L-arginine, matters for skin health of leopard coral grouper (Plectropomus leopardus)

doi:10.21203/rs.3.rs-2751834/v1

An 8 weeks feeding trial was conducted in leopard coral grouper to observe the effects of dietary arginine (Arg) level on growth and skin health about development, pigmentation, antioxidant ability, immune capacity. Fish were feed five iso-lipidic and iso-proteic diets containing the Arg 2.4%, 2.9%, 3.4%, 3.9%, 4.4%, respectively. Results shown that the optimal dietary Arg value for best growth of leopard coral grouper was 3.72% of dry matter (corresponding to 6.73% of dietary protein) based on weight gain rate. The epidermis thickness of back skin and abdomen skin in Arg3.4, Arg3.9 and Arg4.4 groups was significantly higher than Arg2.4 and Arg2.9 groups. The SOD, carotene and astaxanthin in Arg4.4 group were significantly higher than Arg2.4 and 2.9 groups. Key genes in nicotinate and nicotinamide metabolism, gluconeogenesis, pentose phosphate, glutathione synthesis and ceramide synthesis pathways were significantly upregulated in Arg3.4 than Arg2.4 group, the synthesis genes of immune factors were significantly upregulated in Arg3.4 than Arg2.4 group. Suitable dietary Arg level can promote the morphological development, improve the antioxidant ability, enhance the immune capacity and reduce the consumption of pigment of skin. The results supported that Arg is an effective skin health enhancer for leopard coral grouper.

Biological sciences/Immunology/Mucosal immunology

Health sciences/Health care/Nutrition

As one kind of coral trout belonging to Serranidae family in Perciformes class, leopard coral grouper (Plectropomus leopardus) has great economic value worldly for its fascinating taste and ravishing appearance (1, 2). Whereas, the natural population of leopard coral grouper was under threatened result in the over fishing driven by the pursuit for its conspicuous economic value (3). The development of artificial breeding and intensive culturing of leopard coral grouper was stimulated by the contradiction between the diminishing natural resources and the growing market demand (4). In China, leopard coral grouper from artificial farming has become an essential marine culture fish and came into being the main substitute for wild-caught supplying for market (5). Nevertheless, the breaking of pathogen and fading of body color were on the way with the exaggerated increasing breeding density, germplasmic degradation and nutrients provision imbalance in the artificial farming (6–8). The benefits of leopard coral grouper farming suffer from greatly diminishment for the reasons of skin eruptions even mass mortality caused by pathogen infection and appearance deterioration caused by pigment fading (6, 9).

As a matter of fact, fish was easily contacted with diversity pathogens inhabiting in the complicated and changeable water environment (10). The skin of fish interacted with the environment directly, which not only acted as a mechanical barrier insulating from outside, but also played particular roles in specific and non-specific immunity (11). The surface of fish skin was covered with a layer of mucus, which mainly formed by mucin secreted by mucus secretory cells, played the role of buffering friction and also contained multifold bio-activator for clearing the pathogens, such as immunoglobulins, lectins and protease (12). Moreover, fish skin and mucus contained a large number of antioxidant substances and enzymes for oxyradical elimination (13). The integrity of the structure and function of fish skin was extremely important in safeguard for health and resistance for pathogens invasion. But the truth was that problems such as skin damage, ulcers and abrasions occurred frequently for fish in the high-density intensive farming (14). Therefore, improving fish skin health was key to the sustainable development of the aquaculture commerce. Interestingly, studies have found that Arg should be a skin health enhancers for both aquatic and terrestrial animals (14–17).

Arg was one of the essential amino acid for fish (18), which was the substrate for protein synthesis and nitric oxide production, as well as participated in multifarious regulatory processes indirectly such as cell division, antioxidant and immune defense (19, 20). Two major metabolic pathways of Arg played roles in skin healing, the synthesis of nitric oxide (NO) by nitric oxide synthase (NOS)and the production of urea and ornithine by arginase-1 (16). The NO could kill the pathogenic bacteria of skin and the ornithine could further generate polyamines by ornithine decarboxylase, which was the molecules necessary for cell division to promote the skin healing (19, 21). Other study found that Arg has an anabolic effect on proteins in skin but independent of Arg-NO pathways (20). Arg could regulate through mTOR pathway and participate directly in protein synthesis, hence the suitable dietary Arg level could promote the development of tissues and growth of individuals (22). The optimal dietary Arg level for best growth performance in many species has been reported (18, 23–25) but not in leopard coral grouper. In this study, we focused on the optimal Arg requirement of leopard coral grouper and its effects on individual development and skin health, sought for the nutritional interventions methods to improve the growth and health of fish in intensive cultivation.

2.1. Experiment diets

Five groups of iso-lipidic and iso-proteic experimental diets were formulated, contained Arg levels ranging from 2.4–4.4% (dry matter) at approximately 0.5% increments by adjusting the composition ratio of Arg and alanine in the amino acids mixture adding in feed (Table 1). The feed ingredients were crushed and passed through a 60-mesh screen (0.25 mm), then weighed according to the formula and mixed thoroughly. After that they were mixed with fish oil, soybean phospholipid, water and then extrude into strips with 2.5 mm in diameter. Diets were dried to a moisture of about 10% in the air-conditioned room, then stored in the refrigerator at − 20°C before using. Amino acid composition of ingredients (Table 2) and diets (Table 3) were tested by Willtest Technology Co., LTD (Sichuan, China).

2.2. Fish rearing

An 8 weeks feeding trial for leopard coral grouper (Hongyun commercial hatchery, Zhanjiang, China) was carried out at Marin’s Research Station of Guangdong Ocean University (Zhanjiang, China). After acclimatizing to the experimental conditions for 2 weeks by feeding the marine fish comprehensive feed (Crude protein > 50%, ether extract > 8%), 450 healthy and active leopard coral grouper with mean weight of 9.30 ± 0.02 g were allocated into 15 1t-fiberglass tanks with 30 fish in each. Fish was raised in still water and fed three times a day at 8:00, 12:30, 17:00, the feeding amount was adjusted according to the eating situation and weather condition. The seawater which has been precipitated and filtered was changed more than 90% each tank a day to keep it clean.

2.3. Sampling

The total quantity of feed used throughout the experiment as well as the total amount and mass of dead fish were recorded. Fish was fasted 24 hours at the end of the feeding trial, before sampling, fish was anaesthetized by MS-222 (1:10,000). All fish in each tank were counted and weighted. After being sterilized with 750 ml/L alcohol, six fish from each tank were selected randomly to collect the blood, skin tissues and skin mucus. Half of the skin tissues in each group were stored in 4% formaldehyde solution for paraffin sections. Blood was centrifuged 10 min at 3500 r/min to obtain serum samples, together with other skin tissue and skin mucus, were stored in the − 80℃ refrigerator.

2.4. Calculation of growth performance and feed utilization efficiency

Survival rate (SR), weight gain rate (WGR), specific growth rate (SGR) and feed coefficient rate (FCR) were calculated as follows;

SR (%)= FN / IN × 100%;

WGR (%)=(FW - IW༉/ IW × 100%;

SGR (%/d)=(lnFW - lnIW༉/ d × 100%;

FCR = F/(FWt - IWt);

IN, FN were the initial and final amount of the leopard coral grouper in each tank, IW, FW were the initial and final average weight (g), IWt, FWt were the initial and final total fish weight (g), F was the total mass of diet (g) sued during the experiment, d was the days of cultivation.

2.5. Testing of IgM, IgT, LZM, SOD and ROS

Immunoglobulin M (IgM), immunoglobulin T (IgT), reactive oxygen species (ROS), superoxide dismutase (SOD) and lysozyme (LZM) in serum, back skin, abdomen skin and skin mucus were tested by the kits (Shanghai Enzyme-linked Biotechnology Co., Ltd). The sample homogenization and testing were carried out in strict accordance with the kit instructions.

2.6. Testing of chromatic value and pigment content of skin

At the end of the feeding trial, 5 fish in each tank (15 fish each group) were selected randomly to test the chromatic value of back skin and abdomen skin by Chroma Meter CR-400 (Minolta, Osaka, Japan). Five sites were measured on both sides of the back skin and abdomen skin of each fish. The color parameters were L*, a* and b* for lightness, redness and yellowness. The carotenoids, astaxanthin and melanin content of serum, back skin and abdomen skin were tested by the kits from Shanghai Enzyme-linked Biotechnology Co., Ltd. The sample homogenization and testing were carried out in strict accordance with the kit instructions.

2.7. Histological observation of skin tissues

After being fixed with formaldehyde, embedded in paraffin, dewaxed, stained with hematoxylin eosin (H.E), dehydrated and sealed, the back skin and abdomen skin were made into H.E staining paraffin sections. The sections were viewed using a microscope and photographed at ×100 and ×400 magnifications and the images were measured by Image-Pro Plus6.0 (Media Cybernetics, Inc., USA). Five randomly selected fields in each skin section were used to measure melanin area, and 10 randomly selected sites in each field were used to measure epidermis thickness.

2.8. Transcriptome sequencing and real-time PCR quantitative

Total six samples from Arg2.4 and Arg3.4 groups were selected for transcriptome sequencing, including sample Arg2.4-1, Arg2.4-2, Arg2.4-3 from Arg2.4 group and Arg3.4-1, Arg3.4-2, Arg3.4-3 from Arg3.4 group. Transcriptome sequencing was conducted at Gene Denovo Biotechnology Co., Ltd (Guangzhou, China) and the bioinformatic was analysis using omicsmart online analysis platform (https://www.omicsmart.com). All of the genes obtained from sequencing were enriched at A class, B class, pathways level in KEGG database and at level 1, level 2, level 3 in GO database. Eight representative different expression genes (DEGs) were chosen for qRT-PCR analysis to verify the reliability of the transcriptome sequencing. Quantitative RT-PCR analyses were performed on the six RNA samples from the transcriptome sequencing. RNA samples were reverse transcribed into cDNA using PrimerScript RT-PCR Kit (TaKaRa, Kusatsu, Japan) and stored at − 20°C for RT-PCR analysis. Primers of FEL, Bco2, Cirl, actb, NT5E, PCK1, GSTF8 and g6pd for RT-PCR were design by primer 5.0 software based on the sequence data from transcriptome sequencing (Table 4). The primer of reference gene rp113 refers to Chen et al (26). The RT-PCR reactions were run using a SYBR Premix Ex Taq Kit (Takara) in an Applied Biosystems 7500 RT-PCR System (Life Technologies, Carlsbad, CA, USA). The specific operation method refers to Fei et al. (27).

2.9. Statistic analysis

All statistical analyses were performed using Statistical Package for the Social Sciences Statistics (v. 22, SPSS Inc.). Raw data were subjected using one-way analysis of variance (ANOVA) to statistical verification, the means of each group were compared by using the Turkey's tests. All data were presented as means ± standard error (SEM). P < 0.05 were considered significant difference.

Table 1

Ingredient and proximate analyses of the experimental diets.
	Arg2.4	Arg2.9	Arg3.4	Arg3.9	Arg4.4
Ingredient (% dry weight)
Fish meal	42.00	42.00	42.00	42.00	42.00
Soybean protein concentrate	5.00	5.00	5.00	5.00	5.00
Corn gluten meal	10.00	10.00	10.00	10.00	10.00
Chicken by-product meal	5.00	5.00	5.00	5.00	5.00
Amino acid premix ^a	7.00	7.00	7.00	7.00	7.00
Alanine	2.50	2.00	1.50	1.00	0.50
Arginine	0.00	0.50	1.00	1.50	2.00
Wheat meal	21.35	21.35	21.35	21.35	21.35
Fish oil	3.00	3.00	3.00	3.00	3.00
Soybean lecithin	1.00	1.00	1.00	1.00	1.00
Choline chloride	0.50	0.50	0.50	0.50	0.50
Ca(H₂PO₄)₂	1.50	1.50	1.50	1.50	1.50
Vitamin C	0.05	0.05	0.05	0.05	0.05
Vitamin and mineral premix ^b	1.00	1.00	1.00	1.00	1.00
Ethoxyquinoline	0.10	0.10	0.10	0.10	0.10
Total	100.00	100.00	100.00	100.00	100.00
Proximate analyses (%)
Moisture	7.61	8.46	8.27	7.60	7.93
Ether extract (EE)	9.16	9.23	9.05	8.97	9.13
Crude protein (CP)	54.34	54.87	55.03	55.13	55.46

^a Amina acid premix: 18.00% Thr, 10.00% Val, 8.00% Met, 15.00% Ile, 15.00% Leu, 4.00% Phe, 29.00% Lys, 1.00% His.

^b Vitamin and mineral premix: 5.0 mg/kg thiamine, 10.0 mg/kg riboflavin, 5000.0 IU vitamin A, 40.0 mg/kg vitamin E, 1000.0 IU vitamin D3, 10.0 mg/kg menadione, 10.0 mg/kg pyridoxine, 0.02 mg/kg cyanocobalamin, 0.1 mg/kg biotin, 20.0 mg/kg calcium pantothenate, 1.0 mg/kg folic acid, 40.0 mg/kg niacin, 150.0 mg/kg vitamin C, 100.0 mg/kg iron, 0.8 mg/kg iodine, 3.0 mg/kg cupper, 50.0 mg/kg zinc, 12.0 mg/kg manganese, 0.3 mg/kg selenium, 0.2 mg/kg cobalt.

Table 2

Composition of materials (%)
	Fish meal	Soybean protein concentrate	Corn gluten meal	Chicken by-product meal	Wheat meal
Crude protein	73.28	70.86	62.13	69.43	10.40
Ether extract	7.16	1.22	1.92	14.08	0.31
Arg	4.28	5.34	1.86	4.63	0.61
Thr	3.21	2.72	2.04	2.53	0.35
Val	3.57	3.51	2.61	3.16	0.69
Met	2.22	0.86	1.27	1.30	0.27
Ile	3.18	3.74	2.34	2.62	0.50
Leu	5.50	5.84	10.06	4.63	0.77
Phe	3.22	3.77	3.84	3.02	0.86
Lys	5.77	4.56	0.99	4.00	0.30
His	2.23	2.25	1.31	1.43	0.31

Table 3

Amino acid composition of the experiment feed.
Amino acid	Arg2.4	Arg2.9	Arg3.4	Arg3.9	Arg4.4
Arg	2.40	2.89	3.43	3.91	4.41
Asp	3.73	3.74	3.84	3.77	3.88
Thr	3.12	3.14	3.13	3.06	3.11
Ser	1.98	1.99	1.94	1.89	1.97
Glu	7.12	7.17	7.18	7.18	7.22
Gly	2.38	2.35	2.50	2.35	2.43
Ala	5.33	4.85	4.44	3.85	3.38
Cys	0.64	0.67	0.62	0.67	0.68
Val	2.64	2.65	2.71	2.71	2.74
Met	1.56	1.56	1.46	1.59	1.62
Ile	2.71	2.73	2.80	2.77	2.81
Leu	4.88	4.93	4.89	4.96	4.95
Tyr	1.45	1.49	1.41	1.47	1.52
Phe	2.28	2.29	2.33	2.31	2.38
Lys	4.70	4.71	4.82	4.74	4.78
His	1.34	1.35	1.34	1.34	1.26
Pro	2.28	2.32	2.37	2.26	2.27

3.1 Growth, survival rate and feed utilization of leopard coral grouper

The WGR and SGR in Arg3.4 group were the highest among all groups and significantly higher than Arg2.4 and Arg2.9 groups (P < 0.05). The SR of all groups were more than 90% without significant difference (P > 0.05). The FCR in Arg3.4, 3.9 and 4.4 groups were significantly lower than Arg2.4 and 2.9 group (P < 0.05) (Table 5). The optimal dietary Arg level for best growth performance was 3.72% according to the binary regression fitting curve of WGR (Figure 1).

3.2 Back skin and abdomen skin morphology of leopard coral grouper

With the increase of dietary Arg level, the epidermis thickness of back skin and abdominal skin first increased and then tended to be stable. There was no significant difference in epidermis thickness of back skin and abdominal skin between Arg3.4, 3.9, 4.4 group (P > 0.05), but they were significantly higher than those in Arg2.4 and 2.9 group (P < 0.05). Compared with Arg2.4 and 2.9 group, Arg3.4, 3.9 and 4.4 groups had denser mucus cells in epidermis of back skin and abdominal skin. There was no significant difference with the melanin area in back skin and abdomen skin among all groups (P > 0.05) (Figure 2).

3.3 ROS and SOD in serum, back skin, abdomen skin and skin mucus of leopard coral grouper

The ROS of abdomen skin In Arg3.9 and Arg4.4 group was lower than Arg2.4 group with significant difference (P＜0.05). There was no significant difference with the ROS in back skin among all groups (P＞0.05). The SOD of back skin and abdomen skin in Arg4.4 group was significantly higher than Arg2.4, Arg2.9 and Arg3.4 groups (P＜0.05). The SOD of skin mucus in Arg4.4 group was significantly higher than Arg2.4 group (P＜0.05) (Figure 3).

3.4 IgM, IgT, and LZM in serum, back skin, abdomen skin and skin mucus of leopard coral grouper

The IgM and IgT in back skin, abdomen skin and skin mucus increased with the increasing of dietary Arg level. The IgM of back skin and abdomen skin were higher than other groups with significant difference (P＜0.05). The IgM of skin mucus in Arg2.4 group was significantly lower than other groups (P＜0.05). The IgT in back skin and skin mucus of Arg4.4 group were significantly higher than Arg2.4 group (P＜0.05). The LZM of abdomen skin in Arg4.4 group were significantly higher than Arg2.4, Arg2.9 and Arg3.4 groups (P＜0.05). The LZM of back skin in Arg4.4 group was significantly higher than Arg2.4 group (P＜0.05) (Figure 4).

3.5 Chromatic value and pigment content in serum, back skin and abdomen skin of leopard coral grouper

The carotenoids and astaxanthin content of back skin and abdomen skin increased with the increase of the dietary Arg level. The carotenoids content of back skin and abdomen skin in Arg4.4 group were significantly higher than Aeg2.4 group (P＜0.05). The astaxanthin content of back skin in Arg4.4 group was higher than Arg2.4, and 2.9 groups with significant different (P＜0.05). There was no significant different with the melanin content of back and abdomen skin among all groups (P > 0.05) (Figure 5). There was no significant different with the redness and yellowness of back skin and abdomen skin among all groups (P > 0.05). The brightness of back skin and abdomen skin in Arg3.4, 3.9, 4.4 groups were significantly higher than Arg2.4 group (P＜0.05) (Figure 6).

3.6 Transcriptome sequencing of back skin in Arg2.4 and Arg3.4 group of leopard coral grouper

Six samples form back skin were sent for transcriptome sequencing, including Arg2.4-1, Arg2.4-2, Arg2.4-3 from Arg2.4 group and Arg3.4-1, Arg3.4-2, Arg3.4-3 from Arg3.4 group. In each sample, the Q30 of the clean base was more than 90%, the reads unmapped to rRNA / total clean reads was higher than 99% and the ratio of reads mapped to genome was more than 80% (Table 6). The genes first increases and then becomes stable with the increase of the amount of reads (Figure 7). The results indicated that the sequencing was of high quality and sufficient, which could be further analyzed.

The different expressed genes (DEGs) were identified on the basis of P ＜ 0.05. A total of 366 DEGs were identified with 203 upregulated DEGs and 163 downregulated DEGs in Arg3.4 group compared to Arg2.4 group (Figure 8). Symbol and main functions of DEGs were authenticated by gene bank blasting, GO enrichment and KEGG pathways enrichment (Figure 9). Among them, upregulated DEGs related to metabolism, antioxidant and immune defense mainly included: pck1, fbp in gluconeogenesis, g6dp in pentose phosphate pathway, nt5e, rbp7, nadk in nicotinate and nicotinamide metabolism, genes of haptoglobin and transcobalamin in transport of Vitamin B₁₂, gch in folate biosynthesis, g6dp, ggt, gst in glutathione metabolism, degs2 in ceramide synthesis pathway, igll1, pigr, trbv18 concerned with immunoglobulins, ctrl, fel concerned with lectin, prss1, st14, prss27, ctsz, ctsh concerned with protease, lysozyme-related gene lug2, c1qtnf6 in complement system, interleukin-related gene il17rc and mucin-related gene muc19. Downregulated DEGs related to immune defense mainly included gene of complement decay-accelerating factor hig, gene of interleukin-6 receptor il6st and gene of beta-carotene 9',10'-oxygenase Bco2. In Arg3.4 group, genes related to antioxidant enzymes secretion were upregulated without significant difference (Table 7).

Table 4

Primers used for the real-time PCR (RT-PCR) analysis
Primer name	Primer sequence (Forward, 5′ to 3′)	Primer sequence (Reverse, 5′ to 3′)
rp113	CGGACGTGGCTTCACTCTG	CTTGATGGGCATGACTGGAC
FEL	CGTCCCATGGATCAAGAGTATAA	GGAGTCTGTAGTCAGCAATGAG
Bco2	CAAGTCGGGAGAAGCATTAGAT	GGTGTTCAGGTTCTGGTCTATT
Cirl	AATACCTGGAAACCACCTACAC	CGTCCATAGTCAGCACCATAC
actb	TGGCAGAGATCTGACTGACTA	ACATAGCACAGCTTCTCCTTAAT
NT5E	TGGACCACATCTGAGGTTTATG	CCTTCTTCGCGATCTCCTTATC
PCK1	GGAGCAAGGGATGATCAAGAAG	CCGGGTCACAATCACAGTTT
GSTF8	GCTCACCCTCAACCAGAAA	GTATCCCTCCCACAGCTTTATC
g6pd	GGGATGGGCTTTATGACCTATAC	TCACAGACAGGGACCATAGA

Table 5

Effects of dietary Arg level on growth, feed utilization and morphologic indexes of leopard coral trout
	Arg2.4	Arg2.9	Arg3.4	Arg3.9	Arg4.4
IW (g)	9.30 ± 0.00	9.29 ± 0.00	9.31 ± 0.01	9.30 ± 0.00	9.31 ± 0.01
FW (g)	31.97 ± 0.44^d	33.23 ± 0.34^cd	39.27 ± 0.48^b	36.55 ± 1.18^bc	35.99 ± 1.03^bc
WGR (%)	243.74 ± 4.77^c	257.57 ± 3.66^bc	321.82 ± 5.59^a	293.11 ± 12.77^ab	286.34 ± 11.63^ab
SGR (%/d)	2.29 ± 0.03^c	2.36 ± 0.02^bc	2.67 ± 0.02^a	2.53 ± 0.06^a	2.50 ± 0.06^ab
SR (%)	93.33 ± 3.33	93.33 ± 3.33	100.00 ± 0.00	93.33 ± 5.10	94.44 ± 1.11
FCR	2.56 ± 0.11^a	2.57 ± 0.18^a	1.67 ± 0.03^c	2.08 ± 0.08^c	2.04 ± 0.04^b

Different letters represents a significant difference between groups and the same below.

Table 6

Quality control, sequence alignment and gene analysis from transcriptome sequencing of leopard coral grouper
	Arg2.4-1	Arg2.4-2	Arg2.4-3	Arg3.4-1	Arg3.4-2	Arg3.4-3
Raw bases	8111529900	7092014700	6964793700	6312840300	5563745100	5776425000
Clean bases	7959288144	7008159708	6862203941	6222277406	5494317076	5702501719
Clean bases/ Raw bases	98.12%	98.82%	98.53%	98.57%	98.75%	98.72%
Q30 of clean bass	91.86%	92.71%	92.79%	93.12%	92.44%	93.06%
Raw reads	54076866	47280098	46431958	42085602	37091634	38509500
Clean reads	53795982	47068862	46251558	41947308	36974940	38390506
Clean reads/ Raw reads	99.48%	99.55%	99.61%	99.67%	99.69%	99.69%
Reads unmapped to rRNA	53708980	47034630	46207350	41897596	36930592	38348528
Reads unmapped to rRNA/ Clean reads	99.84%	99.93%	99.90%	99.88%	99.88%	99.89%
Reads mapped to genome	45237756	39542376	39769842	35723892	33227454	32727902
Reads mapped to genome/ Reads unmapped to rRNA	84.23%	84.07%	86.07%	85.26%	89.97%	85.34%
Total genes from sequencing	18783	13247	14740	14245	14203	14489

Table 7

Partial of DEGs related to metabolism, antioxidant and immune defense in skin transcriptome of leopard coral grouper
Gene ID in transcriptome	Gene symbol	Related introduction	Log2FC	Regulated	P-value
MSTRG.10128	IGLL1	Immunoglobulin light chain	3.28	up	0.00
augustus-DXB_utg000750l_pilon-processed-gene-0.3-mRNA-1	IGLL1	Immunoglobulin light chain	4.46	up	0.02
MSTRG.31887	PIGR	Polymeric immunoglobulin receptor	2.79	up	0.05
maker-DXB_utg000012l_pilon-snap-gene-1.310-mRNA-1	TRBV18	Immunoglobulin lambda variable	7.13	up	0.05
MSTRG.12780	Mr1	major histocompatibility complex class I	1.66	up	0.00
MSTRG.32994	Cirl	L-rhamnose-binding lectin	3.24	up	0.00
MSTRG.19914	FEL	Fish-egg lectin	1.81	up	0.01
maker-DXB_utg000141l_pilon-augustus-gene-1.200-mRNA-1	Prss1	Anionic trypsin	12.43	up	0.00
MSTRG.25343	ST14	Trypsin	11.35	up	0.04
maker-DXB_utg000419l_pilon-snap-gene-0.188-mRNA-1	PRSS27	Eathepsin Z	5.20	up	0.00
MSTRG.1785	CTSZ	Pro-cathepsin H	0.98	up	0.05
MSTRG.15949	CTSH	Serine protease 27	0.88	up	0.05
maker-DXB_utg000087l_pilon-snap-gene-0.177-mRNA-1	LYG2	Lysozyme G	1.51	up	0.02
maker-DXB_utg000043l_pilon-snap-gene-0.347-mRNA-1	C1qtnf6	Complement C1q tumor necrosis factor	4.74	up	0.00
maker-DXB_utg000007l_pilon-augustus-gene-0.88-mRNA-1	hig	Complement decay-accelerating factor	-0.92	down	0.00
MSTRG.32366	IL17RC	Interleukin 17 receptor C	1.23	up	0.03
MSTRG.15217	Il6st	Interleukin-6 receptor	-0.83	down	0.05
maker-DXB_utg000536l_pilon-augustus-gene-0.57-mRNA-1	Muc19	Mucin	9.17	up	0.00
maker-DXB_utg000065l_pilon-augustus-gene-0.205-mRNA-1	PCK1	Phosphoenolpyruvate carboxykinase	4.65	up	0.00
MSTRG.25991	FBP1	Fructose-1,6-bisphosphatase	1.08	up	0.02
MSTRG.32293	g6pd	Glucose-6-phosphate 1-dehydrogenase	0.95	up	0.03
MSTRG.12624	NT5E	5'-nucleotidase	3.89	up	0.00
MSTRG.32768	Rbp7	Adenylyltransferase 1	1.83	up	0.00
MSTRG.33010	Nadk	NAD kinase	1.16	up	0.00
MSTRG.32768	Rbp7	Adenylyltransferase 1	1.83	up	0.00
maker-DXB_utg000551l_pilon-augustus-gene-0.71-mRNA-1	HP	Haptoglobin	1.46	up	0.03
MSTRG.28564	TC	Transcobalamin	5.58	up	0.00
maker-DXB_utg000003l_pilon-augustus-gene-1.134-mRNA-1	GCH1	GTP cyclohydrolase 1	2.06	up	0.00
maker-DXB_utg000499l_pilon-augustus-gene-1.147-mRNA-1	Ggt5	Glutathione hydrolase 5 proenzyme	1.75	up	0.00
augustus-DXB_utg000067l_pilon-processed-gene-1.3-mRNA-1	GSTF8	Glutathione s-transferase	1.52	up	0.01
augustus-DXB_utg000175l_pilon-processed-gene-0.17-mRNA-1	GSS	Glutathione synthetase	1.68	up	0.02
MSTRG.9807	Degs2	Sphingolipid delta(4)-desaturase	1.54	up	0.00
MSTRG.11501	Bco2	Beta-carotene 9',10'-oxygenase	-0.71	down	0.04

In the present study, the optimal dietary Arg value for best growth performance of juvenile leopard coral grouper was 3.72% of dry matter, which was equivalent to 6.73% of the dietary protein concentration. The value was close to those reported in some of other grouper species, 6.82% for Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂ (18), 6.5% for E. awoara (25) and 6.78% for Cromileptes altivelis (28). Suitable dietary Arg value could improve the growth performance for fish, which may attributed to the stimulant of hormones (18) and promotion of protein synthesis (29). The germinate of fish depended heavily on protein synthesis and accumulation in vivo. Arg regulated the amino acids transport from blood into tissues, and together with itself provided substrates for protein synthesis (20). On the other hand, Arg was able to activate the mTOR signal pathway (22) to promote protein synthesis through regulating phosphorylation of 4E-BP1 and activation of p70 S6 kinase (30).

The growth of fish was accompanied by the tissues development, which was based on cell proliferation and differentiation. Ornithine produced by Arg under arginase-1, could further generate into polyamines, the organic cations of low molecular weight ubiquitously and played important roles in the regulation of cell cycle, division and differentiation (31). In this study, suitable dietary Arg value increased the thickness of the epidermis and the number and volume of mucus secretory cells, promoted the development of skin tissue of leopard coral grouper. The epidermis of fish covering the external surfaces, was the mucilaginous stratified epithelium contains a large number of living cells different from terrestrial animals (32). The skin of fish was not only subjected to the osmotic pressure and friction between environment and cells, but also contracted with the pathogen present all over the water (33). In fish skin, the filament containing cells located near the surface, had the ability to division and differentiate to replenish the damaged epidermal cells, the mucus secretory cells located in the middle layer, were kinds of unicellular glands that could secrete mucin and diversiform of immune factors, which played the major roles in skin defense (32, 34). With the suitable dietary Arg value, the thickening of the epidermis indicated that the ability to withstand friction was stronger. The increase and enlargement of mucus secretory cells in skin also indicated that the secretion ability was more vigorous, which was more conducive to defense the invasion of pathogens.

In addition to the regulation of cell progression and the promotion of amino acid transport and protein synthesis mentioned above, the promotion of Arg on skin development of fish may also be due to the promotion of ribose synthesis to provide substrate for nucleic acid synthesis in cell division. Found in the present study with transcriptome sequencing in back skin of juvenile leopard coral grouper, the key gene g6pd in pentose phosphate pathway, was significantly upregulated in Arg3.4 group compared to Arg2.4 group. These was the only pathway that G-6-P undergoes a series of reactions to generate ribose phosphate, which was necessary for all nucleotide and nucleic acid synthesis for individuals (35). Not only that, the pentose phosphate pathway also generated a large amount of NADPH to balance the intracellular redox potential of cells, which played an essential role in cell growth regulation (36). NADPH was indispensable for the synthesis of GSH, which was the central redox agent in living organisms (37). It could be seen from the transcriptome sequencing that suitable dietary Arg value could promote the expression of key genes in pentose phosphate and glutathione synthesis pathway, improve the antioxidant ability in vivo.

The complicated and changeable habitats of fish and oxidative respiration result in the generation of oxidizing free radicals with active reactive properties in vivo (38). GSH was the antioxidant compounds in endogenous antioxidant system of fish, which involved in the elimination of oxidative free radicals to maintain the REDOX balance in cells (39). By analyzing the DEGs in back skin of juvenile leopard coral grouper, a concise regulatory network of Arg on glutathione synthesis was found (Fig. 10): 1), the nicotinate and nicotinamide metabolism pathway, NMN synthesize NAD by nicotinamide mononucleotide adenylyltransferase, and NAD further synthetizes NADP by NAD kinase. 2), the gluconeogenic pathway, PPE is synthesized from OAA under the action of phosphoenolpyruvate carboxykinase, and then F-1,6-BP is synthesized from PPE through a series of reversible reactions, F-6-P is synthesized from F-1,6-BP crossing the energy barrier by fructose-1,6-bisphosphatase, and G-6-P is further synthesized. 3), G-6-P enters the pentose phosphate pathway and generates GDL under the catalysis of glucose-6-phosphate dehydrogenase, in this process, NADP obtains H + and forms NADPH. 4), NADPH enters the glutathione metabolism pathway and participates in the synthesis and reduction maintenance of GSH.

Another component of the endogenous antioxidant system was antioxidant enzymes such as SOD (13). In this study, both SOD activity and expression of sod genes in back skin were higher in Arg3.4 group than Arg2.4 group, but no significant difference was found. In other fish species, it was found that the suitable dietary Arg value could regulate the keap1/nrf2 pathway to promote the expression of its downstream genes related to antioxidant enzymes such as sod, cat and ho-1, improve the activity of antioxidant enzymes in fish and enhance the ability of oxidation resistance (40, 41). Found in the present study, the SOD activity in Arg4.4 group of back skin and abdomen skin was significantly higher than Arg2.4, 2.9 and 3.4 group. This showed that dietary Arg value promoted both antioxidant substances and enzymes in vivo, but the degree of effect was not completely consistent. Interestingly, the variation trend of carotene and astaxanthin content between dietary Arg level was similar to that of SOD activity, but opposite to that of ROS content in skin of juvenile leopard coral grouper. The research on pigmentation of leopard coral grouper attracted great attention (1, 41, 42), whereas, few reports have focused on the relationship between amino acid nutrition and pigmentation of fish.

The puniceus appearance of leopard coral grouper was largely dependent on the accumulation of carotenoids, especially astaxanthin, in the skin (43). Astaxanthin was a well-known and highly effective colorant and antioxidant, which was widely used to improve the pigmentation and antioxidant capacity of fish (44, 45). Study has shown that astaxanthin could mitigate the oxidative stress in microplastics challenge but at the expense of pigment deposition (46). This indicates that astaxanthin would react with oxidative free radicals and consume itself in the process of antioxidant in vivo. Found in the present study, the deposition of carotene and astaxanthin increased by the increase of Arg, which may be related to the improvement of antioxidant capacity and elimination of oxidative free radicals in the body. From the transcriptome sequencing we found that the expression of bco2, gene related to metabolism of carotene, was significantly downregulated in Arg3.4 group compared to Arg2.4 group. Pearson correlation analysis showed that the expression of this gene was significantly positively correlated with ROS and negatively correlated with SOD in back skin (Fig. 11). This results further proved the hypothesis that suitable dietary Arg value could promote pigment deposition by improving the antioxidant capacity of the body, reducing the content of oxidative free radicals and the consumption of pigment in redox reaction for leopard coral grouper. We further examined the skin chromatic value, found that the redness on back skin and abdomen skin was improved by Arg increasing, but there was no significant difference. This may be related to the low content of pigment without additional added in the experimental diet. In the future study, we sought to explore the effect of antioxidant, pigment protection and body color by amino acids on leopard coral grouper by adding pigment additive in diet.

The last but not least, suitable dietary Arg value enhanced the immunity of skin for juvenile leopard coral grouper by accelerating the synthesis of immune factors. As the same with intestine, the skin of fish was the mucosal associated lymphoid tissue, which contained a variety content of immune factors (47). In this study a large number of immune factor genes were found from transcriptome sequencing, including the genes of immunoglobulin, lectin, protease, lysozyme, complement protein and interleukin. It was found that the synthesis genes of these factors were significantly upregulated and the degradation genes were significantly downregulated in Arg3.4 group compared to Arg2.4 group, indicated that suitable dietary Arg value could enhance the immune effect of skin by genes expression regulating. This was consistent with the results of IgM, IgT content and LZM activity tested in the skin. The benefits of Arg for fish intestinal mucosal immune system have been reported in many studies (15, 18, 48–50). The skin mucosal was quite similar to those in intestine, with presence of goblet cells and bacterial microbiota coated by immunoglobulins, content of B cells, abundant T cells and the ratio of IgM / IgT B cells (51, 52). Study indicated that applicable suitable Arg value for Sparus aurata can accelerate wound healing of skin and stop inflammation reaction (14), just like the present study, suitable dietary Arg value had also been shown to improve fish skin health. It is worth noting that suitable dietary Arg level also significantly upregulated the expression of genes in the ceramide synthesis pathway. Ceramide was an dominant lipid class closely related to human skin health (53), but few reports had been reported in fish skin.

In this study Arg also shown positive effects on fish skin health to increase the oxidation resistance, immunoglobulin content and LZM ability. Similar studies found that the suitable Arg level could increase the immunoglobulin content on channel catfish (54), E. fuscoguttatus ♀ × E. lanceolatus ♂(18), C. altivelis (28) and LZM ability on Sebastes schlegelii (55), Sciaenops ocellatus (56) and Trachinotus ovatus (57). Being an essential member of the non-specific immune system, LZM can eliminate the invaders by hydrolyzing the cytoderm of Gram-positive bacteria (58). As the important factor involved in adaptive immunity, immunoglobulin is a kind of glycoprotein produced by B cells under antigen stimulation, Arg could improve its secretion by promoting the proliferation of lymphocyte and differentiation of B cell (59).

In conclusion, results from the present study suggested that suitable dietary Arg value could improve the growth performance and promote the skin tissues development of juvenile leopard coral grouper. The obtained results also revealed an increase of antioxidant ability based on the GSH synthesis networks and the strengthen of immunocompetency results in immune factor secretion by the influence of suitable dietary Arg level. Moreover, a positive relationship between pigmentation and antioxidant of skin was established under the intervention of dietary Arg value. From a practical aquaculture point of view, feed with suitable Arg value could be the nutritional interventions methods to improve the growth and health of leopard coral grouper in artificial breeding.

Ethics statement

We confirmed that the study was carried out in compliance with the ARRIVE guidelines. In this study, the animal test was in strict accordance with the recommendations in the “Guide for the Care and Use of Laboratory Animals” set by the National Institutes of Health. The experimental animals and the protocol were approved by the ethics, which were board at Guangdong Ocean University (GDOU-01/2019). All of the animals procedures in the experiment were conducted according to the relevant Chinese policies and National Center for the Replacement Refinement & Reduction of Animals in Research.

Funding

This work was supported by the China Agriculture Research System of MOF and MARA (CARS-47), Special Project on Key Fields of Guangdong Colleges and Universities - Special Project on Key Fields of Rural Revitalization (2020ZDZX1034), Science and Technology Project of Zhanjiang City (2020A02001).

Author contribution

W. L. and S. C. came out with the ideas and design the experiment. S. C. and B. T. applied for experiment funding, X. D. applied for experiment space. S. Z. purchased the feedstuff. W. L. H. D., J. Z. and G. C. conducted the feeding trial at Marin’s Research Station of Guangdong Ocean University (Zhanjiang, China). W. L. H. D., J. Z. and G. C. conducted the index testing at Aquatic Animal Nutrition and Feed Laboratory, College of Fisheries, Guangdong Ocean University. W. L. analysed the data and wrote the paper. S. C. contributed to the manuscript correction. All authors have read and approved to submit.

Acknowledgements

Heartfelt thanks to all the members who involved in this study.

Y. Yang et al., Whole-genome sequencing of leopard coral grouper (Plectropomus leopardus) and exploration of regulation mechanism of skin color and adaptive evolution. Zoological Research 41, 328–340 (2020).
X. W. Zhu et al., Integrative Transcriptomics and Metabolomics Analysis of Body Color Formation in the Leopard Coral Grouper (Plectropomus leopardus). Frontiers in Marine Science 8, (2021).
M. Khasanah, N. N. Kadir, J. Jompa, Reproductive Biology of Three Important Threatened/Near-Threatened Groupers (Plectropomus leopardus, Epinephelus polyphekadion and Plectropomus areolatus) in Eastern Indonesia and Implications for Management. Animals 9, (2019).
Y. B. Wang et al., Industrial Aquaculture Experiment of Plectropomus leopardus. Journal of Tropical Biology 5, 15–19 (2014).
M. A. Rimmer, B. Glamuzina, A review of grouper (Family Serranidae: Subfamily Epinephelinae) aquaculture from a sustainability science perspective. Reviews in Aquaculture 11, 58–87 (2019).
C. Chen et al., Morphology of the Early Age and the Pigment Occurrence and the Effects ofDifferent Feed Additives on the Body Color of Plectropomus leopardus. Progress in Fishery Sciences 35, 83–90 (2014).
L. Lin et al., Effects of stocking density on growth and bloodchemical parameters in Plectropomus leopardmus. Fisheries Science 36, 83–87 (2017).
F. Moravec, J. L. Justine, Capillaria plectropomi n. sp (Nematoda: Capillariidae), a new intestinal parasite of the leopard coral grouper Plectropomus leopardus (Serranidae) off New Caledonia. Parasite 21, (2014).
K. I. Mori et al., Endoparasitic dinoflagellate of the genus Ichthyodinium infecting fertilized eggs and hatched larvae observed in the seed production of leopard coral grouper Plectropomus leopardus. Fish Pathology 42, 49–57 (2007).
R. Harikrishnan, C. Balasundaram, M. S. Heo, Fish health aspects in grouper aquaculture. Aquaculture 320, 1–21 (2011).
A. K. Nigam, U. Kumari, S. Mittal, A. K. Mittal, Comparative analysis of innate immune parameters of the skin mucous secretions from certain freshwater teleosts, inhabiting different ecological niches. Fish Physiology and Biochemistry 38, 1245–1256 (2012).
A. J. Lv et al., Proteomics and immune responses in skin of fish. Fisheries Science 35, 302–307 (2016).
T. Nakano, M. Sato, M. Takeuchi, Unique molecular properties of superoxide dismutase from teleost fish skin. FEBS letters 360, 197–201 (1995).
Z. C. Chen, D. Ceballos-Francisco, F. A. Guardiola, D. Huang, M. N. Esteban, Skin wound healing in gilthead seabream (Sparus aurata L.) fed diets supplemented with arginine. Fish & Shellfish Immunology 104, 347–358 (2020).
Z. C. Chen, D. Ceballos-Francisco, F. A. Guardiola, D. Huang, M. A. Esteban, The alleviation of skin wound-induced intestinal barrier dysfunction via modulation of TLR signalling using arginine in gilthead seabream (Spurns aurata L). Fish & Shellfish Immunology 107, 519–528 (2020).
A. D. B. de Souza et al., The in vivo effect of L-arginine on skin elasticity in mice. Brazilian Journal of Pharmaceutical Sciences 53, (2017).
I. Khalin, G. Kocherga, Arginine glutamate improves healing of radiation-induced skin ulcers in guinea pigs. International Journal of Radiation Biology 89, 1108–1115 (2013).
M. Wu et al., Dietary arginine affects growth, gut morphology, oxidation resistance and immunity of hybrid grouper (Epinephelus fuscoguttatus female x Epinephelus lanceolatus male) juveniles. British Journal of Nutrition 120, 269–282 (2018).
H. P. Shi, D. Most, D. T. Efron, M. B. Witte, A. Barbul, Supplemental L-arginine enhances wound healing in diabetic rats. Wound Repair and Regeneration 11, 198–203 (2003).
X. J. Zhang, D. L. Chinkes, R. R. Wolfe, The anabolic effect of arginine on proteins in skin wound and muscle is independent of nitric oxide production. Clinical Nutrition 27, 649–656 (2008).
D. M. Hougaard, L. I. Larsson, Polyamines, molecules necessary for cell division, colocalize with peptide growth factors. European journal of cell biology 48, 14–18 (1989).
X. Ma et al., L-Arginine promotes protein synthesis and cell growth in brown adipocyte precursor cells via the mTOR signal pathway. Amino Acids 49, 957–964 (2017).
M. C. Ren et al., Dietary arginine requirement of juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 414, 229–234 (2013).
Y. R. Yue et al., Effects of dietary arginine on growth performance, feed utilization, haematological parameters and non-specific immune responses of juvenile Nile tilapia (Oreochromis niloticus L.). Aquaculture Research 46, 1801–1809 (2015).
Q. C. Zhou et al., Dietary arginine requirement of juvenile yellow grouper Epinephelus awoara. Aquaculture 350, 175–182 (2012).
X. J. Chen et al., Screening of stable internal reference genes by quantitative real-time PCR in humpback grouper Cromileptes altivelis. Journal of Oceanology and Limnology 39, 1985–1999 (2021).
H. Fei et al., Transcriptome and 16S rRNA analysis revealed the response of largemouth bass (Micropterus salmoides) to Rhabdovirus infection. Frontiers in Immunology 13, (2022).
W. Mu et al., The optimal arginine requirement in diets for juvenile humpback grouper, Cromileptes altivelis. Aquaculture 514, (2020).
S. M. Hoseini, M. A. Khan, M. Yousefi, B. Costas, Roles of arginine in fish nutrition and health: insights for future researches. Reviews in Aquaculture 12, 2091–2108 (2020).
H. Ban et al., Arginine and leucine regulate p70 S6 kinase and 4E-BP1 in intestinal epithelial cells. International Journal of Molecular Medicine 13, 537–543 (2004).
A. E. Pegg, P. P. McCann, Polyamine metabolism and function. The American journal of physiology 243, C212-221 (1982).
R. C. Henrikson, A. G. Matoltsy, The fine structure of teleost epidermis. 1. Introduction and filament-containing cells. Journal of ultrastructure research 21, 194–212 (1967).
J. W. Hawkes, The structure of fish skin. I. General organization. Cell and tissue research 149, 147–158 (1974).
R. C. Henrikson, A. G. Matoltsy, The fine structure of teleost epidermis. II. Mucous cells. Journal of ultrastructure research 21, 213–221 (1967).
R. N. Butler et al., Pentose phosphate pathway in rat colonic epithelium. Biochemistry international 22, 249–260 (1990).
W. N. Tian et al., Importance of glucose-6-phosphate dehydrogenase activity for cell growth. The Journal of biological chemistry 273, 10609–10617 (1998).
M. Deponte, Glutathione catalysis and the reaction mechanisms of glutathione-dependent enzymes. Biochimica Et Biophysica Acta-General Subjects 1830, 3217–3266 (2013).
S. W. Xie et al., Dietary Supplementation of Astaxanthin Improved the Growth Performance, Antioxidant Ability and Immune Response of Juvenile Largemouth Bass (Micropterus salmoides) Fed High-Fat Diet. Marine Drugs 18, (2020).
M. Pazos, M. J. Gonzalez, J. L. Gallardo, J. L. Torres, I. Medina, Preservation of the endogenous antioxidant system of fish muscle by grape polyphenols during frozen storage. European Food Research and Technology 220, 514–519 (2005).
B. Wang et al., Jian carp (Cyprinus carpio var. Jian) intestinal immune responses, antioxidant status and tight junction protein mRNA expression are modulated via Nrf2 and PKC in response to dietary arginine deficiency. Fish & Shellfish Immunology 51, 116–124 (2016).
B. Wang et al., Effects of dietary arginine supplementation on growth performance, flesh quality, muscle antioxidant capacity and antioxidant-related signalling molecule expression in young grass carp (Ctenopharyngodon idella). Food Chemistry 167, 91–99 (2015).
R. J. Hao et al., Integrated analysis of the role of miRNA-mRNA in determining different body colors of leopard coral grouper (Plectropomus leopardus). Aquaculture 548, (2022).
T. Maoka, W. Sato, H. Nagai, T. Takahashi, Carotenoids of Red, Brown, and Black Specimens of Plectropomus leopardus, the Coral Trout (Suziara in Japanese). Journal of Oleo Science 66, 579–584 (2017).
F. Li et al., Effects of dietary supplementation with algal astaxanthin on growth, pigmentation, and antioxidant capacity of the blood parrot (Cichlasoma citrinellum x Cichlasoma synspilum). Journal of Oceanology and Limnology 36, 1851–1859 (2018).
X. L. Song et al., Dietary astaxanthin improved the body pigmentation and antioxidant function, but not the growth of discus fish (Symphysodon spp.). Aquaculture Research 48, 1359–1367 (2017).
J.-N. Huang et al., Astaxanthin mitigates oxidative stress caused by microplastics at the expense of reduced skin pigmentation in discus fish. The Science of the total environment 874, 162494 (2023).
Z. Xu et al., Teleost skin, an ancient mucosal surface that elicits gut-like immune responses. Proceedings of the National Academy of Sciences of the United States of America 110, 13097–13102 (2013).
Z. C. Chen et al., Dietary arginine supplementation mitigates the soybean meal induced enteropathy in juvenile turbot, Scophthalmus maximus L. Aquaculture Research 49, 1535–1545 (2018).
X. Cui, Master Degree, Guangdong Ocean University, (2020).
Z. Luo, Y. J. Liu, K. S. Mai, L. X. Tian, Advance of researches on Arg requirement for fish; a review. Journal of Fisheries of China, 450–459 (2004).
I. Salinas, The Mucosal Immune System of Teleost Fish. Biology 4, 525–539 (2015).
Z. Xu et al., Mucosal immunoglobulins at respiratory surfaces mark an ancient association that predates the emergence of tetrapods. Nature Communications 7, (2016).
Y. Mizutani, S. Mitsutake, K. Tsuji, A. Kihara, Y. Igarashi, Ceramide biosynthesis in keratinocyte and its role in skin function. Biochimie 91, 784–790 (2009).
C. Pohlenz et al., Synergies between vaccination and dietary arginine and glutamine supplementation improve the immune response of channel catfish against Edwardsiella ictaluri. Fish & Shellfish Immunology 33, 543–551 (2012).
Y. B. Shen et al., Dietary Arginine Requirement of Juvenile Rockfish (Sebastes schlegelii). Progress in Fishery Sciences 43, 33–44 (2022).
Z. Y. Cheng, A. Buentello, D. M. Gatlin, Effects of dietary arginine and glutamine on growth performance, immune responses and intestinal structure of red drum, Sciaenops ocellatus. Aquaculture 319, 247–252 (2011).
H. Z. Lin et al., Effect of dietary arginine levels on the growth performance, feed utilization, non-specific immune response and disease resistance of juvenile golden pompano Trachinotus ovatus. Aquaculture 437, 382–389 (2015).
L. Y. Zhu, L. Nie, G. Zhu, L. X. Xiang, J. Z. Shao, Advances in research of fish immune-relevant genes: A comparative overview of innate and adaptive immunity in teleosts. Developmental and Comparative Immunology 39, 39–62 (2013).
C. Pohlenz, A. Buentello, W. Mwangi, D. M. Gatlin, Arginine and glutamine supplementation to culture media improves the performance of various channel catfish immune cells. Fish & Shellfish Immunology 32, 762–768 (2012).

No competing interests reported.

L-arginine, matters for skin health of leopard coral grouper (Plectropomus leopardus)

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods