Dietary Effects of Sodium Propionate Supplementation on Growth, Digestive Enzyme Activity and Immune System Gene Expresion of Tropical Gar Juveniles (Atractosteus Tropicus)

doi:10.21203/rs.3.rs-2748665/v1

Download PDF

Research Article

Dietary Effects of Sodium Propionate Supplementation on Growth, Digestive Enzyme Activity and Immune System Gene Expresion of Tropical Gar Juveniles (Atractosteus Tropicus)

https://doi.org/10.21203/rs.3.rs-2748665/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The effect of sodium propionate (SP) added to balanced diets was determined for Atractosteus tropicus juveniles on growth, survival, digestive enzyme activity, and expression of genes associated with the immune system. Five treatments (0, 0.5, 1.0, 1.5, and 2.0%) were evaluated in triplicate during a 61-day feeding trial. 180 organisms (3.65 ± 0.12 g) were distributed in 15 tanks of 70 L. The juveniles were fed five times daily with 6% in relation to the biomass of the organisms. Juveniles fed with 0.5% of SP showed higher final weight, absolute weight gain (AWG), and specific growth rate (SGR). Fish fed with 1.5 and 2.0% SP showed highest survival rate (91.6%). Control group (0%) showed greater activity of lipases and trypsin. The highest activity of alkaline proteases and chymotrypsin was found in treatments with 0 and 0.5% SP, while addition of 1.5% of SP promoted highest activity of acid proteases, and highest relative gene expression of ocln, muc2, and nod2. The inclusion of SP in the diet of A. tropicus juveniles may benefit the activity of digestive enzymes, as well as the expression of genes related to the function of intestinal barrier and therefore increasing the survival of organisms.

Tropical gar

sodium propionate

digestive enzyme

gene expression

nutrition

The tropical gar is a species with a remarkable ecological, economic and cultural importance in Latin America, which is captured throughout the year for market and local consumption (Márquez-Couturier et al., 2015). Due to the pressure exerted by the human population and its economic activities, it seeks to establish a more precise knowledge about the mechanisms of nutrition (Márquez-Couturier & Vázquez-Navarrete, 2015). Proper feeding and nutrition play a fundamental role in the health status of fish and their ability to respond to diseases (Gatlin, 2002).

Several feeding formulas have been evaluated for tropical gar according to the nutritional requirements of the species, adding additives, probiotics and prebiotics that may have positive effects on growth and survival. The analysis of these positive effects can be carried out supported by tools of digestive enzymatic biochemistry and gene expression (Frías-Quintana et al., 2017; Hernández-López et al., 2021; Maytorena-Verdugo et al., 2022; Nájera-Arzola et al., 2018; Nieves-Rodríguez et al., 2018; Pérez-Jiménez et al., 2022; Sepúlveda-Quiroz et al., 2021)

Short-chain fatty acids (SCFAs) are 1–6 carbon organic fatty acids. SFCA has important roles as nutrients for the colonic epithelium; as modulators of intracellular pH, cell volume, and other functions associated with ion transport; and as regulators of gene disappearance, differentiation, and expression (Cook & Sellin, 1998). The main SCFAs are acetate, propionate, and butyrate (Hijova & Chmelarova, 2007), which have been widely studied as feed additives for several species.

Sodium propionate effects has been evaluated in several species such as white shrimp (Litopenaeus vannamei) (da Silva et al., 2016); zebrafish (Danio rerio) (Hoseinifar, Safari, et al., 2017); european seabass (Dicentrarchus labrax) (Wassef et al., 2020); turbot (Scophthalmus maximus L.) (Sun et al., 2022); caspian white fish (Rutilus frisii kutum) (Hoseinifar et al., 2016).

The objective of this work was to determine the effect of different concentrations of sodium propionate (0, 0.5, 1.0, 1.5 and 2.0%) in balanced diets for tropical gar juveniles (A. tropicus) on growth, survival, digestive development, and immune system gene expression.

Biological material

The experiment was carried out at the Laboratorio de Fisiología en Recursos Acuáticos (LAFIRA) in DACBiol-UJAT. Spawning was induced to obtain A. tropicus larvae, using one female (3 kg) and six males (1.5 kg). Female was injected with GnRH (Ourofino Saúde animal, Ltda) (35 µg kgˉ¹) in the base of the pelvic fin. Fish were placed in a 2000 L circular pond with raffia thread to simulate the natural spawning site.

After hatching (72 h post fertilization), larvae were placed in a 70 l plastic tanks for maintenance. Once the nutrients have been absorbed from the yolk sac and after opening of the mouth (3 days post hatching), the larvae were fed 5 times per day (8:00, 11:00, 13:00, 15:00 and 18:00 h) with artemia nauplii following the feeding scheme proposed by De la Cruz-Alvarado et al. (2021) until reaching juvenile size. For this experiment, 180 juveniles (3.65 ± 0.12 g mean weight and 10.38 ± 0.10 cm total length) were used.

Experimental design

Experimental design consisted of a completely randomized single factor experiment. Four treatments were evaluated by triplicate with different concentrations of SP (0.5, 1.0, 1.5 and 2.0%) and a control group (0%). For each experimental unit, 12 organisms were placed in 15 circular tanks of 70 L connected to a recirculation system with a 1500 L reservoir for solids sedimentation and a biological filter driven by a 1 HP water pump (Jacuzzi, JWPA5D-230A, Delavan WI, USA). Water quality parameters were monitored daily until the end of the experiment. Temperature (29.5 ± 0.6°C) and dissolved oxygen (5.4 ± 0.3 mg/l) were measured with an oximeter (YSI 85, Ohio, USA), and pH (7.2 ± 0.1) with a potentiometer (HANNA HI 991001, Romania). The organisms were fed 4 times a day (8:00, 11:00, 14:00 and 18:00 h) at 6% of biomass weight during 61 days of feeding trial.

Experimental diets

A modified diet proposed by Frías-Quintana et al. (2016) was used as base diet. Different concentrations of SP were added according to treatments (Table 1). For the preparation of experimental diets, the methodology described by Álvarez-González et al. (2001) was followed. Macronutrients, micronutrients, and sodium propionate were weighed separately. Macronutrients were mixed for 15 min using an industrial mixer (Bathamex, 178716, Mexico), then the micronutrients and sodium propionate were added and mixed for another 15 min. Finally, liquid ingredients (soy lecithin) and water (400 ml kgˉ¹) were weighted, incorporated, and mixed for 15 min. The resulting mixture was processed in a grinder (Torrey, M-22RI, Monterrey, Mexico) to obtain 5 mm pellets, which were dried in an oven (Coriat, HC-35-D, CDMX, México) at 45°C. for 12 h and stored at -20°C until further analysis.

Table 1

Composition of experimental diets with diferent concentrations of SP
Sodium propionate (%)
Ingredients (g kg^− 1)	0	0.5	1.0	1.5	2.0
Pork mealᵃ Poultry mealᵃ Soybean mealᵇ Corn starchᶜ Fish mealᵃ Wheat mealᵇ Sodium propionateᵈ Soybean lecithinᵉ Gelatinᶠ Vitamins and minerals premixᶢ Vitamin Cʰ	250 218.4 161.1 150 100 55.5 0 30 20 10 5	250 218.4 161.1 150 100 50.5 5 30 20 10 5	250 218.4 161.1 150 100 45.5 10 30 20 10 5	250 218.4 161.1 150 100 40.5 15 30 20 10 5	250 218.4 161.1 150 100 35.5 20 30 20 10 5
Proximal composition (g/100g dry matter)
Protein Lipids Ash NFE	44.32 15.32 12.77 28.49	44.81 15.74 12.74 28.43	43.99 15.43 13.23 28.43	44.83 15.53 13.71 28.48	44.74 15.3 13.53 28.46

ᵃProteínas Marinas y Agropecuarias, S. A. de C. V., Guadalajara, Jalisco

ᵇGALMEX Comercializadora de Insumos Agrícolas, Villahermosa, Tabasco, México

ᶜMSA Industrializadora de Maíz, Guadalajara, Jalisco, México

ᵈMi granero Ingredientes Selectos. San Pedro Cholula, Puebla, México

ᵉPronat Ultra, Mérida, Yucatán, México

ᶠD’gari Productos alimenticios y dietéticos Relámpago, Tlalpan, CDMX, México

ᶢPedregal (para trucha Silver Cup), Toluca, Edo. de Méx. México

ʰROVIMIX® C-EC (Roche) active agent of 35%

Growth and feed indexes

Every 15 days, weight and total length of the organisms were measured until the end of the experiment (day 61). Weight was recorded with an electronic balance (Ohaus HH120, precision 120 ± 0.01 g, Shenzhen, China) and length was measured using a digital vernier. Survival was calculated by counting the juveniles at the end of the feeding trial. With the obtained data, the following indexes were calculated:

$$Survival \left(S\%\right)=\frac{final fish number}{initial fish number }*100$$

$$Absolute weight gain \left(AWG\right)=final weight \left(g\right)-initial weight\left(g\right)$$

$$Specific growth rate \left(SGR\right)=\frac{(\text{ln} final weight-\text{ln} initial weight)}{days of feeding}*100$$

$$Feed conversion rate \left(FCR\right)=\frac{feed intake \left(g\right)}{weight gain \left(g\right)}$$

$$Condition factor \left(K\right)=\frac{final weight \left(g\right)}{total final lenght \left(cm\right)}*100$$

Biological samples

All procedures were performed according to Mexican Norm (NOM-062-ZOO-1999, 2001) of Animal Welfare. At the end of the feeding trial, 15 organisms per treatment were dissected to obtain the visceral package and register biometric data of the organs. For the digestive enzyme analysis, intestine and stomach from three fish per tank were dissected and stored at -80°C until further analysis. For gene expression analysis, intestine and liver from two fish per tank were dissected and stored in RNAlater at -80°C until processing.

Somatic indexes

With the data obtained from the visceral package, somatic indexes were calculated:

$$Hepatosomatic index \left(HSI\right)=\frac{liver weight \left(g\right)*100}{body weight \left(g\right)}$$

$$Viscerosomatic index \left(VSI\right)=\frac{viscera weight \left(g\right)*100}{body weight \left(g\right)}$$

$$Relative intestine length \left(RIL\right)=\frac{intestine length \left(cm\right)*100}{body length \left(cm\right)}$$

Digestive enzyme activity

The crude enzymatic extract was obtained from the stomach and intestine, which were macerated and homogenized separately with distilled water in a 1:10 ratio (weight: volume) under cold conditions (4°C). The mixture was centrifuged at 12,000 rpm for 15 min at 4°C and the supernatant was aliquoted and frozen at -80°C until analysis. Soluble protein concentration was determined following Bradford (1976) protocol using bovine serum albumin (BSA) as the standard protein. Acid proteases (stomach) were determined according to Anson (1938) methodology, using hemoglobin (0.25%) in L–1 glycine-HCl buffer (100 mM, pH 2) as substrate. The activity of alkaline proteases in intestine was determined by the method described by Walter (1984) using casein (0.25%) as substrate in 100 mM Tris-HCL buffer + 10 mM Ca Cl₂ (pH 9). For both techniques, absorbance was measured at 280 nm using a molar extinction coefficient (MOC) of 0.005 ml/µM cm. The methodology described by Erlanger et al. (1961) was followed to determine trypsin activity using 2 mM α-Benzoyl-DL-Arginine- ƿ -nitroanilide (BAPNA) as substrate diluted in 50 mM Tris-HCL + 10 mM CaCl₂ buffer (pH 8.2), absorbance was measured at 410 nm. Chymotrypsin activity was determined according to DelMar et al. (1979) using 1.25 mM SAAPNA substrate in 100 mM Tris-HCL + 100 mM CaCl₂ buffer (pH 7.8), absorbance was measured at 410 nm. Amylase activity was determined according to Robyt & Whelan (1968) using 2% starch as substrate in 100 mM citrate-phosphate buffer + 50 mM NaCl, pH 7.5; the reaction product was measured at 600 nm. Lipase activity was determined according Versaw et al. (1989) technique using 100 mM β-naphthyl acetate as substrate in 50 mM Tris-HCL buffer (pH 7.5) with 100 mM sodium cholate, the reaction was measured at 540 nm. Alkaline and acid phosphatases were determined following methodology described by Bergmeyer (1974) using 4-nitrophenyl phosphate (2.4%), dissolved in 100 mM L–1 glycine-NaOH (pH 10.1) buffer as substrate for alkaline phosphatases and 100 mM citric acid (pH 5.5) for acid phosphatases; the absorbances was measured at 410 nm. The enzyme activity was determined using the following equations: units by ml (U/ml) = [Δabs × final reaction volume (ml)]/[ε × time (min) × extract volume (ml)] − 1; specific activity (U/mg protein) = U ml/ mg of soluble protein.

RNA extraction and qPCR

RNA was extracted from intestine and liver samples using Trizol Reagent according to the manufacturer's protocol (Invitrogen, Waltham, MA). RNA concentration and purity were measured with a spectrophotometer (NanoDrop2000, Thermo Fisher Scientific, Madrid, Spain) using an absorbance radius of 260 and 280 nm. The cDNA synthesis was performed with the Superscript II kit (Invitrogen), using 1 µg of RNA for a final volume of 20 µl. Reactions were performed in a thermocycler (Mastercycler nexus GSX1, Eppendorf AG, Hamburg, Germany) using the following protocol: 5 min at 65°C, 10 min at 25°C (alignment), 50 min at 42°C (cDNA extension), 15 min at 70°C (RT activation) and finally 20 min at 37°C.

Genes related to intestinal health occludin (ocln), nucleotide-binding oligomerization domain-2 (nod2) and mucin 2 (muc2) were analyzed (Table 2).

The RT-qPCR reaction was performed using a CFX96 Real-Time System (BioRad, Hercules, CA) using 5µl of SyberGreen, 3µl of primer mix and 2µl of cDNA for a final volume of 10µl. The protocol followed was: 95°C for 10 min, 40 cycles of 15 s at 95°C, 60°C for 30 s, 70°C for 5 s and finally a melting curve with increments of 0.5°C from 75°C to 95°C. The rpl8 gene was used as the reference gene. Relative gene expression was calculated as fold-change compared with control and using 2^−ΔΔCt formula (Livak & Schmittgen, 2001).

Table 2

Designed primers for qPCR of genes from intestinal barrier of A. tropicus
Gen	Primer sequence (5’-3’)	Size (bp)	Amplification efficiency (%)	Reference
Ribosomal protein (rpl8)	F: TGTGCTGCCTGGAAGAGAAG R: TTTCGGGGTTGTGGGAGATG	90	99.82	Aranda-Morales et al. (2021)
Occludin (ocln)	F: TGACGAATACCACAGACTGAAG R: CGATCATAGTCGCTGACCATC	123		(Sepúlveda-Quiroz et al., 2021)
Mucin (muc2)	F: GGCCTCCTCAAGAGCACGGTG R: TCTGCACGCTGGAGCACTCAATG	100	90.94	(Nieves-Rodríguez et al., 2018)
Nucleotide-binding oligomerization domain-2 (nod2)	F: GTAGTGAACAAGGAGGCGGAC R: TGAGCTCATCCAGGCCATCG	295		(Sepúlveda-Quiroz et al., 2021)

Statistical Analysis

Normality (Kolmogorov-Smirnov) and homoscedasticity (Barttlet) tests were performed for all variables. One-way ANOVA was performed to analyze the variables (growth and digestive enzyme activity). A posteriori test (Tukey) was performed when finding significant differences. Gene expression variables were analyzed using the Kruskal-Wallis and Dunn´s nonparametric test. Statistical analyses were performed in the GraphPad Prism software (v.8.0.2) with a significance value of 0.05.

Growth and survival rates

The 0.5% SP treatment showed the highest value in final weight (25.7 ± 4.5 g). Juveniles of 1.5% SP achieved higher total length (17.83 ± 2.42 cm), however, there was no significant difference in any treatment (p > 0.05). Treatments 1.5 and 2.0% SP showed highest survival rate (91.7 ± 8.33%). Fish fed with 0.5% SP registered higher AWG (21.93 ± 4.39) and SGR (3.1 ± 0.26) (p > 0.05). The 2% SP treatment obtained highest mean FCR (Table 3). No significative differences were found in HSI, VSI and RIL (p > 0.05) (Table 4).

Table 3

Survival and growth parameters and somatic indexes of A. tropicus fed with different SP concentration (mean ± standard deviation, SD) for 61 days.
	Treatments (SP%)
Growth parameters	0	0.5	1	1.5	2
Final Weight (g)	24.19 ± 1.2	25.79 ± 4.5	22.17 ± 2.5	23.32 ± 1.9	21.38 ± 1.2
Final Length (cm)	17.60 ± 0.1	17.74 ± 0.6	17.03 ± 0.5	17.60 ± 0.5	16.79 ± 0.3
Survival (%)	80.5 ± 12.7	86.1 ± 4.8	86.11 ± 9.6	91.6 ± 8.3	91.6 ± 8.3
AWG (g/fish)	20.53 ± 1.26	21.93 ± 4.39	18.52 ± 2.81	19.81 ± 2	17.69 ± 1.02
SGR (%/day)	3.1 ± 0.14	3.1 ± 0.26	3.0 ± 0.34	3.05 ± 0.17	2.9 ± 0.14
Condition factor (k)	0.44 ± 0.02	0.46 ± 0.03	0.45 ± 0.01	0.41 ± 0.04	0.45 ± 0.01
FCR	1.61 ± 0.09	1.92 ± 0.38	1.52 ± 0.23	1.46 ± 0.14	1.40 ± 0.08
Note: AWG: absolute weight gain; SGR: specific growth rate; FCR: feed conversion rate

Table 4

Somatic indexes of A. tropicus fed with different SP concentration (mean ± standard deviation, SD) for 61 days.
	Treatments (SP%)
Somatic indexes	0	0.5	1	1.5	2
HSI	3.26 ± 1.22	3.04 ± 0.67	2.80 ± 0.47	3.47 ± 0.5	2.95 ± 0.61
VSI	9.45 ± 3.65	8.73 ± 1.09	8.01 ± 1.01	10.53 ± 1.77	8.10 ± 1.23
RIL	35.86 ± 4.99	35.18 ± 3.67	38.68 ± 4.91	40.26 ± 4.20	30.92 ± 6.01
Note: HSI: hepatosomatic index; VSI: viscerosomatic index; RIL: relation of intestine length.

Digestive enzyme activity

For acid proteases fish fed with 1.5% SP (95.73 ± 7.26 u mg protein) showed the highest enzyme activity (p < 0.05). Treatment 0.5% SP showed highest activity for alkaline proteases (39.16 ± 3.29) and chymotrypsin (0.44 ± 0.039) (p < 0.05). The control group (0%) showed the highest lipase (152.41 ± 6.84) and trypsin activity (3.13 ± 0.22) (Fig. 1).

Gene expression

According to the qPCR results, in the intestine, fish from 1.5 and 2% SP treatments showed higher ocln expression when compared to the 0.5% (p < 0.05). The fish from de 1.5% SP treatment showed higher expression of the nod2 and muc2 genes in the intestine when comparing with the 0.5 and 1.0% SP treatments (p < 0.05). In liver, 1.5% SP treatment showed higher expression of the nod2 when comparing with 0.5 and 1.0% of SP, and higher expression of ocln gene comparing with 0 and 2.0% tratments (p < 0.05) (Fig. 2).

Innovative trends in aquaculture nutrition include evaluating the effectiveness of several probiotics, prebiotics and additives added to balanced fish diets. Different parameters have been analyzed to characterize the responses to these immunostimulants.

This study evaluated the inclusion of sodium propionate at different concentrations. The results did not show significant differences in productive parameters such as: specific growth rate, feed conversion rate, survival, and somatic indexes. However, A. tropicus juveniles fed with 0.5% SP showed a trend of higher growth, AWG, and SGR. The highest survival occurred in the 1.5 and 2.0% treatments. The effects of including SP in balanced diets for fish may vary according to the species, environmental conditions, the concentration used, and the life stage of the organism. Similar doses were used in other studies. On European seabass (Decentrarchus labrax) final weight, daily weight gain and survival were higher when including 0.3% SP compared to other treatments (Wassef et al., 2019). In the caspian white fish (Rutilus frisii kutum) the inclusion of 0.25 and 0.5% SP resulted in a higher final weight and weight gain, in addition to promoting immune response parameters (Hoseinifar et al., 2016). Another study carried out by Hoseinifar, Safari, et al. (2017) with the zebrafish (Danio rerio) indicates that inclusion of 1 and 2% of SP regulates the expression of genes related to growth hormones GH and IGF1 and GHRL appetite. In yellow fin seabream (Acanthopagrus latus) similar results were obtained when including 0.5 and 1% of SP to promote growth, immune response parameters and digestive capacity (Sotoudeh et al., 2020). In two studies conducted by the same author in white shrimp (Litopenaeus vannamei) it has been shown that including 2% SP increased feed intake, additionally, it reduced the concentration of pathogens such as Vibrio spp in the digestive tract, as well as increasing final weight adding 0.5 to 2% SP in the diet (da Silva et al., 2013, 2016).

Higher HSI in the liver of A. tropicus juveniles may suggest greater glycogen and lipid content, which may be related to the composition of the diets, the health and the metabolism of the organism (Gatlin, 2002; Polakof et al., 2012). Previous studies with red tilapia (Oreochromis sp.) found no significant differences in HSI and VSI when comparing the effects of different organic acids such as propionate, butyrate, and sodium acetate (Ebrahimi et al., 2017). However, in A. tropicus significant differences were found when evaluating this index when adding 0.4% of MOS and FOS (Nájera-Arzola et al., 2018; Sepúlveda-Quiroz et al., 2021) suggesting a greater presence of energy reserves in the liver due to the energy intake in the diets. In the present study no differences were observed in the HIS, VSI and RIL when including SP. The intestinal length ratio (RIL) suggests a greater area of nutrient absorption; however, it is necessary to perform histological studies to assess the structure of the organs related to these indexes.

The effects of the inclusion of probiotics, prebiotics, and other additives to functional diets for fish has led to the study of various functions of the organism, such as the activity of digestive enzymes. (Aalamifar et al., 2020; Castillo et al., 2014; Hoseinifar, Safari, et al., 2017; Hoseinifar, Dadar, et al., 2017; Maytorena-Verdugo et al., 2022; Nájera-Arzola et al., 2018; Nieves-Rodríguez et al., 2018; Pérez-Jiménez et al., 2022; Sepúlveda-Quiroz et al., 2021; Silva et al., 2016; Sotoudeh et al., 2020).

Our results showed highest activity in fish feed with 1 and 2% of SP, similar results showed that adding 1% SP and a mix of SP + sodium acetate increased the activity of this enzyme in yellow fin seabream (Acanthopagrus latus) (Sotoudeh et al., 2020). In contrast, our results showed higher activity of alkaline proteases, trypsin and chymotrypsin in fish fed with 0 and 0.5% of SP. These results may be due to the action of organic acid salts which reduces pH in the stomach and intestine (Lee et al., 2015). Other studies in A. tropicus show increased activity of alkaline proteases, trypsin and chymotrypsin in fish fed with low concentrations of MOS and FOS (0 and 0.5%) (Nájera-Arzola et al., 2018; Sepúlveda-Quiroz et al., 2021). The activity of lipases and amylases were not modified between treatments, similar to the results reported by Nieves-Rodríguez et al. (2018) when including B-glucans in diets for juveniles of A. tropicus. Increase in the activity of these enzymes may be due to the specificity that the enzymes have in terms of pH and temperature values (Guerrero-Zárate et al., 2014; Xiong et al., 2011). Whereas, the modification of the enzyme activities in the group of proteases (acid, alkaline, trypsin and chymotrypsin proteases) suggest a positive effect of organic acids and/or their salts on protein hydrolysis (Lee et al., 2015).

The effects of SP on the expression of ocln, nod2 and muc2 genes have been rarely reported in fish. However, other immune response parameters have been evaluated in other species when including SP in their diets (Hoseinifar et al., 2016; Hoseinifar, Safari, et al., 2017; Safari et al., 2016; Wassef et al., 2019). Mucus is one of the main components of intestine, and is composed mainly of a protein called mucin, which plays an important role in protecting the intestinal barrier, regulating homeostasis, and preventing disease (Liu et al., 2020). Burger-van Paassen et al. (2009) suggests that one of the mechanisms that regulate muc2 expression are short-chain fatty acids such as butyrate or propionate. Our study showed a higher expression of this gene in the intestine of A. tropicus juveniles with 1.5% of SP. Similar results were reported by Pérez-Jiménez et al. (2022) which reported greater expression of muc2 when increasing the concentrations of FOS (7.5%) in larvae of A. tropicus. Other components of the intestinal barrier include the tight junctions (TJs) which provide a barrier within the membrane by regulating paracellular permeability and protein diffusion, thus maintaining cell surface polarity, and enhancing transport of proteins and macromolecules through cells (Treyer & Müsch, 2013). Our study showed greater expression of the ocln gene in the intestine at concentrations of 1.5 and 2% of SP, and in the liver at a concentration of 1.5% SP, suggesting that the addition of short-chain fatty acids also regulates the expression of genes related to tight junctions. Liu et al. (2019) reported similar results of greater expression of ocln when adding sodium butyrate in diets for Scophthalmus maximus L. Sun et al. (2022) also evaluated the inclusion of 0.5 and 1.0% of SP in Scophthalmus maximus combined with soybean meal, and found similar results in the expression of the ocln gene. Sepúlveda-Quiroz et al. (2021) found similar results when evaluating the same genes in juveniles of A. tropicus adding 1 and 1.5% of FOS. Finally, the present study showed a higher expression of the nod2 gene, which has been identified as an important sensor in the first line of defense in the invasion by microorganisms in mammals and teleost fish (Y. Li et al., 2021). Results of this study showed a higher expression of nod2 in intestine and liver in fish fed with 1.5% SP. Highest expression of this gene was observed in the liver, which agrees with (J. Li et al., 2015) where a Vibrio infection was induced (V. anguillarum) in miiuy croaker (Miichthys miiuy) suggesting that the expression of this gene plays an important role in the innate immune response and exerts important immune functions in liver tissues. In contrast, a study with A. tropicus juveniles did not show significant differences in the expression of ocln and nod2 when incorporating β-glucans into their diets (Nieves-Rodríguez et al., 2018). In our study, the increase of immune related genes at a higher concentration of SP, corresponds with the increased survival rate, which also increased at a higher concentration of SP.

The inclusion of 0.5 to 2% SP in diets for A. tropicus did not influence growth parameters and somatic indexes. However, the inclusion of 1.5 SP may have positive effects on the immune response by increasing the expression of muc2, ocln and nod2.

ACKNOWLEDGMENT

The autor would like to thank Consejo Nacional de Ciencia y Tecnología (Conacyt) for the financial support of this project through the Grant “Estudio de la fisiología digestiva en larvas y juveniles de pejelagarto (Atractosteus tropicus) con base en técnicas histológicas, bioquímicas y moleculares” CB-2016-1-282765, and for the Master degree fellowship (CVU 1081761), to Colegio de Postgraduados, Campus Veracruz for economic support throughout the Master degree program Agroecosistemas Tropicales. Finally, to the Laboratorio de Fisiología en Recursos Acuáticos from the Universidad Juárez Autónoma de Tabasco for the technical support during this research project.

AUTHORS CONTRIBUTION

JGAC, CAAG and RMG designed and planned the bioassay; JGAC, TMB and SAFG conducted the experiment and sample collection; JGAC, SAFG, GGAA carried out the biochemical analyses; JGAC, LDJM and TMB conducted the molecular analyses; JGAC, SAFG, CAAG, RGZ and RMG, performed statistical analysis. JGAC, AAH, JLRM, PDR, RMG wrote the paper. All authors contributed to the revision and feedback and approved the final version of the paper.

FINANCIAL SUPPORT

This research was supported by the Consejo Nacional de Ciencia y Tecnología through the Grant “Estudio de la fisiología digestiva en larvas y juveniles de pejelagarto (Atractosteus tropicus) con base en técnicas histológicas, bioquímicas y moleculares” CB-2016-1-282765 and the Colegio de Postgraduados Campus Veracruz through the budget for full time students 32033001.

Ethics approval. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (NOM-062-ZOO-, 1999, 2001).

Competing interests. The authors declare no competing interests.

ORCIDS

Jesús Gabriel Arellano-Carrasco https://orcid.org/0000-0002-3371-0362
Rafael Martínez-García https://orcid.org/0000-0003-2560-1518
Alberto Asiain-Hoyos https://orcid.org/0000-0001-8520-6734
Juan L. Reta-Mendiola https://orcid.org/0000-0002-3569-9291
Pablo Díaz-Rivera https://orcid.org/0000-0003-0463-4628
Susana A. Frías-Gómez https://orcid.org/0000-0002-7950-7757
Talhia Martínez-Burguete https://orcid.org/0000-0002-3475-2804
Gloria Gertrudys Asencio-Alcudia https://orcid.org/0000-0002-7302-659X

Luis Daniel Jiménez-Martínez https://orcid.org/0000-0001-9873-7307

Rocio Guerrero-Zarate https://orcid.org/0000-0002-0346-0841

Cesar A. Sepúlveda-Quiroz https://orcid.org/0000-0002-7787-5249
Carlos A. Álvarez-González https://orcid.org/0000-0001-9240-0041

Aalamifar H, Soltanian S, Vazirzadeh A, Akhlaghi M, Morshedi V, Gholamhosseini A, Mozanzadeh T, M (2020) Dietary butyric acid improved growth, digestive enzyme activities and humoral immune parameters in Barramundi (Lates calcarifer). Aquacult Nutr 26(1):156–164. https://doi.org/10.1111/anu.12977
Álvarez-González CA, Civera-Cerecedo R, Ortiz-Galindo JL, Dumas S, Moreno-Legorreta M, Grayeb-Del Alamo T (2001) Effect of dietary protein level on growth and body composition of juvenile spotted sand bass, Paralabrax maculatofasciatus, fed practical diets. Aquaculture (Amsterdam Netherlands) 194(1–2):151–159. https://doi.org/10.1016/s0044-8486(00)00512-3
Anson ML (1938) The estimation of pepsin, trypsin, papain, and cathepsin with hemoglobin. J Gen Physiol 22(1):79–89. https://doi.org/10.1085/jgp.22.1.79
Aranda-Morales SA, Peña-Marín ES, Jiménez-Martínez LD, Martínez-Burguete T, Martínez-Bautista G, Álvarez-Villagómez CS, De la Rosa-García S, Camarillo-Coop S, Martínez-García R, Guzmán-Villanueva LT, Álvarez-González CA (2021) Expression of ion transport proteins and routine metabolism in juveniles of tropical gar (Atractosteus tropicus) exposed to ammonia. Comp Biochem Physiol Toxicol Pharmacology: CBP 250(109166):109166. https://doi.org/10.1016/j.cbpc.2021.109166
Bergmeyer HU (1974) Phosphatases. In Methods of enzymatic analysis. Sciencedirect. https://doi.org/10.1016/B978-0-12-091304-6.X5001-0. Elsevier
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1–2):248–254. https://doi.org/10.1016/0003-2697(76)90527-3
Burger-van Paassen N, Vincent A, Puiman PJ, van der Sluis M, Bouma J, Boehm G, van Goudoever JB, van Seuningen I, Renes IB (2009) The regulation of intestinal mucin MUC2 expression by short-chain fatty acids: implications for epithelial protection. Biochem J 420(2):211–219. https://doi.org/10.1042/BJ20082222
Castillo S, Rosales M, Pohlenz C, Gatlin DM, III (2014) Effects of organic acids on growth performance and digestive enzyme activities of juvenile red drum Sciaenops ocellatus. Aquaculture (Amsterdam Netherlands) 433:6–12. https://doi.org/10.1016/j.aquaculture.2014.05.038
Cook SI, Sellin JH (1998) Review article: short chain fatty acids in health and disease: REVIEW: SCFAs IN HEALTH AND DISEASE. Aliment Pharmacol Ther 12(6):499–507. https://doi.org/10.1046/j.1365-2036.1998.00337.x
da Silva BC, Vieira FdoN, Mouriño JLP, Bolivar N, Seiffert WQ (2016) Butyrate and propionate improve the growth performance of Litopenaeus vannamei. Aquac Res 47(2):612–623. https://doi.org/10.1111/are.12520
da Silva BC, Vieira FdoN, Mouriño JLP, Ferreira GS, Seiffert WQ (2013) Salts of organic acids selection by multiple characteristics for marine shrimp nutrition. Aquaculture (Amsterdam, Netherlands), 384–387, 104–110. https://doi.org/10.1016/j.aquaculture.2012.12.017
De la Cruz-Alvarado FJ, Álvarez-González CA, Llera-Herrera R, Monroig Ó, Kabeya N, Rodríguez-Morales S, Concha-Frias B, Guerrero-Zárate R, Jiménez-Martínez LD, Peña-Marín ES (2021) Expression of long-chain polyunsaturated fatty acids biosynthesis genes during the early life-cycle stages of the tropical gar Atractosteus tropicus. Comp Biochem Physiol B Biochem Mol Biol 256(110628):110628. https://doi.org/10.1016/j.cbpb.2021.110628
DelMar EG, Largman C, Brodrick JW, Geokas MC (1979) A sensitive new substrate for chymotrypsin. Anal Biochem 99(2):316–320. https://doi.org/10.1016/s0003-2697(79)80013-5
Ebrahimi M, Daeman NH, Chong CM, Karami A, Kumar V, Hoseinifar SH, Romano N (2017) Comparing the effects of different dietary organic acids on the growth, intestinal short-chain fatty acids, and liver histopathology of red hybrid tilapia (Oreochromis sp.) and potential use of these as preservatives. Fish Physiol Biochem 43(4):1195–1207. https://doi.org/10.1007/s10695-017-0365-0
Erlanger BF, Kokowsky N, Cohen W (1961) The preparation and properties of two new chromogenic substrates of trypsin. Arch Biochem Biophys 95(2):271–278. https://doi.org/10.1016/0003-9861(61)90145-x
Frías-Quintana C, Álvarez-González C, Tovar-Ramírez D, Martínez-García R, Camarillo-Coop S, Peña E, Galaviz M (2017) Use of potato starch in diets of tropical gar (Atractosteus tropicus, gill 1863) larvae. Fishes 2(1):3. https://doi.org/10.3390/fishes2010003
Frías-Quintana C, Domínguez-Lorenzo J, Álvarez-González C, Tovar-Ramírez D, Martínez-García R (2016) Using cornstarch in microparticulate diets for larvicultured tropical gar (Atractosteus tropicus). Fish Physiol Biochem 42(2):517–528. https://doi.org/10.1007/s10695-015-0156-4
Gatlin DM, III (2002) Nutrition and Fish Health. In: Halver JE, Hardy RW (eds) Fish Nutrition. Elsevier, pp 672–699
Guerrero-Zárate R, Alvarez-González CA, Olvera-Novoa MA, Perales-García N, Frías-Quintana CA, Martínez-García R, Contreras-Sánchez WM (2014) Partial characterization of digestive proteases in tropical gar Atractosteus tropicus juveniles. Fish Physiol Biochem 40(4):1021–1029. https://doi.org/10.1007/s10695-013-9902-7
Hernández-López IA, Tovar-Ramírez D, De la Rosa-García S, Álvarez-Villagómez CS, Asencio-Alcudia GG, Martínez-Burguete T, Galaviz MA, Guerrero-Zárate R, Martínez-García R, Peña-Marín ES, Álvarez-González CA (2021) Dietary live yeast (Debaryomyces hansenii) provides no advantages in tropical gar, Atractosteus tropicus (Actinopterygii: Lepisosteiformes: Lepisosteidae), juvenile aquaculture. Acta Ichthyol Piscat 51(3):311–320. https://doi.org/10.3897/aiep.51.67095
Hijova E, Chmelarova A (2007) Short chain fatty acids and colonic health. Bratislavské Lekárske Listy 108(8):354–358. https://www.researchgate.net/publication/5647158_Short_chain_fatty_acids_and_colonic_health
Hoseinifar SH, Ahmadi A, Khalili M, Raeisi M, Van Doan H, Caipang CM (2017) The study of antioxidant enzymes and immune-related genes expression in common carp (Cyprinus carpio) fingerlings fed different prebiotics. Aquac Res 48(11):5447–5454. https://doi.org/10.1111/are.13359
Hoseinifar SH, Dadar M, Ringø E (2017) Modulation of nutrient digestibility and digestive enzyme activities in aquatic animals: The functional feed additives scenario. Aquac Res 48(8):3987–4000. https://doi.org/10.1111/are.13368
Hoseinifar SH, Safari R, Dadar M (2017) Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: Insights from zebrafish model. Gen Comp Endocrinol 243:78–83. https://doi.org/10.1016/j.ygcen.2016.11.008
Hoseinifar SH, Zoheiri F, Caipang CM (2016) Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry. Fish Shellfish Immunol 55:523–528. https://doi.org/10.1016/j.fsi.2016.06.027
Li J, Gao Y, Xu T (2015) Comparative genomic and evolution of vertebrate NOD1 and NOD2 genes and their immune response in miiuy croaker. Fish Shellfish Immunol 46(2):387–397. https://doi.org/10.1016/j.fsi.2015.06.026
Li Y, Jin L, Xia P, Sui W, Huang A, Bu G, Meng F, Kong F, Cao X, Han X, Yu G, Pan X, Yang S, Zheng C, Zeng X, Du X (2021) Identification and functional analysis of NOD2 and its two splicing variants associated with a novel pattern of signal regulation in teleost fishes. Dev Comp Immunol 120(104049):104049. https://doi.org/10.1016/j.dci.2021.104049
Lim C, Lückstädt C, Webster CD, Kesius P (2015) Organic Acids and Their Salts. In: Lee C-S, Lim C, Gatlin DM III, Webster CD (eds) Dietary nutrients, additives, and fish health. John Wiley & Sons, Inc., pp 305–315
Liu Y, Chen Z, Dai J, Yang P, Xu W, Ai Q, Zhang W, Zhang Y, Zhang Y, Mai K (2019) Sodium butyrate supplementation in high-soybean meal diets for turbot (Scophthalmus maximus L.): Effects on inflammatory status, mucosal barriers and microbiota in the intestine. Fish Shellfish Immunol 88:65–75. https://doi.org/10.1016/j.fsi.2019.02.064
Liu Y, Yu X, Zhao J, Zhang H, Zhai Q, Chen W (2020) The role of MUC2 mucin in intestinal homeostasis and the impact of dietary components on MUC2 expression. Int J Biol Macromol 164:884–891. https://doi.org/10.1016/j.ijbiomac.2020.07.191
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT Method. Methods (San Diego Calif) 25(4):402–408. https://doi.org/10.1006/meth.2001.1262
Márquez-Couturier G, Navarrete-Vázquez C, Sánchez-Contreras W, Álvarez-González CA (2015) Acuacultura tropical sustentable: Una estrategia para la producción y conservación del pejelagarto (Atractosteus tropicus) en Tabasco, México. Universidad Juárez Autónoma de Tabasco. http://publicaciones.ujat.mx/cientificas/Documentos/Biología/36/Acuicultura
Márquez-Couturier G, Vázquez-Navarrete CJ (2015) Estado de arte de la biología y cultivo de pejelagarto (Atractosteus tropicus). Agroproductividad 8(8):44–51
Maytorena-Verdugo CI, Peña-Marín ES, Alvarez-Villagómez CS, Pérez-Jiménez GM, Sepúlveda-Quiroz CA, Alvarez-González CA (2022) Inclusion of Mannan-oligosaccharides in diets for tropical gar Atractosteus tropicus larvae: Effects on growth, digestive enzymes, and expression of intestinal barrier genes. Fishes 7(3):127. https://doi.org/10.3390/fishes7030127
Nájera-Arzola IC, Álvarez-González CA, Frías-Quintana CA, Peña E, Martínez-García R, Camarillo-Coop S (2018) Evaluation of Mannan oligosaccharides (MOS) in balanced diets for tropical gar juveniles (Atractosteus tropicus). Hidrobiologica 28(3):239–246. https://doi.org/10.24275/uam/izt/dcbs/hidro/2018v28n3/pena
Nieves-Rodríguez K, Álvarez-González C, Peña-Marín E, Vega-Villasante F, Martínez-García R, Camarillo-Coop S, Tovar-Ramírez D, Guzmán-Villanueva L, Andree K, Gisbert E (2018) Effect of β-glucans in diets on growth, survival, digestive enzyme activity, and immune system and intestinal barrier gene expression for tropical gar (Atractosteus tropicus) juveniles. Fishes 3(3):27. https://doi.org/10.3390/fishes3030027
NOM-062-ZOO- (2001) Norma Oficial Mexicana: Especificaciones técnicas para la producción, cuidado y uso de los animales de laboratorio. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. https://www.gob.mx/senasica/documentos/nom-062-zoo-1999
Pérez-Jiménez GM, Peña-Marín ES, Maytorena-Verdugo CI, Sepúlveda-Quiroz CA, Jiménez-Martínez LD, De la Rosa-García, Asencio-Alcudia S, Martínez GG, Tovar-Ramírez R, Galaviz D, Martínez-Burguete MA, Alvarez-González T, C. A., Alvarez-Villagomez CS (2022) Incorporation of fructooligosaccharides in diets influence growth performance, digestive enzyme activity, and expression of intestinal barrier function genes in tropical gar (Atractosteus tropicus) larvae. Fishes, 7(3), 137. https://doi.org/10.3390/fishes7030137
Polakof S, Panserat S, Soengas JL, Moon TW (2012) Glucose metabolism in fish: a review. Journal of Comparative Physiology. B, Biochemical, Systemic, and Environmental Physiology, 182(8), 1015–1045. https://doi.org/10.1007/s00360-012-0658-7
Robyt JF, Whelan W (1968) Amylases. In: Radley JA (ed) Starch and its derivates. Chapman and Hall, London, UK
Safari R, Hoseinifar SH, Kavandi M (2016) Modulation of antioxidant defense and immune response in zebra fish (Danio rerio) using dietary sodium propionate. Fish Physiol Biochem 42(6):1733–1739. https://doi.org/10.1007/s10695-016-0253-z
Sepúlveda-Quiroz CA, Peña-Marín ES, Pérez-Morales A, Martínez-García R, Alvarez-Villagomez CS, Maytorena-Verdugo CI, Camarillo-Coop S, Vissio PG, Pérez Sirkin D, Tovar-Ramírez D, Galaviz M, Álvarez-González CA (2021) Fructooligosaccharide supplementation in diets for tropical gar (Atractosteus tropicus) juvenile: Effects on morphophysiology and intestinal barrier function. Aquac Res 52(1):37–50. https://doi.org/10.1111/are.14867
Silva BC, Jesus GFA, Seiffert WQ, Vieira FN, Mouriño JLP, Jatobá A, Nolasco-Soria H (2016) The effects of dietary supplementation with butyrate and polyhydroxybutyrate on the digestive capacity and intestinal morphology of Pacific White Shrimp (Litopenaeus vannamei). Mar Freshw Behav Physiol 49(6):447–458. https://doi.org/10.1080/10236244.2016.1257759
Sotoudeh E, Sangari M, Bagheri D, Morammazi S, Torfi Mozanzadeh M (2020) Dietary organic acid salts mitigate plant protein induced inflammatory response and improve humoral immunity, antioxidative status and digestive enzyme activities in yellowfin seabream, Acanthopagrus latus. Aquacult Nutr 26(5):1669–1680. https://doi.org/10.1111/anu.13112
Sun H, Zhang J, Wang W, Shao R, Liang S, Xu W, Li M, Ai Q, Mai K, Wan M (2022) The effects of sodium propionate supplementation in the diet with high soybean meal on growth performance, intestinal health, and immune resistance to bacterial infection in turbot (Scophthalmus maximus L.). Aquaculture Nutrition, 2022, 8952755. https://doi.org/10.1155/2022/8952755
Treyer A, Müsch A (2013) Hepatocyte polarity. Compr Physiol 3(1):243–287. https://doi.org/10.1002/cphy.c120009
Versaw WK, Cuppett SL, Winters DD, Williams LE (1989) An improved colorimetric assay for bacterial lipase in nonfat dry milk. J Food Sci 54(6):1557–1558. https://doi.org/10.1111/j.1365-2621.1989.tb05159.x
Walter HE (1984) Proteinases: methods with hemoglobin, casein and azocoll as substrates. In: Bergmeyer HJ (ed) Methods of Enzymatic Analysis: Vol. V. Verlag Chemie, Weinham, pp 270–277
Wassef EA, Saleh NE, Abdel-Meguid NE, Barakat KM, Abdel-Mohsen HH, El-bermawy NM (2019) Sodium propionate as a dietary acidifier for European seabass (Dicentrarchus labrax) fry: immune competence, gut microbiome, and intestinal histology benefits. Aquaculture International: Journal of the European Aquaculture Society 28(1):95–111. https://doi.org/10.1007/s10499-019-00446-7
Xiong DM, Xie CX, Zhang HJ, Liu HP (2011) Digestive enzymes along digestive tract of a carnivorous fish Glyptosternum maculatum (Sisoridae, Siluriformes): Digestive enzymes of Glyptosternum maculatum. J Anim Physiol Anim Nutr 95(1):56–64. https://doi.org/10.1111/j.1439-0396.2009.00984.x

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Dietary Effects of Sodium Propionate Supplementation on Growth, Digestive Enzyme Activity and Immune System Gene Expresion of Tropical Gar Juveniles (Atractosteus Tropicus)

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Statistical Analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1