A strong Association between Plasminogen Activator Inhibitor Type - 1 (-657 4G/5G PAI-1) and the Development of Pre-eclampsia

doi:10.21203/rs.3.rs-2750742/v1

Download PDF

Research Article

A strong Association between Plasminogen Activator Inhibitor Type - 1 (-657 4G/5G PAI-1) and the Development of Pre-eclampsia

https://doi.org/10.21203/rs.3.rs-2750742/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction: Pre-eclampsia (P-EC) is a multisystem disorder of pregnancy, characterized by new-onset hypertension and proteinuria. Deregulation of the coagulation cascade and hypofibrinolysis appears to play a role in the development of P-EC.

Methods: About 140 Egyptian pregnant women with a diagnosis of P-EC (patients' group) and 100 normotensive pregnant women not complicated by P-EC (a healthy control group) were collected. The genomic DNA was extracted from peripheral blood. Single-nucleotide polymorphisms were genotyped using ARMS-PCR. The serum was used for biochemical parameters measurement.

Results: There is a strong significant (P < 0.0001) difference between PAI-1 5G/4G polymorphism among the patients and the control groups in the codominant model, high significant (P = 0.004) in the dominant model, high significant (P = 0.009) in the recessive model. Additionally, superoxide dismutase activity and reduced glutathione levels were decreased in pre-eclamptic women when compared to normotensive ones. On the other hand, malondialdehyde and glutathione peroxidase levels were increased in the pre-eclamptic group when compared with normalized pregnant ones.

Conclusion: Our results showed that the mutated PAI-15G/4G polymorphisms may be associated with the development of P-EC in Egyptian women.

Pre-eclampsia

Pregnancy

Single-nucleotide polymorphisms

PCR

Pregnancy entails a balance between thrombosis as well as fibrinolysis that is dynamic during pregnancy to increase coagulation during the third trimester. During implantation as well as placentation, proteolysis permits appropriate invasion of the trophoblast in addition to spiral artery remodeling, which has to be maintained in equilibrium via antifibrinolytic factors [1, 2].

Plasminogen activator inhibitor-1 (PAI-1) contributes to the regulation of the fibrin pathway via the inhabitation of tissue plasminogen activator (tPA) that typically divides plasminogen to plasmin, and consequently divides fibrin into degraded products. Hence, in the case of activating tPA through PAI-1, the establishment of a prothrombotic state occurs [1]. PAI-1 results from activated platelets, endothelial cells, as well as placental vasculature and trophoblasts during pregnancy [3].

Progesterone elevates PAI-1 expression from decidua as well as PAI-2 release entirely from the placenta as an element of thrombotic factor systemic upregulation in pregnancy [4]. Consequently, PAI-1 is considered an endothelial impairment marker, while PAI-2 is usually employed as a placental function surrogate. Concerning healthy women, the levels of PAI-1 levels are elevated to reach 4-5-fold during the third trimester, then back to a normal state following birth [5].

The gene promoter area of PAI-1 is featured by distinct polymorphism, particularly the 4G insertion / 5G deletion polymorphism that promotes PAI-1 transcription [6]. PAI-1 expression is modulated by risk factors of atherosclerosis which result in damage of endothelia, including, insulin resistance, diabetes as well as hypertriglyceridemia. Such risk factors would induce local hypoxia that modifies PAI-1-cell-type specific expression. Moreover, there is a controversial correlation between adverse outcomes of pregnancy as well as PAI-1 polymorphisms, including recurrent pregnancy loss (RPL), intrauterine growth restriction (IUGR), as well as pre-eclampsia (P-EC) [7].

Pre-eclampsia is regarded as the most dangerous complication that threatens the life of pregnant females as well as embryos. The most serious risk factors involved with P-EC are diabetes mellitus, age, renal disease, chronic hypertension, and obesity [8].

Early onset of pre-eclampsia immoderately induces perinatal morbidity as well as mortality [1]. Pre-eclampsia has a range of phenotypic manifestations along with varying severity as well as onset, in addition to e presence of more than one disease-inducing etiology, each coinciding with a centric process of peculiar activation of inflammation, fibrinolysis, and coagulation. The inciting event along with the early onset of the disease is assumed to take place during placentation, with trophoblast impairment invasion, in addition to spiral artery remodeling, and thus endothelial impairment, intravascular inflammation, and uteroplacental ischemia. Previously acquired or inherited thrombophilia may be inclined to this abnormal placenta. Additional evidence for an underlying hypercoagulable condition has been evidenced in a wide range of placenta pathological studies in subjects with pre-eclampsia indicative of thrombosis, fibrin deposition, and villous infarcts [9, 10].

The correlation of maternal oxidative stress with the later evolution of complications including P-EC has been studied in multiple types of research [11].

The possible indices of oxidative stress can be attributed to elevated consumption of oxygen, mineral deficiencies, and physiological modifications during pregnancy. Placental hypoxia is a serious factor of P-EC that occurs as a result of reduced perfusion and ischemic reperfusion and, as a consequence, leads to an elevation in free radical synthesis such as placenta superoxide anion [12].

Under ordinary conditions, free radical production in endothelial cells is comparatively minimized. It is suspected that the production of free radicals in pre-eclampsia increases the usage of antioxidants. It has not been determined if endothelial impairment induced by antioxidant deficiency or excessive oxidative stress is involved in pre-eclampsia development or if the inappropriate function is triggered by confirmed pre-eclampsia may result in oxidative stress. It is reported that oxidative stress takes place before pre-eclampsia-onset and the placenta is indicated as the main organ responsible for the generation of free radicals in females who experienced pre-eclampsia [13].

In the present study, we investigated the correlation of -675 4G/5G PAI-1 gene polymorphisms with P-EC, and the role of the imbalance between oxidants and antioxidants in a cohort of Egyptian women.

1. Sample preparation

This case-control study was performed on 140 women with a diagnosis of P-EC (blood pressure >140/90 mmHg and proteinuria >0.3 g in 24-hour urine samples after 32 weeks of pregnancy) in the case group and 100 healthy women with a previous pregnancy (or pregnancies) without P-EC in the control group. The samples were collected from December 2019 to August 2020 in Mansoura University Main hospital from the Department of Obstetrics and Gynecology according to the ethical standards of the Institutional Research Board (IRB), Faculty of Medicine, Mansoura University. Each participant signed the informed consent. Any patients with past or present medical disorders associated or not associated with pregnancy were excluded from the study.

2. Blood sampling

Five milliliters of blood were collected by vein puncture from all patients and control groups. The blood sample was dispensed in EDTA tubes for molecular studies and whole blood was obtained as a serum for biochemical parameters measurement.

3 DNA extraction and genotyping

The genomic DNA was extracted from peripheral blood using a high pure PCR template preparation kit according to the manufacturer’s protocol (QI amp DNA Blood Mini Kit supplied by Qiagen GmbH Cat, No. 51104, Hiden, Germany), Genotyping was performed using ARMS- PCR SNP kit according to the manufacturer’s protocol (Thermal Cycler TECHEN TC-312) [14]. All the PCR reactions were carried out in duplicate in a PCR thermocycler. Primer pairs used for screening of -657 4G/5G PAI-1 mutation by ARMS-PCR are listed in (Table 1) [15].

Table 1: Primer pairs used for screening of PAI-1 4G/5G mutation by ARMS-PCR

Mutation	Primer sequence	Size(bp)
PAI-1 4G/5G	Consensus (common primer): CCTAAAAGCACACCCTGCAA
	5G: 5`-ACACGGCTGACTCCCCCA-3`	312
	4G: 5`- ATACACGGCTGACTCCCCA– 3`	313

4. Primer-PCR program

The optimization of amplification was performed under the conditions listed in (Table 2). The PCR products were electrophoresed on 2% agarose gel, stained with ethidium bromide, and visualized under UV light.

Table 2: Optimization of PCR conditions for PAI-1 gene

Cycle no.	Time	Temperature °C	Cycle name
1 cycle	3 min	95	Initial denaturation
30 cycle	20 sec	95	Denaturation
	10 sec	55	Annealing
	20 sec	72	Extension
1 cycle	3 min	72	Final extension
1 cycle	&	4	Soak

5. Biochemical Parameters:

LPO (ng/mg) was determined in terms of MDA (nmol/mL) according to the method of Nadiger et al., 1986 [16]. Superoxide dismutase activity (SOD) (U/mL) was estimated according to the method of Hartz et al., 1973 [17]. Glutathione peroxidase [GPx) activity (U/mL) was determined by the nonenzymatic method by Paglia et al., 1967 [18]. Glutathione reductase (GSH) activity (ng/mL) was measured according to the method of Goldberg et al., 1983 [19].

Statistical analysis

Statistical analysis was performed using SPSS version 25. The genotype distributions of mutation and the frequency of heterozygous and homozygous were compared between patients and controls using Pearson’s Chi-square test. The P value of <0.05 was regarded as significant. Comparison between the genotypes and different parameters among groups was performed using the One-Way ANOVA test.

This study represents a biochemical study including about 140 pre-eclampsia patients and 100 control volunteers from Mansoura University Hospital between 2019- 2020. The present resultsshow descriptive data for all quantitative parameters studied in control participants in contrast to pre-eclampsia cases.

1. The distribution of demographic variables among patients and control groups is displayed in (Table 3)

Table 3 shows the median age of pre-eclampsia patients was (28.96±6.9) years and the median age of the control was (25.6 ± 4.2) years. A strong significant (P < 0.0001) difference was detected related to age between pre-eclampsia patients and control. A strong statistically significant (P < 0.0001) difference in systolic blood pressure between patients (151.4±18) compared to control (124±4.2), in addition to a strong statistically significant (P < 0.0001) difference in diastolic blood pressure between patients (92.6±12) compared to control (82±3). A strong significant (P < 0.0001) decrease in the percentage of hemoglobin was observed in cases of pre-eclampsia (10.38±1.4) compared to control (12.31 ±1.25). In contrast, A highly significant (P=0.009) elevation in the activities of ALT was detected in cases of pre-eclampsia (29 ±3.4) compared to the control (21.0 ±8.6). However, no significant changes were detected in the activity of AST of pre-eclampsia patients (32.4 ± 5.1) compared to the control (29.38± 9). A strong statistically significant (P < 0.0001) decrease in the level of serum albumin of the patients (3.025± 0.6) compared to the control (3.9±0.3). Concerning the level of random blood glucose, a strong significant (P < 0.0001) elevation was observed in pre-eclampsia patients (109 ±35) in comparison to the control (86 ± 4.9). While there was no significant difference in the level of creatinine in pre-eclampsia (0.782 ± 0.14) and control (0.815 ± 0.19).

Table 3: Distribution of demographic data between pre-eclampsia patients and control groups

P value	Patients group (n=140)	Control group (n=100)	Parameters
P value	Mean ±SD	Mean ±SD
< 0.0001***	28.96±6.9	25.6 ± 4.2	Age (year)
< 0.0001****	151.4±18	124±4.2	SBP (mmHg)
< 0.0001****	92.6±12	82±3	DBP (mmHg)
< 0.0001****	10.38±1.4	12.31±1.25	HB (g %)
0.009***	29±3.4	21±8.6	ALT (IU/L)
0.2	32.4±5.1	29.38±9	AST (IU/L)
< 0.0001********	3.025± 0.6	3.9±0.3	Serum albumin (g/dL)
< 0.0001****	109±35	86±4.9	RBG (mmol/L)
1.65	0.782±0.14	0.815±0.19	Creatinine (mg/dL)

Data were expressed as Mean ± SD. *P≤0.05 = significant, **P≤0.01 = very significant, ***P≤0.001 = highly significant, ****P≤0.0001 = strong significant, n= number of cases, SBP=systolic blood pressure, DBP= Diastolic blood pressure, HB=Hemoglobin, AST=Aspartate transaminase, ALT=Alanine transaminase, RBG=Random blood glucose.

2. Hematological investigations between pre-eclampsia patients and control groups are shown in Table 4

Table 4 shows there are strong significant (P < 0.0001) differences between the study group as well as controls concerning WBC, HB gm%, HCT%, MCV, MCH, Neutrophil, Granulocyte, and RDW. A highly statistically significant (P=0.002) difference in Platelet count between pre-eclampsia patients and the control group. A significant differences between the study group as well as the control regarding Lymphocytes where (P=0.02) and no marked differences between the study group and controls concerning RBC, MCHC%, MID, MPW, and MPV.

Table 4: Comparison of hematological investigations of pre-eclampsia patients and healthy subjects.

CBC	Control group (n=100)	Patients' group (n=140)	P value
CBC	Mean ±SD	Mean ±SD	P value
WBC count (×10^3/µL)	8.55±1	10.37±3	< 0.0001****
RBC count (×10^6/µL )	4.3±0.3	4.2±0.7	0.26
HB (g %)	12.36±1.1	10.38±1.4	< 0.0001****
HCT %	40.6±3.6	31.4±5.5	< 0.0001****
MCV (fL)	93.2±9.6	79±8.2	< 0.0001****
MCH (pg)	29±2.6	25.2±3.2	< 0.0001****
MCHC %	33.1±2.7	32±2.1	0.65
Neutrophile	64±5.1	71.1±9.4	< 0.0001****
Granulocyte	6.1±1	8.1±3	< 0.0001****
Lymphocyte	2.5±0.8	2.3±0.09	0.02*
MID	0.8±0.04	0.8±0.07	0.6
RDW %	13.8±1.1	15±2.6	< 0.0001****
Mean platelet width (fL)	16.3±2.9	16.5±4.2	0.8
Mean platelet volume (fL)	10±1.2	10.1±1.5	0.58
Platelet count (K/µL)	215±35	189.5±27.7	0.002***

Results were obtained using the independent t-test. Data were expressed as Mean ±SD. *P≤0.05 = significant, **P≤0.01 = very significant ***P≤0.001 = highly significant, ****P≤0.0001 = strong significant, n= number of cases, WBC=White blood cells, RBC=Red blood cells, HB=Hemoglobin, HCT%=Hematocrit, MCV=Mean corpuscular volume, MCH=Mean corpuscular hemoglobin, MCHC= Mean corpuscular hemoglobin concentration, MID= Mid-range absolute count, RDW= Red cell distribution width.

3. The distribution of biochemical oxidative stress between patients and control groups is shown in Table 5

Table 5 shows that the activities of SOD in pre-eclampsia (P-EC) patients were diminished (89.18±19.7), so there is a strong statistically significant (P < 0.0001) difference between the patients' group and controls regarding SOD. Additionally, the GSH level in P-EC patients was decreased than that of healthy controls, (0.11±0.08), consequently there is a strong statistically significant (P < 0.0001) difference between the patient's group and controls regarding GSH. On the contrary, the serum level of MDA in the patients' group was higher than that of the control group, (0.55±0.11), hence there is a statistically significant (P=0.03) difference between the patients' group as well as controls in terms of MDA. Also, the GPX level in the patients' group was higher than that of the control, (498.56±53.3), so there is a strong statistically significant (P < 0.0001) difference between the patients' group as well as controls regarding GPx (Figure 1).

Table 5: Comparison of antioxidants and lipid peroxidation in pre-eclampsia patients’ and control groups

P value	Patients (n=140)	Control (n=100)
P value	Mean ± SD	Mean ± SD
< 0.0001****	89.18±19.7	243.5±23.15	SOD (U/mL)
< 0.0001****	0.11±0.08	1.73±0.365	GSH (ng/mL)
0.03*	0.55±0.11	0.49±0.25	MDA (nmol/mL)
< 0.0001****	498.56±53.3	303.22±71.59	GPx (U/mL)

Results were obtained using the independent t-test. Data were expressed as Mean ± SD. *P ≤0.05 = significant, **P ≤0.01 = very significant, ***P ≤0.001 = highly significant, ****P ≤0.0001 = strong significant.

4. Distribution of PAI-1 4G/5G gene polymorphism in pre-eclampsia cases compared to controls with their significance related to different genetic models

Table 6 shows a strong statistically significant (P < 0.0001, OR=2.1, 95%CI=1.1-4.5) difference between the patients' group and the control group regarding PAI-1 4G/5G genotypes in the codominant model, where the genotype 4G/4G in P-EC patients (7%) is higher than in healthy cases (4%), while genotypes 4G/5G (31%) in patients is lower than in healthy cases (66%) and 5G/5G genotype in patients (62%) is higher than that of the control group (30%). Moreover, there is a highly significant (P=0.004, OR=2.45, 95%CI=1.1-4.5) difference in the dominant model. Also, a highly statistically significant (P=0.009, OR=1.88,95%CI=1.1-3.89) difference in the recessive model. On the contrary, no significance in the over-dominant model (P=0.08, OR=0.99, 95%CI=0.76-2.1). According to allelic frequencies, our results showed that the 4G allele frequency in the control group (37%) is higher than that of the patients' group (22.5%) and the frequency of the 5G allele in the control group (63%) decreases when compared to patients' group (77.5%) and there is a highly statistically significant difference between the control group and the patients' group concerning allelic frequencies of PAI-1 4G/5G genotypes, where (P=0.004, OR=1.22, 95%CI=1.5-3.5) (Figure 2), (Figure 3) .

Table 6: Distribution of PAI-1 4G/5G gene polymorphism in pre-eclampsia cases compared to control with their significance related to different genetic models.

Model	Genotype	Controls (n=100)		Patients (n=100)		OR (95%CI)	Chi-square test
							X²	P value
		No	%	No	%
Codominant	4G/4G	4	4	7	7	2.1 (1.1-4.5)	25.72	< 0.0001**
	4G/5G	66	66	31	31
	5G/5G	30	30	62	62
Dominant	5G/5G	30	30	62	62	2.45 (1.1-4.5)	4.35	0.004**
	4G/5G-4G/4G	70	70	38	38
Recessive	4G/4G	4	4	7	7	1.88 (1.1-3.89)	3.32	0.009**
	4G/5G-5G/5G	96	96	93	93
Over-dominant	4G/5G	66	66	31	31	0.99 (0.76-2.1)	2.11	0.08
	4G/4G-5G/5G	31	31	69	69
Alleles	4G	74	37	45	22.5	1.22 (1.5-3.5)	5.15	0.004**
	5G	126	63	155	77.5

Values represent n (number of cases) percentage (%) of frequencies of the genotypes of PAI-1 4G/5G, P = probability, *P≤0.05 = significant, **P≤0.01 = very significant, ***P≤0.001 = highly significant ****P≤0.0001 = strong significant, OR= Odds ratio and CI (confidence interval).

5. The correlations between PAI-1 genotypes and the oxidative stress parameters within groups

Table 7 shows the correlations between PAI-1 genotypes and the oxidative stress parameters within groups, there is a highly significant (P=0.002) increase in 4G/5G in comparison to 4G/4G and 5G/5G with SOD among pre-eclampsia patients and control groups (Figure 4A), there is a strong significant (P < 0.0001) increase in 4G/5G in comparison to 4G/4G and 5G/5G with GSH among pre-eclampsia patients and control groups (Figure 4B), in addition to, a significant (P=0.021) increase in 5G/5G in comparison to 4G/4G and 4G/5G with GPx among pre-eclampsia patients and control groups (Figure 4C). While there is no significant (P=0.2) difference between PAI-1genotypes and levels of MDA within groups.

Table 7: The correlation between PAI-1 4G/5G genotypes and oxidative stress parameters within groups.

One-Way ANOVA			PAI-1 Genotype
One-Way ANOVA			5G/5G (n=94)	4G/5G (n=94)	4G/4G (n=11)
P value	F	Mean ± SD		Mean ± SD	Mean ± SD
0.002**	6.3	142.1±18		192±30	178.4±36	SOD (U/mL)
< 0.0001***	10.5	0.66±0.02		1.2±0.3	0.67±0.08	GSH (ng/mL)
0.2	1.2	0.55±0.01		0.49±0.05	0.51±0.02	MDA (nmole/mL)
0.021*	3.9	451±53		356.3±46	365.7±31	GPx (U/mL)

P = probability, *P≤0.05 = significant **P≤0.01 = very significant ***P≤0.001 = highly significant ****P≤0.0001 = strong significant, n= number of cases, SOD=Superoxide dismutase, GSH=Glutathione, MDA= Malondialdehyde, GPx= Glutathione peroxidase. Data were expressed as Mean ± SD. Results were obtained using the One-Way ANOVA test.

6. The correlations between PAI-1 4G/5G genotypes and the clinical data within groups.

Table (8) shows the correlations between PAI-1 4G/5G genotypes and the clinical data within groups, according to systolic blood pressure, there is a very statistically significant (P=0.01) increase in 4G/4G in comparison to 4G/5G and 5G/5G among groups (Figure 5A). Regarding diastolic blood pressure, there is a statistically significant (P=0.023) increase in 4G/4G in comparison to 4G/5G and 5G/5G among groups (Figure 5B). Concerning serum albumin (gm/dl), there is a strong statistically significant (P < 0.0001) increase in 4G/5G in comparison to 5G/5G and 4G/4G among groups (Figure 5C). Regarding random blood glucose gm/dl, there is a significant (P=0.03) increase in 5G/5G in comparison to 4G/5G and 4G/4G among groups (Figure 5D). Concerning HB gm%, there is a highly statistically significant (P=0.001) increase in 4G/5G in comparison to 5G/5G and 4G/4G among groups (Figure 6A). According to HCT %, there is a highly statistically significant (P=0.003) increase in 4G/5G in comparison to 5G/5G and 4G/4G among groups (Figure 6B). In addition to MCV fl, there is a highly statistically significant (P=0.002) increase in 5G/5G in comparison to 4G/5G and 4G/4G among groups (Figure 6C). Finally, regarding MPW, there is a very statistically significant (P=0.01) increase in 5G/5G in comparison to 4G/5G and 4G/4G among groups (Figure 6D).

Table 8: Comparison between PAI-1 4G/5G genotypes and clinical data within groups.

One-way ANOVA		PAI-1 Genotype						Clinical data
One-way ANOVA		5G/5G		4G/5G		4G/4G		Clinical data
P value	F	Mean± SD	No	Mean± SD	No	Mean ± SD	No
0.1	1.78	27.4±6	91	26.6±5.6	97	28.3±5.3	11	Age (Year)
0.01**	4.6	141.6±22	91	133±16	97	141.3±19	11	SBP (mmHg)
0.023*	3.8	89.8±11	91	85.4±9.4	97	89.4±10.9	11	DBP (mmHg)
0.1	2.1	9.8±2.9	91	8.9±2.1	97	9.1±2	11	WBC count (×10³/µL)
0.7	0.2	4.2±0.5	91	4.3±0.4	97	4.2±0.5	11	RBC count (×10³/µL)
0.001**	6.8	10.9±1.7	91	11.8±1.4	97	11.5±1.3	11	HB g%
0.003**	6.1	34±6.6	91	37.4±6.5	97	35.6±5.9	11	HCT %
0.002**	6.3	83.1±10.8	90	88.6±11.5	96	89.7±10.3	11	MCV (fL)
0.06	2.8	26.6±3.3	90	27.7±3.5	96	27.6±2.7	11	MCH (pg)
0.6	0.4	31.3±2	90	33.8±2.7	96	31.4±1.6	11	MCHC %
0.4	0.7	66.8±7.3	64	66.3±7.7	83	69.7±9.8	8	Neutrophile
0.2	1.2	7±3.1	73	6.5±2.4	90	7.7±3	11	Granulocyte
0.8	0.1	2.43±0.9	86	2.5±0.8	92	2.44±0.1	11	Lymphocyte
0.9	0.04	0.86±0.08	85	0.88±0.04	92	0.9±0.05	10	MID
0.2	1.5	14.6±2.4	82	14.3±1.8	89	15.4±2.3	11	RDW %
0.01**	4.2	16.7±2.6	82	15.7±3	88	17.9±2.9	10	Mean platelet width (fL)
0.8	0.1	10.4±1.4	90	10.03±1.2	95	9.8±1	11	Mean platelet volume (fL)
0.1	2.1	199.4±36	90	208.7±27	97	170.9±25	11	Platelet count (K/ µL)
0.3	0.9	23.5±1.2	87	28.2±3.2	92	21.9±4.2	11	ALT (IU/L)
0.5	0.5	30.5±1.8	86	31.4±1.8	93	36.9±2.8	11	AST (IU/L)
< 0.0001**	9	3.3±0.6	78	3.7±0.6	91	3.2±0.5	11	Serum albumin (g/dL)
0.3	1	0.81±0.1	82	0.78±0.1	92	0.75±0.08	10	Creatinine (mg/dL)
0.03*	3.4	95±20	74	90.8±21	85	109.5±28	9	RBG (mmol/L)

P = probability, *P≤0.05 = significant, **P≤0.01 = very significant, ***P≤0.001 = highly significant, ****P≤0.0001 = strong significant, n= number of case, SBP=systolic blood pressure, DBP= Diastolic blood pressure, WBC=White blood cells, RBC=Red blood cells, HB=Hemoglobin, HCT%=Hematocrit, MCV=Mean corpuscular volume, MCH=Mean corpuscular hemoglobin, MCHC= Mean corpuscular hemoglobin concentration ,MID=Mid-range absolute count, RDW=Red cell distribution width, AST=Aspartate transaminase, ALT=Alanine transaminase, RBG=Random blood glucose. Data were expressed as Mean ± SD. Results were obtained using the One-Way ANOVA test.

Preeclampsia is a condition during pregnancy in which a sudden rise in blood pressure and swelling occur, mostly in the face, hands, and feet. It is the most common complication to occur during pregnancy. It generally develops during the third trimester and comprises 2–8% of complications resulting from gestation, over 50,000 maternal deaths, and greater than 500,000 fetal deaths worldwide [20]. If the preeclampsia remains untreated, it can develop into eclampsia, in which the mother can experience convulsions, and coma, and can even die. However, complications from preeclampsia are extremely rare if the mother attends her prenatal appointments.

Various genes participate in the pathogenesis of P-EC dangerously and the placenta is the central organ of this pathophysiology. The Egyptian population is heritably heterogeneous and is considered a perfect source to clarify the association between gene polymorphisms as -675 4G/5G PAI-1 among several genes and pre-eclampsia [21].

According to that, this study has been carried out on -675 4G/5G PAI-1 gene polymorphism and some oxidative and antioxidant markers among several studies have established a correlation with preeclampsia [22, 23]. Consequently, this study aims to evaluate the effect of these risk factors including genetic polymorphisms and oxidative as well as antioxidant markers, and their association with P-EC as the following:

The current study was performed on 140 pregnant women (preeclampsia women, patients' group) and 100 healthy pregnant women (control group) were collected randomly from the Obstetrics Department of Mansoura Main Hospital, and Mansoura University, Egypt between 2019–2020 and blood samples were collected from all subjects. P-EC is more common in women with advanced maternal age [24]. Maternal age is also considered one of the main risk factors responsible for variations in preeclampsia morbidity between countries and a lot of research reported that women at the age of 40 years are at higher risk of P-EC [24].

In our study, there is a strong statistically significant (P < 0.0001) difference in age among patients as well as control groups, so our study shows that age may play a serious role in P-EC pathogenesis. Supporting our study, a large study in china included 2800 singleton pregnancies, observing elevated adverse gestation consequences linked to elevated maternal age [25]. Another supporter study confirmed that advanced maternal age (AMA, women > 35 years) is an essential hazard factor of poor maternal consequences in PE. These results may be due to the greater ratio of women who are overweight and suffering from obesity in the AMA group (62,8% vs 38,1%).

P-EC is a new onset of hypertension, the parameters for initial identification of preeclampsia are specifically defined as a systolic blood pressure of 140 mmHg or more or diastolic blood pressure of 90 mmHg or more, that must be identified after 5th month of pregnancy [20]. Concerning hypertension in the studied groups, the present data shows that there is a strong statistically significant (P < 0.0001) difference in systolic blood pressure as well as diastolic blood pressure together among patients compared to control, which illustrates the high blood pressure generated especially during the severe stages of the P-EC disease.

Previous studies in agreement with the findings of the current study, one of these studies reported that short- and long-term blood pressure variability gradually increased from the control group, across women with preeclampsia, to those with gestational hypertension [26]. Another large study that included almost 1000 patients with gestational hypertension and preeclampsia investigated visit-to-visit blood pressure variability in 2nd as well as 3rd trimester and reported similar results with significantly higher blood pressure variability among women with gestational hypertension and preeclampsia than in normotensive controls [27]. In maximally adjusted models, authors showed that visit-to-visit blood pressure variability was associated with gestational hypertension and preeclampsia [27].

Underlying medical disorders like gestational diabetes, chronic hypertension, and urinary tract diseases are associated with high P-EC risk [28–30]. Increased cardiac output and elevated systematic vascular resistance in hypertension are leading to an alteration in the function of endothelial cells [31]. Another analysis observed that chronic hypertension had approximately 14-fold greater P-EC probabilities similar to research performed in India [28, 32], Yemen [33], Ethiopia [34], Jordan [35], and Uganda [36] as well as WHO [29, 30].

Gestation is related to specific hematologic alterations like low HB levels, elevated MCV, neutrophil, leukocytosis, and minor thrombocytopenia [37]. However the greatest frequent result in preeclampsia is proteinuria, further alterations (neutrophilia, thrombocytopenia as well as HTC % elevation) might also be determined in a routine Complete Blood Count (CBC) analysis [38].

Anemia is a widespread disorder, particularly in developed countries. Our results indicate a strong statistically significant (P < 0.0001) difference in anemia parameters (HB, HCT, MCV, and MCH) with P-EC patients between patients and control groups. Although there are high levels of RBC count and MCHC parameter in the control group and lower levels in the patients' group, there is no statistically significant difference in RBC and MCHC between groups.

Contrary to our findings, the other studies published established that anemia through the first six months of gestation was not correlated with P-EC [39].

In routine CBC tests, RDW is an additional red cell parameter that determines the differences in the size of erythrocyte cells. Elevated RDW levels, a state defined as anisocytosis, are demonstrated to be associated with inflammation in the common population. The present study shows a strong statistically significant (P < 0.0001) difference in the levels of RDW among patients and control. Our result is online with prior research establishing that increased levels of RDW in gestation were linked to the incidences well as the severity of P-EC [40, 41].

Leukocytosis is a physiologic alteration that happened in normal gestations resulting in neutrophilia, as well as WBCs, which are considered the inflammation mediator [42]. Our findings show a strong statistically significant (P < 0.0001) difference in WBC, neutrophils, and granulocyte count and a significant (P = 0.02) difference in lymphocyte count between patients and control groups. Other studies revealed that leukocytosis that occurs during the first trimester is correlated with adverse gestation consequences, specifically with preterm birth [43, 44]. Referring to their results, neutrophilia is the only WBC parameter correlated with critical P-EC. Additionally, alterations in the operations of WBC happen besides the high levels of Neutrophils in preeclamptic women, and phenotypic as well as metabolic alterations in monocytes and granulocytes are observed in vivo research [45].

Platelet parameters in routine CBC like the total number of platelets, MPV, plateletcrit as well as PDW are vital markers of the activation process of platelet and thromboembolic cascades. In our biochemical study, the mean levels of platelets were decreased in the patient and elevated in the control, and there is a highly statistically significant (P = 0.002) difference in platelets between the patients' group and the control group.

Another study in disagreement with our results recommended that thrombocytopenia may be a late laboratory finding of P-EC and decreasing concentrations are usually associated with additional acute perturbation [46]. Although, many researchers have revealed that platelet count during the 1st three months of pregnancy is not a useful indicator to expect P-EC occurrence [47, 48]. Although our findings show high levels of PDW and MPV in the patients' group than in the control, there is no statistically significant difference in PDW, MPV, and MID between patients and control groups. Opposing our outcomes, high levels of both MPV and PDW with lower levels of plateletcrit have been established to be linked with P-EC [48].

In conclusion, we have demonstrated that inflammatory markers (WBC, Neutrophils, lymphocytes, granulocytes, and PLT), as well as anemia markers (HB, HTC%, MCV, MCH, and RDW), are the only CBC markers correlated with PE. There is no significant difference among the last inflammation and anemia parameters (MPV, MID, and PDW) & (RBC and MCHC) in patients and the healthy controls.

Referring to the role of liver enzymes in the diagnosis of PE. Hepatic enzyme determination has a predictive role in preeclampsia warning. These findings may be very useful to prevent the consequences of dangerous P-EC. Defects in liver chemistry result from insufficient blood supply to the liver, possibly leading to per-portal hemorrhage and ischemia. Sinusoidal, as well as per-portal deposition of fibrin and microvesicular deposition of fat, happen also and possibly alter the function of hepatocytes [49, 50].

The current survey shows that there is a highly statistically significant (P = 0.009) difference in liver enzymes as (ALT) between patient and control groups. Although, the presence of high levels of AST in patients than in control, there is no significant difference in (AST) among patients and control indicating that ALT may be one of the main risk factors for P-EC.

This is contrary to the last study which reported that AST in serum was significantly (P < 0.001) increased in healthy gravid women [51]. Other studies revealed that during preeclampsia the level of transaminase in serum was increased to > 10 mg/dL as well as that of ALT to 271 ± 297 mg/dL [52].

Hypoalbuminemia in preeclampsia is the result of reduced hepatic blood flow which is secondary to hypovolemia created by higher filtration pressure in the capillaries. Thus, Hypoalbuminemia can be identified as an early sign of developing preeclampsia [53]. Our results show that the mean concentration of albumin in serum in the control group is more than that of the patients and there is a strong statistically significant (P < 0.0001) difference between the patients' group and the control group. Therefore, our findings are in agreement with Hypoalbuminemia that occurs during preeclampsia development [54]. Similarly, our finding was in agreement with another study in which 60 patients diagnosed with severe preeclampsia cases had albumin concentrations less than 3 g/ dL [53]. In contrast to our findings, another study shows that the mean serum albumin level in the preeclampsia group was almost similar to that of the normotensive group [55, 56].

Gestational diabetes mellitus (GDM) and preeclampsia (PE) are common complications in pregnancy [57]. This is credible biologically due to insulin resistance and insulin elevated concentration resulting in high sympathetic activity as well as abnormal tubular absorption of sodium, which finally causes endothelial cell injury and hence elevated P-EC risk [31].

Regarding our results that show, a strong statistically significant (P < 0.0001) difference in random blood glucose between patients and control groups, that indicates RBG may be a major risk factor of the P-EC disease. Supporting our study, patients with gestational diabetes had approximately 12-fold elevated P-EC probabilities and other research proved this percentage [30, 58]. A retrospective cohort study in Germany showed that there was no independent correlation between GDM and PE, regardless of obesity before pregnancy, and it was unknown whether it was related to the strict control of blood glucose levels [59].

It is suggested that oxidative stress, recognized as an imbalance of oxidant-antioxidant, is involved in the pathophysiology of pre-eclampsia. Multiple studies investigated the contribution of oxidative stress in pre-eclamptic females, where placental tissues have been shown to generate elevated superoxide levels than normal pregnant females [60, 61]. Typically, oxidative stress takes place in normal healthy pregnant females than in non-pregnant females; nonetheless, reactive free radicals increase in pre-eclampsia. Reactive oxygen species, such as hydrogen peroxide as well as superoxide anion have been demonstrated to directly induce smooth muscle contraction. Such reactive species would also suppress nitric oxide, an endothelial-derived relaxation factor, thus influencing vascular tone. It is not obvious if antioxidant deficiency and oxidative stress are the main triggers of pre-eclampsia or a by-product of pre-eclampsia.

Determining the level of different antioxidants or end products of oxidative stress provides guidelines for diagnosing and managing pre-eclampsia. Despite the cause, the presence of oxidative stress as well as antioxidant defense system deficiency can be a key factor to maximize lipid peroxidation in pre-eclampsia. Moreover, lipid peroxidation that can indirectly give more details regarding damage to cells is assumed to be a significant factor in pre-eclampsia pathogenesis, as elevated MDA levels were detected in the current study. Nevertheless, elevated lipid peroxidation products have been detected in both normal pregnant subjects as well as pre-eclampsia than in non-pregnant females [62].

In this regard, this study attempted to determine the level of multiple antioxidants in pre-eclamptic females via the measurement of serum antioxidants. A wide range of studies has detected substantially an increased overall capacity of antioxidants in pre-eclamptic females, while other studies have reported a marked lower capacity of total antioxidants. In the current study, a marked decline in the overall capacity of antioxidants was detected, despite the marked elevation in total peroxide as well as the end products of oxidative stress.

The overall defense potential of the plasma is not sufficiently enhanced to defeat oxidative stress in pre-eclampsia. In normal pregnancy, the elevated ROS production is counterbalanced by the maximized synthesis of multiple different antioxidants to maintain placental tissues against toxic reactive products. There are multiple methods by which antioxidants can alleviate the risk as well as pre-eclampsia severity. The majority of antioxidants are capable of directly protecting maternal as well as fetal cells against the damage of oxidants by neutralizing or quenching free radicals. H₂O₂ as well as superoxide anion and are considered the most versatile and robust free radicals generated in different pathways. Superoxide dismutase can counteract the disturbances of free radicals by dismutation of O2- radicals thus protecting cell membranes from lipid peroxidation mediated by free radicals [63].

In agreement with our findings, many studies have detected a significantly elevated SOD activity in pre-eclamptic females with P = 0.0001 [64]. while other studies have detected marked decreased SOD activity [65]. In general, the present study revealed that the activity of SOD indicates minimized SOD activity in pre-eclamptic females. It was previously revealed that the elevation in diastolic blood pressure of pre-eclamptic females is adversely associated with the plasma as well as SOD placental levels. The maximized concentrations of superoxide, as a result of a deficiency in superoxide dismutase, in the existence of iron can lead to lipid peroxidation [66]

Our study revealed a significant elevation in GPx activity in pre-eclamptic females than normal pregnant females with P = 0.0001. Nonetheless, a few studies have reported marked diminished GPx activity in pre-eclamptic females. Another study examined the activity of GPx in blood samples and detected minimized activity of GPx activity was correlated with elevated severity as well as pre-eclamptic risks [67].

Furthermore, GPx is also capable of attenuating the attack of free radicals and endothelial damage via their potential to degrade hydrogen peroxide as well as organic hydroperoxides including lipid as well as phospholipid hydroperoxides utilizing GSH. The elevated glutathione peroxidase activity in pre-eclampsia could act as a compensatory mechanism to restrain reactive radical-induced damage or other toxins. Nevertheless, the marked impact of GPx in the plasma pre-eclamptic females may demonstrate a potential protective reaction against maximized oxidative stress [68].

In addition, many researchers referred to the increased glutathione peroxidase activity along with the elevated MDA levels as an enzyme compensative mechanism to protect against the elevated concentrations of peroxides. Additionally, lipid peroxides are generated in the placenta; nonetheless, unrestrained lipid peroxide production may induce oxidative stress that ultimately disrupts the integrity of cells. This study detected a marked elevation in the levels of serum MDA in pre-eclamptic females than normal pregnant females [69].

Excessive elevation in oxidative stress biomarkers as well as lipid peroxidation was reported in pre-eclamptic females. Elevated lipid peroxidation is regarded as a causative factor of pre-eclampsia [70]. Some researchers have illustrated that elevated plasma lipid peroxidation products namely, malondialdehyde (MDA) in pre-eclamptic females than in healthy pregnant females induce impairment in vascular endothelial cells in P-EC cases. Nevertheless, despite such reports, limited studies did not manage to demonstrate the correlation between the levels of lipid peroxidation as well as endothelial impairment in late or early pre-eclampsia [71].

Unlike glutathione peroxidase, GSH in blood was markedly decreased in pre-eclamptic females than in normal pregnant females. This result is logical since elevated GPx activity leads to consuming GSH, which refers to the fact that protection against reactive oxidants through GSH in pre-eclamptic females is impaired. Moreover, GSH would suppress the peroxidation of lipids through membrane-bound GPx. Decreased GSH levels in pre-eclamptic females may be correlated with elevated local or systemic oxidative stress in this cohort. Along with the elevation in GPx activity, reduced GSH concentrations can indicate substantially elevated levels of circulating hydrogen peroxide in pre-eclampsia [72].

Fibrinolysis has a direct correlation with preeclampsia and the genetic polymorphism of the heterozygous 4G/5G PAI-1 illustrates this association. The expression of PAI-1 in plasma after being exposed to inflammatory cytokines is increased, such as vascular endothelial growth factor (VEGF), and interleukin 1β (IL-1β) [73], hypoxic conditions, fibroblast growth factor (FGF) epidermal, and growth factor (EGF) [74]. Hypoxia may induce PAI-1 mRNA as well as expression of the protein, in addition to stimulating the factors of transcription induced by hypoxia (HIF-1α and HIF-2α) to trigger PAI-1 [75]. It should be noted that pre-eclampsia mechanisms can be due to both. In pre-eclampsia along with elevated syncytial PAI-1 levels, interfering fibrin deposition as well as infarction can lower maternal-to-fetal nutrient flow and thus induce IUGR [76]. Nevertheless, there is a controversy over the association between pre-eclampsia as well as PAI-1 polymorphism.

In the current paper, we studied PAI-1 gene polymorphism in pre-eclampsia patients compared to controls. Our data revealed a strongly significant difference in PAI-1 4G/5G genotype frequencies in different genetic models and PAI-1 4G/5G allelic frequencies between pre-eclamptic women as well as control. The 4G allele is considered a protective agent in pre-eclampsia. Our study shows that PAI-1 4G/5G polymorphism contributes to P-EC pathogenesis.

Similar to these findings, plasma PAI-1 levels in pre-eclampsia have been reported to be more elevated than in normal pregnancy. PAI-1 is characterized by antifibrinolytic activity via inhabiting tissues PA, and hence opposing fibrinolysis besides enhancing a procoagulant state during pregnancy, attenuating bleeding, and improving the stability of clot. PAI-1 elevated levels in pre-eclampsia can lead to the onset of placental damage 77 [77].

In agreement with our results, It was reported that the ischemic placenta contributes to the pathogenesis as well as pathology of pre-eclampsia that releases several bioactive factors, resulting in the pervasiveness of endothelial damage which culminates in pre-eclampsia maternal syndrome. PAI-1 increased levels may induce occlusive lesions as well as fibrin deposition resulting in spiral arteries or intervillous thrombosis, thus inducing placental ischemia 78 [78].

Supporting the current study, previous studies relationship between elevated levels of PAI-1 as well as pre-eclampsia. Some previous studies showed a meta-analysis of 6 case-control studies examining the 4G/5G polymorphism revealed no substantial difference in 4G allele frequency in subjects with and without pre-eclampsia. Nonetheless, subjects with the 4G allele experienced a 1.27-fold elevated risk of developing pre-eclampsia [6, 79]. Similarly to our study, a meta-analysis of 18-case control studies revealed that the 4G/5G polymorphism is related to an elevated risk of pre-eclampsia, RPL, and advocated PAI-1 examination as well as anticoagulant therapy [6, 77].

Females with the PAI-1 5G/5G genotype were found to be more susceptible to early onset of severe pre-eclampsia (17–35 gestational weeks) [1]. Also similar to our study, it was found that the pervasiveness of some thrombophilic genes in females with severe or mild P-EC in Southern Brazil. The investigated variants include the insertion/deletion (4G/5G) in the plasminogen activator inhibitor type 1 (PAI-1) gene promoter region [80].

In agreement with our biochemical study, this polymorphism is also associated with pre-eclampsia. Meta-analysis of 11 studies that included 1297 pre-eclampsia subjects in addition to 1791 healthy participants revealed a strong correlation between pre-eclampsia as well as SERPINE1-675 4G/5G polymorphism for the recessive genetic model (odds ratio (OR) = 1.36, 95% confidence interval (CI): 1.13–1.64, P = 0.001), a significant result based on the sensitivity analysis [81, 82]. In contrast to our study, PAI-1-675 4G/5G polymorphism was revealed to be not correlated with pre-eclampsia with a cohort of 5003 females enrolled in the meta-analysis [81].

Contrary to our findings, previous studies relationship between elevated levels of PAI-1 as well as preeclampsia. Some previous studies showed a meta-analysis of 6 case-control studies examining the 4G/5G polymorphism revealed the absence of any significant difference in 4G allele frequency between preeclamptic patients and control. Nonetheless, subjects with the 4G allele experienced a 1.27-fold elevated risk of developing preeclampsia [6, 79].

On the other hand, our results show many correlations between the genetic polymorphism PAI-1 and biochemical parameters. Regarding gene polymorphism, there is a strong statistically significant (P < 0.0001) difference in GSH with PAI-1 gene polymorphism between preeclampsia patients and the control group, a highly statistically significant (P = 0.002) difference in SOD with PAI-1 gene polymorphism between preeclampsia patients and the control group, and a statistically significant (P = 0.021) difference in GPx with PAI-1 gene polymorphism between preeclampsia patients and control group, but there is no significant (P = 0.2) difference in MDA with PAI-1 gene polymorphism between preeclampsia patients and control group. These results may be due to the levels of the antioxidants SOD, GSH, and GPx generally decreasing to fight the overall increase in the concentrations of the oxidative stress markers and protect the cells from the free radicals attack that leads to the cell aging and finally apoptosis. In addition to the compensatory mechanism of GPx to compensate for the over-consuming of GSH levels in these processes.

In addition, According to PAI-1 gene polymorphism and regarding hypertension parameters, the PAI-1 gene polymorphism is associated with high blood pressure in preeclampsia where there is a very statistically significant (P = 0.01) difference with SBP and a statistically significant (P = 0.023) difference with DBP. In agreement with the current findings, two longitudinal cohorts of American Indians participating in the strong heart study SHS (1993–1995) and the strong heart family study SHFS (2001–2003), suggested that baseline plasma PAI-1 significantly predicted the risk of hypertension, independent of many known risk factors. Specifically, a higher level of plasma PAI-1 was associated with over 35% increased risk of developing hypertension in this high-risk population and suggests that plasma PAI-1 may contribute to the development of hypertension through pathways beyond traditional risk factors [83].

To the best of our knowledge, our study is the first to reveal many correlations between PAI-1 gene polymorphism and CBC parameters, there is a highly statistically significant difference in HB; (P = 0.001), HCT; (P = 0.003) and MCV; (P = 0.002) with PAI-1 gene polymorphism between preeclampsia patients and control. While, a very statistically significant (P = 0.01) difference in MPW with PAI-1 gene polymorphism between preeclampsia patients and control, these findings may be due to PAI-1 participation in vascular endothelium dysfunction in preeclampsia patients that consequently leads to hemorrhage and uterine bleeding in preeclamptic women that results in a significant decrease in anemia parameters. Referring to liver function tests, a strong statistically significant (P < 0.0001) difference in serum albumin with PAI-1 gene polymorphism between preeclampsia patients and control. This effect on liver function enzymes is referring to the liver being the most organ affected by preeclampsia disease besides the kidney and HELLP syndrome is a diagnostic syndrome in the disease diagnosis. This syndrome is triggered when preeclampsia pathophysiology is stimulated by this polymorphism.

Finally, a statistically significant (P = 0.03) difference in RBG with PAI-1 gene polymorphism between preeclampsia patients and the control group. Similar to our findings, another study reported that PAI-1 levels are higher in the serum of women with GDM compared to healthy women during the early 3rd trimester of pregnancy [84]. Conversely, other studies stated that PAI-1 levels in maternal uterine blood do not change in women with GDM in the third-trimester pregnancy compared to controls [85].

The ethnic allelic distribution as well as genetic differences in this study cohort as compared with another study cohort can be partially responsible for the controversial findings. Interaction between ecological factors and genes can impact the evolution of P-EC. Our study demonstrated that the heterozygous − 657 4G/5G PAI-I genotype may be associated with P-EC among Egyptian women.

The present findings may contribute to determining the genetic elements that participate in the pathogenesis of P-EC. More genetic correlation research must be carried out in different populations to identify other potential genetic factors. In addition, preeclampsia patients are characterized by low levels of antioxidants such as SOD and GSH levels as well as high levels of oxidative stress markers such as MDA and GPx compared to healthy individuals.

Some limitations should be taken into consideration, the present study has some limitations such as the relatively small sample size, and the groups should be classified based on the degree of pre-eclampsia.

Acknowledgments

We wish to express our scientific appreciation to all the staff members for their help in performing fieldwork. Thanks to all of the study participants.

Ethical Approval and Consent to participate

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Mansoura University (Date. 10/10//2021 – No. R.21.09.1447).

Human Ethics

Informed consent was obtained from all individual participants included in the study.

Consent for publication

Not applicable

Availability of supporting data

The data that supports this work is available upon reasonable request.

Competing interests

The authors have no relevant financial or non-financial interests to disclose.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Authors' contributions

All authors contributed to the study's conception and design. Material preparation, data collection, and analysis were performed by (Hwyda Ahmed), (Afaf M. ElSaid), (Hend A.Shalaby), (Manar Refaat), and (Omali Y. Elkhawaga). The first draft of the manuscript was written by (Hwyda Ahmed) and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Gerhardt A, Goecke TW, Beckmann MW, Wagner KJ, Tutschek B, Willers R, et al. The G20210A prothrombin‐gene mutation and the plasminogen activator inhibitor (PAI‐1) 5G/5G genotype are associated with early onset of severe preeclampsia. Journal of Thrombosis and Haemostasis. 2005;3(4):686-91.
Aung M, Konoshita T, Moodley J, Naicker T, Connolly C, Khaliq OP, et al. Aminopeptidase A (ENPEP) gene polymorphisms and preeclampsia: Descriptive analysis. European Journal of Obstetrics & Gynecology and Reproductive Biology. 2021;258:70-4.
Zhang Y, He X, Xiong X, Chuan J, Zhong L, Chen G, et al. The association between maternal methylenetetrahydrofolate reductase C677T and A1298C polymorphism and birth defects and adverse pregnancy outcomes. Prenatal Diagnosis. 2019;39(1):3-9.
Pettker A., Lockwood C. J. “Thromboembolic Disorders In Pregnancy,” in Obstetrics: Normal And Problem Pregnancies, S. Gabbe, . Niebyl, M Landon et al, Eds, Elsevier, Philadelphia, PA, USA, 7th edition. 2017 pp. 965–80,.
Pinheiro MB, Carvalho MG, Martins-Filho OA, Freitas LG, Godoi LC, Alpoim PN, et al. Severe preeclampsia: are hemostatic and inflammatory parameters associated? Clinica chimica acta. 2014;427:65-70.
Chen H, Nie S, Lu M. Association between Plasminogen Activator Inhibitor‐1 Gene Polymorphisms and Recurrent Pregnancy Loss: A Systematic Review and Meta‐Analysis. American Journal of Reproductive Immunology. 2015;73(4):292-300.
Hoirisch-Clapauch S, Brenner B. The role of the fibrinolytic system in female reproductive disorders and depression. Thrombosis Update. 2020;1:100004.
Smith R, Baker P. Risk factors, prevention and treatment of hypertension in pregnancy. Minerva ginecologica. 2005;57(4):379-88.
Guller S, Ma Y, Malek A, Di Santo S, Schneider H. Differential release of plasminogen activator inhibitors (PAIs) during dual perfusion of human placenta: implications in preeclampsia. Placenta. 2007;28(4):278-85.
Cho HY, Park HS, Ahn EH, Ko EJ, Park HW, Kim YR, et al. Association of Polymorphisms in Plasminogen Activator Inhibitor-1 (PAI-1), Tissue Plasminogen Activator (tPA), and Renin (REN) with Recurrent Pregnancy Loss in Korean Women. Journal of Personalized Medicine. 2021;11(12):1378.
Sibai BM, Stella CL. Diagnosis and management of atypical preeclampsia-eclampsia. American journal of obstetrics and gynecology. 2009;200(5):481-e1.
Sikkema JM, van Rijn BB, Franx A, Bruinse HW, de Roos R, Stroes ESG, et al. Placental Superoxide is Increased in Pre-eclampsia. Placenta. 2001;22(4):304-8.
Walsh SW. Placental isoprostane is significantly increased in preeclampsia. The FASEB Journal. 2000;14(10):1289-96.
Perrey C, Turner SJ, Pravica V, Howell WM, Hutchinson IV. ARMS-PCR methodologies to determine IL-10, TNF-alpha, TNF-beta and TGF-beta 1 gene polymorphisms. Transplant immunology. 1999;7(2).
Jannes J. Polygenic disease: a study of genetic risk in an Australian stroke population: the Adelaide Genetic Stroke Study. 2004.
Nadiger HA, Marcus SR, Chandrakala MV, Kulkarni DD. Malonyl dialdehyde levels in different organs of rats subjected to acute alcohol toxicity. Indian Journal of Clinical Biochemistry. 1986;1:133-6.
Hartz JW, Funakoshi S, Deutsch HF. The levels of superoxide dismutase and catalase in human tissues as determined immunochemically. Clinica Chimica Acta. 1973;46(2):125-32.
Paglia DE, Valentine WN. Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. The Journal of laboratory and clinical medicine. 1967;70(1):158-69.
Goldberg DM. Glutathione reductase. Methods of enzymatic analysis. 1984;3:258-65.
Karrar and Hong [Updated 2021 Nov 2]. In: StatPearls [Internet]. Treasure Island (FL). StatPearls Publishing; 2022 Jan- Available from: https://wwwncbinlmnihgov/books/NBK570611/. 2002.
Williams PJ, Broughton F. The genetics of pre-eclampsia and other hypertensive disorders of pregnancy. Best Pract Res Clin Obstet Gynaecol. 2011;25(4):405-17.
Kupferminc MJ, Fait G, Many A, Gordon D, Eldor A, Lessing JB. Severe Preeclampsia and High Frequency of Genetic Thrombophilic Mutations. Obstetrics & Gynecology. 2000;96(1):45-9.
Salimi S, Saravani M, Yaghmaei M, Fazlali Z, Mokhtari M, Naghavi A, et al. The early-onset preeclampsia is associated with MTHFR and FVL polymorphisms. Archives of Gynecology and Obstetrics. 2015;291(6):1303-12.
Duckitt K, Harrington D. Risk factors for pre-eclampsia at antenatal booking: systematic review of controlled studies. BMJ. 2005;330(7491):565-.
Shan D, Qiu P-Y, Wu Y-X, Chen Q, Li A-L, Ramadoss S, et al. Pregnancy Outcomes in Women of Advanced Maternal Age: a Retrospective Cohort Study from China. Sci Rep. 2018;8(1):12239-.
Tadic M, Cuspidi C, Suzic Lazic J, Vukomanovic V, Mihajlovic S, Savic P, et al. Blood pressure variability correlates with right ventricular strain in women with gestational hypertension and preeclampsia. Journal of Human Hypertension. 2021.
Jieyu L, Yingying C, Tian G, Jiaxiang W, Jiawen L, Yingjie G, et al. Visit-to-visit blood pressure variability is associated with gestational hypertension and pre-eclampsia. Pregnancy Hypertension. 2019;18:126-31.
Bej P, Chhabra P, Sharma AK, Guleria K. Determination of Risk Factors for Pre-eclampsia and Eclampsia in a Tertiary Hospital of India: A Case Control Study. J Family Med Prim Care. 2013;2(4):371-5.
Abalos E, Cuesta C, Carroli G, Qureshi Z, Widmer M, Vogel JP, et al. Pre-eclampsia, eclampsia and adverse maternal and perinatal outcomes: a secondary analysis of the World Health Organization Multicountry Survey on Maternal and Newborn Health. BJOG: An International Journal of Obstetrics & Gynaecology. 2014;121:14-24.
Bilano VL, Ota E, Ganchimeg T, Mori R, Souza JP. Risk factors of pre-eclampsia/eclampsia and its adverse outcomes in low- and middle-income countries: a WHO secondary analysis. PloS one. 2014;9(3):e91198-e.
Dekker GA, Sibai BM. Etiology and pathogenesis of preeclampsia: Current concepts. American Journal of Obstetrics and Gynecology. 1998;179(5):1359-75.
Agrawal S. Prevalence and Risk Factors for Symptoms Suggestive of Pre-Eclampsia in Indian Women. Journal of Women’s Health, Issues & Care. 2014;03(06).
Al-Tairi ANQ, Isa ZM, Ghazi HF. Risk factors of preeclampsia: a case control study among mothers in Sana’a, Yemen. Journal of Public Health. 2017;25(6):573-80.
Tessema GA, Tekeste A, Ayele TA. Preeclampsia and associated factors among pregnant women attending antenatal care in Dessie referral hospital, Northeast Ethiopia: a hospital-based study. BMC Pregnancy Childbirth. 2015;15:73-.
Khader YS, Batieha A, Al-njadat RA, Hijazi SaS. Preeclampsia in Jordan: incidence, risk factors, and its associated maternal and neonatal outcomes. The Journal of Maternal-Fetal & Neonatal Medicine. 2018;31(6):770-6.
Kiondo P, Wamuyu-Maina G, Bimenya GS, Tumwesigye NM, Wandabwa J, Okong P. Risk factors for pre-eclampsia in Mulago Hospital, Kampala, Uganda. Tropical Medicine & International Health. 2011;17(4):480-7.
Whittaker P, Macphail S, Lind T. Serial hematologic changes and pregnancy outcome. Obstetrics & Gynecology. 1996;88(1):33-9.
Heilmann L, Rath W, Pollow K. Hemostatic Abnormalities in Patients With Severe Preeclampsia. Clinical and Applied Thrombosis/Hemostasis. 2007;13(3):285-91.
Rahman MM, Abe SK, Rahman MS, Kanda M, Narita S, Bilano V, et al. Maternal anemia and risk of adverse birth and health outcomes in low- and middle-income countries: systematic review and meta-analysis1,2. The American Journal of Clinical Nutrition. 2016;103(2):495-504.
Kurt RK, Aras Z, Silfeler DB, Kunt C, Islimye M, Kosar O. Relationship of Red Cell Distribution Width With the Presence and Severity of Preeclampsia. Clinical and Applied Thrombosis/Hemostasis. 2013;21(2):128-31.
Yücel B, Ustun B. Neutrophil to lymphocyte ratio, platelet to lymphocyte ratio, mean platelet volume, red cell distribution width and plateletcrit in preeclampsia. Pregnancy Hypertension: An International Journal of Women's Cardiovascular Health. 2017;7:29-32.
Lurie S, Frenkel E, Tuvbin Y. Comparison of the Differential Distribution of Leukocytes in Preeclampsia versus Uncomplicated Pregnancy. Gynecologic and Obstetric Investigation. 1998;45(4):229-31.
Canzoneri BJ, Lewis DF, Groome L, Wang Y. Increased neutrophil numbers account for leukocytosis in women with preeclampsia. Am J Perinatol. 2009;26(10):729-32.
Tzur T, Weintraub AY, Sergienko R, Sheiner E. Can leukocyte count during the first trimester of pregnancy predict later gestational complications? Archives of Gynecology and Obstetrics. 2013;287(3):421-7.
Gervasi M-T, Chaiworapongsa T, Pacora P, Naccasha N, Yoon BH, Maymon E, et al. Phenotypic and metabolic characteristics of monocytes and granulocytes in preeclampsia. American Journal of Obstetrics and Gynecology. 2001;185(4):792-7.
Habas E, Rayani A, Ganterie R. Thrombocytopenia in hypertensive disease of pregnancy. J Obstet Gynaecol India. 2013;63(2):96-100.
Han L, Liu X, Li H, Zou J, Yang Z, Han J, et al. Blood coagulation parameters and platelet indices: changes in normal and preeclamptic pregnancies and predictive values for preeclampsia. PloS one. 2014;9(12):e114488-e.
Karateke A, Kurt R, Baloğlu A. Relation of platelet distribution width (PDW) and platelet crit (PCT) to preeclampsia. Polish Gynaecology. 2015;86(5):372-5.
Minakami H, Oka N, Sato T, Tamada T, Yasuda Y, Hirota N. Preeclampsia: A microvesicular fat disease of the liver? American Journal of Obstetrics and Gynecology. 1988;159(5):1043-7.
Dani R, Mendes GS, De Laurentys Medeiros J, Péret FJ, Nunes A. Study of the liver changes occurring in preeclampsia and their possible pathogenetic connection with acute fatty liver of pregnancy. American Journal of Gastroenterology (Springer Nature). 1996;91(2).
Das S, Char D, Sarkar S, Saha TK, Biswas S, Rudra B. Evaluation of liver function test in normal pregnancy and preeclampsia: A case control. IOSRJDMS. 2013;12(1):30-2.
Malvino E, Muñoz M, Ceccotti C, Janello G, Mc Loughlin D, Pawlak A, et al. Maternal morbidity and perinatal mortality in HELLP syndrome. Multicentric studies in intensive care units in Buenos Aires area. Medicina. 2005;65(1):17-23.
Gojnic M, Jeremic K, Mostic T, Petkovic S. Intrapartalne rupture uterusa, uzroci i zbrinjavanje. Acta chirurgica Iugoslavica. 2004;51(3):97-9.
Hastmark, Alexander BT, Llinas MT, Bennett WA, Khalil RA. Pathophysiology of hypertension during preeclampsia linking placental ischemia with endothelial dysfunction. Hypertension. 2001;38(3):718-22.
Bhatia RK, Bottoms SF, Saleh AA, Norman GS, Mammen EF, Sokol RJ. Mechanisms for reduced colloid osmotic pressure in preeclampsia. American Journal of Obstetrics and Gynecology. 1987;157(1):106-8.
Olooto WE, Amballi AA, Mosuro AO, Adeleye AA, Banjo TA. Assessment of Total Protein, Albumin, Creatinine and Aspartate Transaminase level in Toxemia of Pregnancy. Journal of Medical Sciences. 2013;13(8):791-6.
Yang Y, Wu N. Gestational Diabetes Mellitus and Preeclampsia: Correlation and Influencing Factors. Frontiers in Cardiovascular Medicine. 2022;9.
Conde A, Belizan JM. Risk factors for pre-eclampsia in a large cohort of Latin American and Caribbean women. BJOG: An International Journal of Obstetrics and Gynaecology. 2000;107(1):75-83.
Weschenfelder F, Hein F, Lehmann T, Schleußner E, Groten T. Contributing factors to perinatal outcome in pregnancies with gestational diabetes—what matters most? A retrospective analysis. Journal of Clinical Medicine. 2021;10(2):348.
Bosco C, Díaz E, Gutiérrez R, González J, Parra-Cordero M, Rodrigo R, et al. A putative role for telocytes in placental barrier impairment during preeclampsia. Medical Hypotheses. 2015;84(1):72-7.
Bosco C, Díaz Guerra E, Gutierrez Rojas R, González Montero J, Parra Cordero M, Ramón Rodrigo Salinas R, et al. Placental Hypoxia Developed During Preeclampsia Induces Telocytes Apoptosis in Chorionic Villi Affecting The Maternal-Fetus Metabolic Exchange. Current Stem Cell Research & Therapy. 2016;11(5):420-5.
Bogdanović J, Opačić M, Bajčetić M, Mandić V, Maglić D, Miković Ž, et al. Oxidative status of maternal blood in pregnancies burdened by inherited thrombophilias. Plos one. 2020;15(6):e0234253.
Strycharz-Dudziak M, Kiełczykowska M, Drop B, Świątek Ł, Kliszczewska E, Musik I, et al. Total antioxidant status (TAS), superoxide dismutase (SOD), and glutathione peroxidase (GPx) in oropharyngeal cancer associated with EBV infection. Oxidative medicine and cellular longevity. 2019;2019.
Roy S, Dhobale M, Dangat K, Mehendale S, Lalwani S, Joshi S. Differential oxidative stress levels in mothers with preeclampsia delivering male and female babies. The Journal of Maternal-Fetal & Neonatal Medicine. 2015;28(16):1973-80.
Pimentel AML, Pereira NR, Costa CA, Mann GE, Cordeiro VSC, de Moura RS, et al. L-arginine-nitric oxide pathway and oxidative stress in plasma and platelets of patients with pre-eclampsia. Hypertension Research. 2013;36(9):783-8.
Nikolic A, Cabarkapa V, Novakov Mikic A, Jakovljević A, Stosic Z. Ceruloplasmin and antioxidative enzymes in pre-eclampsia. The Journal of Maternal-Fetal & Neonatal Medicine. 2016;29(18):2987-93.
Chamy VM, Lepe J, Catalán Á, Retamal D, Escobar JA, Madrid EM. Oxidative stress is closely related to clinical severity of pre-eclampsia. Biological research. 2006;39(2):229-36.
Taravati A, Tohidi F. Comprehensive analysis of oxidative stress markers and antioxidants status in preeclampsia. Taiwanese Journal of Obstetrics and Gynecology. 2018;57(6):779-90.
Sarwar MS, Sarkar RC, Bhowmick R, Dewan SMR, Ahmed MU, Hasnat A, et al. Effect of socio-economic status and estimation of lipid peroxidation and antioxidant in preeclamptic pregnant women: a case–control study. Hypertension in pregnancy. 2015;34(1):125-35.
Sharma J, Sharma A, Bahadur A, Vimala N, Satyam A, Mittal S. Oxidative stress markers and antioxidant levels in normal pregnancy and pre-eclampsia. International journal of gynecology obstetrics & Gynecology. 2006;94(1):23-7.
Siddiqui IA, Jaleel A, Al Kadri HM. Biomarkers of oxidative stress in women with preeclampsia. Biomark Med 2013; 7 (2): 229–34.
Dahabiyeh LA, Tooth D, Kurlak LO, Mistry HD, Pipkin FB, Barrett DA. A pilot study of alterations in oxidized angiotensinogen and antioxidants in pre-eclamptic pregnancy. Sci Rep. 2020;10(1):1-8.
Prutsch N, Fock V, Haslinger P, Haider S, Fiala C, Pollheimer J, et al. The role of interleukin-1β in human trophoblast motility. Placenta. 2012;33(9):696-703.
Anteby EY. Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor-4 and -10 stimulate trophoblast plasminogen activator system and metalloproteinase-9. Molecular Human Reproduction. 2004;10(4):229-35.
Meade ES, Ma YY, Guller S. Role of Hypoxia-Inducible Transcription Factors 1α and 2α in the Regulation of Plasminogen Activator Inhibitor-1 Expression in a Human Trophoblast Cell Line. Placenta. 2007;28(10):1012-9.
Guller S. Role of the syncytium in placenta-mediated complications of preeclampsia. Thrombosis Research. 2009;124(4):389-92.
Minor K, Leftwich H. Enoxaparin Effect on Pregnancy Outcomes in a Patient with Elevated Plasminogen Activator Inhibitor-1. Case Reports in Obstetrics and Gynecology. 2020;2020.
Estuardo, Jesús , Daniela., Lujan J, Durand C, Avila F, et al. Incidence of hereditary thrombofilies in a population of Mexican women. Obstetrics &Gynecology International Journal. 2020;11(4):208-13.
Wiwanitkit V. Correlation between plasminogen activator inhibitor-1 4G/5G polymorphism and pre-eclampsia: an appraisal. Archives of gynecology and obstetrics. 2006;273(6):322-4.
Dalmaz CA, Santos KG, Botton MR, Tedoldi CL, Roisenberg I. Relationship between polymorphisms in thrombophilic genes and preeclampsia in a Brazilian population. Blood Cells, Molecules, and Diseases. 2006;37(2):107-10.
Morgan JA, Bombell S, McGuire W. Association of plasminogen activator inhibitor-type 1 (-675 4G/5G) polymorphism with pre-eclampsia: systematic review. PloS one. 2013;8(2):e56907.
Khosravi F, Zarei S, Ahmadvand N, Akbarzadeh-Pasha Z, Savadi E, Zarnani A-H, et al. Association between plasminogen activator inhibitor 1 gene mutation and different subgroups of recurrent miscarriage and implantation failure. J Assist Reprod Genet. 2014;31(1):121-4.
Peng H, Yeh F, de Simone G, Best LG, Lee ET, Howard BV, et al. Relationship between plasma plasminogen activator inhibitor-1 and hypertension in American Indians. Journal of Hypertension. 2017;35(9):1787-93.
Salmi A, Zaki MN, Zakaria, Nor Aliza G, Rasool HG. Arterial stiffness, inflammatory and pro-atherogenic markers in gestational diabetes mellitus. Vasa. 2012;41(2):96-104.
Bugatto F, Quintero-Prado R, Visiedo FM, Vilar-Sánchez JM, Figueroa-Quiñones A, López-Tinoco C, et al. The influence of lipid and proinflammatory status on maternal uterine blood flow in women with late onset gestational diabetes. Reproductive Sciences. 2018;25(6):837-43.

No competing interests reported.

supplementaryfigure.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

A strong Association between Plasminogen Activator Inhibitor Type - 1 (-657 4G/5G PAI-1) and the Development of Pre-eclampsia

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

1. Sample preparation

2. Blood sampling

3 DNA extraction and genotyping

4. Primer-PCR program

5. Biochemical Parameters:

Statistical analysis

3. Results

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1