGAAGGACAAGAAGAC	CGAGGTGCCAAACCCTACTA

Statistical analysis

All statistical analyses were performed using SPSS 26.0 software and replicated three times. The significant difference was indicated as p < 0.05. All values were calculated as mean ± standard deviation (SD).

Acute toxicity of ethiprole to Eisenia fetida

The acute toxicity of ethiprole to earthworms was shown in Table 2. The symptoms of low-concentration earthworms poisoning were body curl, yellow liquid exuding from the epidermis, the peristaltic ability weakened, and high-concentration earthworms poisoning symptoms were enlarged banding, the body’s the body was severely congested, and even autolysis in severe cases. The LC₅₀ values of ethiprole 14 days were 5000.2, the 95% confidence interval is 4344.6-5897.3, and the regression equation is Y = 1.747X-6.464, R² is 0.954.

Table 2

Mortality of earthworms treated with ethiprole for 7 days and 14 days
Ethiprole concentration (mg kg^− 1)	7 d		14 d
Ethiprole concentration (mg kg^− 1)	Number of deaths	Mortality (%)	Number of deaths	Mortality (%)
10125.00	19	63.33	22	73.33
6750.00	12	46.67	19	63.33
4500.00	8	36.67	12	40.00
3000.00	7	23.33	9	30.00
2000.00	4	23.33	8	26.67
1333.33	2	6.67	7	13.33
888.66	2	6.67	4	13.33

SOD, CAT, POD activity

As shown in Fig. 1(A), the SOD activity of 416 mg·kg^− 1 ethiprole increased firstly and then decreased in this period (except for the 28th d). Compared to the control, the SOD activities of 625 and 1 000 mg·kg^− 1 ethiprole were significantly inhibited at 28 d. The activity of 1 000 mg·kg^− 1 treatment saw a slowly rising trend and reached the maximum at 14 d.

The changes in CAT activities exposure to different concentrations of ethiprole were depicted in Fig. 1(B). Compared with the control, the CAT activity was inhibited for all treatments during the whole exposure period. And with the increment of ethiprole concentration, the inhibition effect was more serious (except for the group of 1 000 mg·kg^− 1 ethiprole on the 28th day).

The changes in POD activities were illustrated in Fig. 1(C). The activity of POD was significantly inhibited at 1 000 mg·kg^− 1 for the whole period, the treatment of 416 mg·kg^− 1 ethiprole was activated obviously at 21 d. With the prolongation of exposure time, the POD activity of 625 mg·kg^− 1 ethiprole treatment increased gradually.

MDA content

The changes in MDA content in earthworms were showed in Fig. 2. The content of MDA in each concentration was higher than that of the control group within 14 days. After 21 d, MDA content decreased to below the control level. With the prolongation of exposure time, the content of MDA increased gradually in 625 mg·kg^− 1 treatment for the whole period.

DNA damage

The OTMs and TD% of E. fetida induced by different concentrations of ethiprole were shown in Fig. 3. Compared to the controls, the OTM value gradually increased at each concentration, 625 and 1 000 mg·kg^− 1 treatments showed a more obvious increase, which indicated the DNA of the tested earthworms were damaged more seriously. This increased effect disappeared after 7 d and a slower rate of decrease with an increasing concentration were shown, which exhibited a good dose-time effect relationship.

HSP90, TCTP, SOD, l-rRNA gene expression

The β-actin gene was used as the housekeeping gene. The expression of the HSP90 gene was up-regulated and reached the maximum at each concentration on the 7th d, which was 2.2, 1.2, and 1.5-fold of the control group, respectively. After 7 days, it began to decrease, and the higher the concentration, the slower the rate of down-regulation. The exposure of ethiprole was significantly down-regulated at concentrations of 625 and 1 000 mg·kg^− 1 on the 28th d (Fig. 4(A)).

Figure 4(B): The expression of TCTP genes was up-regulated within 14 days at a medium concentration (625 mg·kg^− 1), and 1.9-fold higher than that of the control group on the 14th d. Meanwhile, the highest concentration (1 000 mg·kg^− 1) reached the highest expression at the 7th d, which was 1.7-fold higher than that of the control group. There was no significant change in the expression of the TCTP gene at a low concentration (416 mg·kg^− 1) under ethiprole exposure except on the 7th day.

As shown in Fig. 4(C), the SOD gene changes significantly compared with the control. The SOD genes were up-regulated at both low and high concentrations during the entire exposure period of ethiprole. It reached the maximum at 14th d, which is 1.5 and 1.7 times higher than the control, respectively. Then it began to decrease, and the higher the concentration, the slower it decreases.

It can be seen from Fig. 4 (D) that the l-rRNA gene was significantly down-regulated during the whole exposure period compared with the control, and the inhibition was more obvious with the increase of the concentration. There is no up-regulation of the l-rRNA gene was observed throughout the experiment.

The artificial soil method adopted in this paper was close to the natural environment condition, and can truly reflect the transdermal and oral toxicity of chemical pollutants to earthworms. The acute toxicity test provided a base for further research of different ethiprole concentrations. The results showed that ethiprole is a low-toxic pesticide on earthworms, and the toxicity was related to exposure concentration and time. The higher the exposure concentration and the longer the exposure time, the higher the mortality of earthworms and the stronger the toxicity.

Early biochemical responses are important information for the assessment of the potential effects of chemicals on the environment. The increase in SOD activity within 14 days may be due to the production of a large amount of ROS under external stress, which may activate the antioxidant defense system or the neural regulation machinery of earthworms to make them out of danger (Ning et al. 2018). The possible reason for the decrease in SOD activity after 14 days was that the excessive ROS destroyed the antioxidant defense system of earthworms, or the earthworms' repair system was activated to convert excess ROS into H₂O₂. Wang et al. (2016) found that the excessive accumulation of ROS and inhibition of enzyme synthesis were the main reasons for the decrease in SOD. CAT and POD can make the H₂O₂ and other free radicals decompose into H₂O and O₂, after O²⁻ was converted into H₂O₂ under the action of SOD (Liu et al. 2011; Zhang et al. 2015a). In this experiment, compared with the control, the activities of CAT and POD were significantly inhibited at 1 000 mg·kg^− 1, and with the increment of concentration, the inhibitory effect became more serious. The same results were found in the Zhang et al. (2016b) study that the activities of CAT and POD were inhibited when earthworms were exposed to a high concentration of imidaclothiz. This result also showed that the antioxidant abilities of earthworms to protect them from ROS damage were lost. An important finding was that the activity of CAT increased on 14 d, and decreased on 28 d, but the activity of POD reached the maximum on 21 d, which indicated that CAT played the role firstly in the process of converting H₂O₂ into H₂O, then POD did it. Among the changes of SOD, CAT, and POD, they responded differently to the oxidative stress of ethiprole, which indicated a synergistic effect.

Earthworms are susceptible to lipid peroxidation due to their high content of polyunsaturated fatty acids (Ribera et al. 2001). In this experiment, compared with the control group, the content of MDA increased gradually within 14 days, indicating that the lipid peroxidation and unsaturated fatty acid peroxide products were accumulated continuously with the prolongation of exposure time on earthworms. The decrease in MDA content after 21 days may be due to the increased antioxidant activity of antioxidant enzymes during exposure, or the stress effect of ethiprole on earthworms decreased.

Comet assay (Alkaline single-cell gel electrophoresis, SCGE), is a sensitive, efficient, and rapid method to detect DNA damage that has been widely used to evaluate the genotoxicity of pollutants to earthworms (Reinecker and Reinecke 2004; Martin et al. 2005). In this study, the OTM value increased gradually with the increase of the concentration and reached the maximum value on the 7 d. However, the reduction of OTM in the high-concentration treatment group (1 000 mg·kg^− 1) was slower, and the damage still existed until the 28th day. The reason for the increase in the first 7 days may be due to the increasing stress of ethiprole on earthworms resulting in DNA damage and excessive ROS production (Ching et al. 2001). Although the repair system in earthworms can repair automatically occurring DNA changes, excessive ROS can lead to permanent DNA damage. The reason for the decrease after 7 days may be that the antioxidant defense system or the DNA repair system of earthworms was activated by excessive ROS accumulation. However, the specific repair mechanism needs to be further studied. Qiao et al. (2007) said that when the toxic substances in the invertebrate tissue accumulate to a certain threshold or when they are exposed to DNA repair enzymes for a long time, the DNA repair system would be activated.

Gene expression analysis, as one of the leading experimental techniques in toxicogenomic, detects the subtle disturbances of biochemical pathways caused by low levels of environmental stressors. ROS can not only regulate the activity of antioxidative enzymes but also induce the expression of some related genes. In this study, the SOD gene was notably up-regulated when exposed to different ethiprole concentrations, which may be the result of ROS production under ethiprole stress. Scandalios et al. (2005) found that the changes in SOD gene expression were related to oxidative stress, which was to avoid the damage caused by ROS to earthworms. To sum up, it was found that the expression of the SOD gene and SOD activity reached the maximum at 14 d, indicating that antioxidant enzymes and gene expression jointly resisted the damage of ROS under oxidative stress. In addition, the TCTP gene is a highly conserved protein in eukaryotes cells, which plays a very important role in cell cycle regulation and tumor reversal (Telerman and Amson 2009). In this study, the TCTP gene was up-regulated significantly under 625 and 1 000 mg·kg^− 1 treatment. While Wu et al. (2012) found that the TCTP gene was up-regulated under phenanthrene and pyrene treatment. This suggested that ethiprole may harm terrestrial invertebrates through carcinogenesis. It was well known that HSP90 plays an important role in maintaining cell stability. In this experiment, the expression of the HSP90 gene was affected when exposed to different concentrations of ethiprole and significantly down-regulated at 416 mg·kg^− 1. These results may be due to the toxic stress of chemicals, resulting in the induction of HSP90 to maintain cell stability and protect cells. However, the exact contribution of HSP90 in protecting cells from stress remains unclear (Mcclellan et al. 2007).

In this paper, the l-rRNA gene was measured as an indicator of metabolic activity in earthworms. Compared with the control, the expression of the l-rRNA gene was down-regulated at each concentration, and the higher the concentration, the more obvious the inhibitory effect, which may be explained by the potential effect of ethiprole stress on earthworms. Gao et al. (2013) found that the l-rRNA gene was significantly up-regulated under copper stress. The change of l-rRNA gene expression indicates the early effect of ethiprole on the energy metabolism of earthworms, which provides reliable information and a scientific basis for rapid and accurate prediction of environmental pollution and the selection of molecular markers.

This thesis is systematic research of the toxicity of ethiprole on earthworms at the physiological and molecular levels. The study is of great significance to provide scientific support for using the ethiprole and reduce environmental pollution and the damage to non-target organisms. Our research indicated that ethiprole caused a negative impact on the environment, the tested earthworms were subjected to oxidative stress, DNA damage, and genotoxicity. In addition, the CAT activity, OTM, and SOD gene could be the most sensitive biomarkers for monitoring the early warning of ethiprole pollution in the environment.

Funding Information

This work was supported by the National Natural Science Foundation of China (31572034).

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Authors Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Caixia Zhang, Fuhao Wang, Peipei Hao and Ziqi Liu. The first draft of the manuscript was written by Youpu Cheng and Min Zhou. All authors read and approved the final manuscript.

Ethical Approval

All applicable international, national, and/or institutional guidelines for the care and use of animals (Eisenia fetida) were followed.

Consent to Participate

Not applicable.

Consent to Publish

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this paper.

Bommer UA, Thiele BJ (2004) The translationally controlled tumor protein (TCTP). Int J Biochem Cell Biol 36(3):379–385. https://doi.org/10.1016/S1357-2725(03)00213-9
Brulle F, Mitta G, Cocquerelle C, Vieau D, Lemi`ere S, Leprˆetre A, Vandenbulcke F (2006) Cloning and real-time PCR testing of 14 potential biomarkers in Eisenia fetida following cadmium exposure. Environ Sci Technol 40:2844–2850. https://doi.org/10.1021/es052299x
Caboni P, Sammelson RE, Casida JE (2003) Phenylpyrazole insecticide photochemistry, metabolism, and GABAergic action: ethiprole compared with fipronil. J Agric Food Chem 51(24):7055–7061. https://doi.org/10.1021/jf030439l
Cang T, Zhang H, Wang XQ, Wu CG, Chen LZ, Wang XY, Xu MF, Cai LM, Zhao XP (2016) Acute toxicities and preliminary risk evaluation of chiral ethiprole to three non-target organisms. Chin J pesticide Sci 18(1):65–70 (in Chinese). https://doi.org/10.16801/j.issn.1008-7303.2016.0007
Chen C, Zhou QX, Liu S, Xiu ZM (2011) Acute toxicity, biochemical and gene expression responses of the earthworm Eisenia fetida exposed to polycyclic musks. Chemosphere 83:1147–1154. https://doi.org/10.1016/j.chemosphere.2011.01.006
Ching EWK, Siu WHL, Lam PKS, Xu LH, Zhang YY, Richardson BJ, Wu RSS (2001) DNA adduct formation and DNA strand breaks in green-lipped mussels (Perna viridis) exposed to benzo[a]pyrene: dose- and time-dependent relationships. Mar Pollut Bull 42(7):603–610. https://doi.org/10.1016/S0025-326X(00)00209-5
Di Z, Franklin L, Douglas W, Mnjoyan ZH, Ken F (2002) Physical and functional interaction between myeloid cell leukemia 1 protein (MCL1) and Fortilin. The potential role of MCL1 as a fortilin chaperone. J Biol Chem 277:37430–37438. https://doi.org/10.1074/jbc.M207413200
Gao J, Wang F, Cui JN, Zhang Q, Wang P, Liu DH (2021) Assessment of toxicity and environmental behavior of chiral ethiprole and its metabolites using zebrafish model. J Hazard Mater 414:125492. https://doi.org/10.1016/j.jhazmat.2021.125492
Gao Y, Sun X, Gu X, Sun Z (2013) Gene expression responses in different regions of Eisenia fetida with antiparasitic albendazole exposure. Ecotox Environ Safe 89:239–244. https://doi.org/10.1016/j.ecoenv.2012.12.004
Lin DS, Zhou QX, Xie XJ, Liu Y (2010) Potential biochemical and genetic toxicity of triclosan as an emerging pollutant on earthworms (Eisenia fetida). Chemosphere 81:1328–1333. https://doi.org/10.1016/j.chemosphere.2010.08.027
Liu S, Zhou Q, Wang Y (2011) Ecotoxicological responses of the earthworm Eisenia fetida exposed to soil contaminated with HHCB. Chemosphere 83:1080–1086. https://doi.org/10.1016/j.chemosphere.2011.01.046
Liu T, Zhang X, Wang X, Chen D, Li Y, Wang F (2018) Comparative toxicity and bioaccumulation of two dinotefuran metabolites, UF and DN, in earthworms (Eisenia fetida). Environ Pollut 234:988–996. https://doi.org/10.1016/j.envpol.2017.12.007
Liu Y, Wang C, Qi SZ, He J, Bai YC (2021) The sublethal effects of ethiprole on the development, defense mechanism, and immune pathways of honeybees (Apis mellifera L). Environ Geochem Health 43:461–473. https://doi.org/10.1007/s10653-020-00736-7
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real- time quantitative PCR and the 2^{– ∆∆CT} method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262
Martin FL, Piearce TG, Hewer A, Phillips DH, Semple KT (2005) A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil. Environ Pollut 138:307–315. https://doi.org/10.1016/j.envpol.2005.03.012
Mcclellan AJ, Xia Y, Deutschbauer AM, Davis RW, Gerstein M, Frydman J (2007) Diverse Cellular Functions of the Hsp90 Molecular Chaperone Uncovered Using Systems Approaches. Cell 131:121–135. https://doi.org/10.1016/j.cell.2007.07.036
Neuparth T, Correia AD, Costa FO, Lima G, Costa MH (2005) Multi-level assessment of chronic toxicity of estuarine sediments with the amphipod Gammarus locusta: I. Biochemical endpoints. Mar Environ Res 60:69–91. https://doi.org/10.1016/j.marenvres.2004.08.006
Ning YC, Jin CM, Zhou HR, Wang EZ, Huang XN (2018) Screening indices for cadmium-contaminated soil using earthworm as bioindicator. Environ Sci Pollut Res 25:32358–32372. https://doi.org/10.1007/s11356-018-3207-4
Niu XY, Qi SZ, Wu LM, Zhang ZY, Shi MW (2019) Toxicity studies of ethiprole suspension concentrate to newly emerged honey bees (Apis mellifera L). Asian J Ecotoxicol 14(3):203–213 (in Chinese). https://doi.org/10.7524/AJE.1673-5897.20180517001
OECD (1984) Earthworm, Acute Toxicity Tests. Guideline for Testing Chemicals. No. 207. OECD, Paris, France
OECD (2004) Earthworm Reproduction Test. Guideline for Testing Chemicals. No. 222. OECD, Paris, France
Oost RVD, Beyer J, Vermeulen NPE (2003) Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ Toxicol Pharmacol 13:57–149. https://doi.org/10.1016/s1382-6689(02)00126-6
Pierluigi C, Sammelson RE, Casida JE (2003) Phenylpyrazole insecticide photochemistry, metabolism, and GABAergic action: ethiprole compared with fipronil. J Agric Food Chem 51:7055–7061. https://doi.org/10.1021/jf030439l
Qiao M, Chen Y, Wang CX, Wang Z, Zhu YG (2007) DNA damage and repair process in earthworm after in-vivo and in vitro exposure to soils irrigated by wastewaters. Environ Pollut 148(1):141–147. https://doi.org/10.1016/j.envpol.2006.10.033
Reinecke SA, Reinecke AJ (2004) The comet assay as biomarker of heavy metal genotoxicity in earthworms. Arch Environ Contam Toxicol 46:208–215. https://doi.org/10.1007/s00244-003-2253-0
Ribera D, Narbonne JF, Arnaud C, Saint-Denis M (2001) Biochemical responses of the earthworm Eisenia fetida andrei exposed to contaminated artificial soil, effects of carbaryl. Soil Biol Biochem 33:1123–1130. https://doi.org/10.1016/S0038-0717(01)00035-9
Sanchez-Hernandez JC (2006) Earthworm Biomarkers in Ecological Risk Assessment. Rev Environ Contam Toxicol 188:85–126. https://doi.org/10.1007/978-0-387-32964-2_3
Santiago M, Paula D, Inmaculada D, José Antonio C, Felipe C (2008) Genotoxicity detected in wild mice living in a highly polluted wetland area in south western Spain. Environ Pollut 153:590–593. https://doi.org/10.1016/j.envpol.2007.09.008
Scandalios JG (2005) Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Braz J Med Biol Res 38:995–1014. https://doi.org/10.1590/s0100-879x2005000700003
Schreck E, Geret F, Gontier L, Treilhou M (2008) Neurotoxic effect and metabolic responses induced by a mixture of six pesticides on the earthworm Aporrectodea caliginosa nocturna. Chemosphere 71:1832–1839. https://doi.org/10.1016/j.chemosphere.2008.02.003
Singh NP, Mccoy MT, Tice RR, Schneider EL (1988) A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175:184–191. https://doi.org/10.1016/0014-4827(88)90265-0
Singh NS, Sharma R, Singh SK, Singh DK (2021) A comprehensive review of environmental fate and degradation of fipronil and its toxic metabolites. Environ Res 199:111316. https://doi.org/10.1016/j.envres.2021.111316
Singh S, Eapen S, D’Souza SF (2006) Cadmium accumulation and its influence on lipid peroxidation and antioxidative system in an aquatic plant. Bacopa monnieri L Chemosphere 62(2):233–246. https://doi.org/10.1016/j.chemosphere.2005.05.017
Song Y, Zhu LS, Wang J, Wang JH, Liu W, Xie H (2009) DNA damage and effects on antioxidative enzymes in earthworm (Eisenia foetida) induced by atrazine. Soil Biol Biochem 41(5):905–909. https://doi.org/10.1016/j.soilbio.2008.09.009
Telerman A, Amson R (2009) The molecular programme of tumour reversion: the steps beyond malignant transformation. Nat Rev Cancer 9:206. https://doi.org/10.1038/nrc2589
Tian FJ (2016) Research on degration products and pathway of ethiprole in different environments. Dissertation, Henan institute of science and technology
Wang J, Wang G, Zhu L (2016) DNA damage and oxidative stress induced by imidacloprid exposure in the earthworm Eisenia fetida. Chemosphere 144:510–517. https://doi.org/10.1016/j.chemosphere.2015.09.004
Wu S, Zhang H, Zhao S, Wang J, Li H, Chen J (2012) Biomarker responses of earthworms (Eisenia fetida) exposured to phenanthrene and pyrene both singly and combined in microcosms. Chemosphere 87:285–293. https://doi.org/10.1016/j.chemosphere.2011.11.055
Yang Y, Xiao Y, Chang Y, Cui Y, Klobucar G, Li M (2018) Intestinal damage, neurotoxicity and biochemical responses caused by tris (2-chloroethyl) phosphate and tricresyl phosphate on earthworm. Ecotoxicol Environ Saf 158:78–86. https://doi.org/10.1016/j.ecoenv.2018.04.012
Zhang Q, Shi HY, Gao BB, Tian MM, Hua XD, Wang MH (2016a) Enantioseparation and determination of the chiral phenylpyrazole insecticide ethiprole in agricultural and environmental samples and its enantioselective degradation in soil. Sci Total Environ 542:845–853. https://doi.org/10.1016/j.scitotenv.2015.10.132
Zhang Q, Zhang G, Yin P, Lv Y, Yuan S, Chen J, Wei B, Wang C (2015a) Toxicological effects of soil contaminated with spirotetramat to the earthworm Eisenia fetida. Chemosphere 139:138–145. https://doi.org/10.1016/j.chemosphere.2015.05.091
Zhang QM, Zhang BH, Wang CX (2014) Ecotoxicological effects on the earthworm Eisenia fetida following exposure to soil contaminated with imidacloprid. Environ Sci Pollut Res 21:12345–12353. https://doi.org/10.1007/s11356-014-3178-z
Zhang W, Liu K, Li J, Liang J, Lin KF (2015b) Impacts of BDE209 addition on Pb uptake, subcellular partitioning and gene toxicity in earthworm (Eisenia fetida). J Hazard Mater 300:737–744. https://doi.org/10.1016/j.jhazmat.2015.08.014
Zhang Y, Zhang L, Feng L, Mao L, Jiang H (2016b) Oxidative stress of imidaclothiz on earthworm Eisenia fetida. Comp Biochem Physiol C Toxicol Pharmacol 191:1–6. https://doi.org/10.1016/j.cbpc.2016.09.001
Zhou M, Cheng YP, Zhang Y, Liu ZQ, Zhang MH (2022) Oxidative stress, DNA damage, and gene expression induced by flufiprole enantiomers in the earthworms (Eisenia fetida). Comp Biochem Physiol. C Toxicol Pharmacol 257:109341. https://doi.org/10.1016/j.cbpc.2022.109341
Zhou Z, Wu XZ, Lin ZQ, Pang SM, Mishra S, Chen SH (2021) Biodegradation of fipronil: current state of mechanisms of biodegradation and future perspectives. Appl Microbiol Biot 105:7695–7708. https://doi.org/10.1007/s00253-021-11605-3

Download PDF

Journal Publication

published 22 Mar, 2024

Read the published version in Environmental Science and Pollution Research →

Version 1

posted

You are reading this latest preprint version

Oxidative stress, DNA damage, and gene expression in earthworms (Eisenia fetida) exposure to ethiprole

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Chemicals and reagents

Earthworms and test soil

Acute toxicity test

Extraction of enzymes

Determination of MDA content and SOD, POD, and CAT activity

Comet assay

Real-time RT- qPCR analysis

Statistical analysis

Results

Acute toxicity of ethiprole to Eisenia fetida

SOD, CAT, POD activity

MDA content

DNA damage

HSP90, TCTP, SOD, l-rRNA gene expression

Discussion

Conclusion

Declarations

References

Status:

Journal Publication

Version 1