Molecular characterization and drug susceptibility of Acinetobacter baumannii infection in children from a third-level hospital in Mexico

doi:10.21203/rs.3.rs-2754541/v1

Objectives

Acinetobacter spp. has become a threat public health threat due to the high prevalence of multidrug-resistant strains. There is limited information on the clinical and molecular features of carbapenem-resistant A. baumannii (CRAB) infections in children. Our study aimed to describe the clinical and molecular characteristics of CRAB infections among pediatric patients at a tertiary center in Mexico.

Methods

Consecutive cases of CRAB infections were recorded between 2017–2022. Clinical and demographic data were collected from clinical records. Identification of the strains was carried out through mass spectrometry. Confirmation of A. baumannii strains was done using a PCR method based on gyrB sequence. Additionally, PCR was used to detect the presence of carbapenemase-encoding resistance genes.

Results

49 CRAB infections were reported, 69.3% (n = 34) female. 44.8% (n = 22) were neonates. The median hospital length of stay was 32 days (interquartile range [IQR], 19–60). 48.9% of the isolates were recovered from bronchial secretions. Most of the antibiotic groups exhibited a co-resistance rate exceeding 40%. All carbapenem-resistant strains carried bla_OXA−51, and bla_OXA−24 genes. Bla_IMP genes were detected in half of the cases, with all strains co-harboring bla_OXA−24 genes.

Conclusion

The study showed a high prevalence of CRAB infections in neonates, along with a high prevalence of co-resistance to antibiotics, and a high rate of isolates carrying bla_OXA-24, and bla_IMP genes. CRAB poses a major threat due to the mortality rate and limited therapeutic options, it is imperative to urgently halt the propagation of carbapenem-resistant Acinetobacter baumannii.

A. baumannii

Carbapenem-resistant

oxacillinase

neonatal intensive care

There are over 50 species in the Acinetobacter genus, with Acinetobacter baumannii being a top-priority pathogen according to the World Health Organization [1]. This microorganism is often responsible for healthcare-associated infections such as ventilator-associated pneumonia, urinary tract infections, and sepsis. Its impact is particularly significant in intensive care units, where it can lead to higher mortality rates [2].

Carbapenem-resistant A. baumannii (CRAB) is a global threat, as carbapenem antibiotics are a crucial resource for treating this pathogen [3]. While all strains of A. baumannii have a chromosomally-encoded OXA-beta-lactamase, they can also acquire other carbapenemases.

Despite previous studies on the emergence of CRAB, there is limited information regarding its impact on children [4, 5]. Our study aimed to address this gap in knowledge by analyzing the clinical characteristics and molecular epidemiology of carbapenem-resistant A. baumannii infections in children treated at a tertiary care center in Mexico.

Between January 2017 and December 2022, 49 A. baumannii isolates were obtained through active surveillance from children hospitalized at Hospital Universitario “Dr. José Eleuterio González”, a tertiary care facility in Monterrey, Mexico. All strains satisfied the laboratory´s requirements for a significant pathogen and were deemed responsible for hospital-acquired infection. Demographic and clinical characteristics data were obtained from clinical records.

The strains were primarily isolated on blood agar and were identified in the Central Clinical Laboratory at our institution by matrix-assisted laser desorption/ionization time-of-flight (Bruke Biotyper Microflex LT/SH MALDI-MS System). A multiplex polymerase chain reaction with a gyrB sequence was used to distinguish A. baumannii from other Acinetobacter calcoaceticus-baumannii complex strains [6].

Antimicrobial susceptibility testing was performed in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines [7]. with colistin susceptibility was determined through broth microdilution. MicroScan Walkaway was used to assess antibiotic susceptibility to piperacillin-tazobactam, ampicillin-sulbactam, ceftazidime, cefepime, imipenem, meropenem, tigecycline, colistin, amikacin, gentamicin, ciprofloxacin, and trimethoprim-sulfamethoxazole. The drug-resistant phenotype profiles of the strains were categorized following the standard definition for acquiring resistance proposed by Magiorakos et al [8].

All carbapenem-resistant isolates underwent testing for nine carbapenemase encoding genes; one class A carbapenemase (bla_KPC), four class B carbapenemase (bla_IMP, bla_VIM, bla_NDM, and bla_SIM series), and three class D carbapenemase (bla_OXA-51, bla_OXA-23, bla_OXA-24, and bla_OXA-58), as shown Table 1 [9].

Table 1

Primer sequences of the target genes.
Gene	Primer sequence (5´ → 3´)	Size (bp)	Ref
IMP	F: ATGAGCAAGTTATCTGTATTCTTTAT R: TTAGTTGCTTAGTTTTGATGGTTT	390	13
KPC	F: TCGCCGTCTAGTTCTGCTGTCCT R: CCGCGCAGACTCCTAGCCTAA	965	13
NDM-1	F: TCACCGAGATTGCCGAGCGA R: GGGCAGTCGCTTCCAACGGT	457	13
VIM	F: GGTCGCATATCGCAACGCAGT R: CGGCGACTGAGCGATTTTTG	188	13
IMI	F: CCATTTCACCCATCACAAC R: CTACCGCATAATCATTTGC	440	13
SPM	F: CTGCTTGGATTCATGGGCGC R: CCTTTTCCGCGACCTTGATC	271	13
OXA-51	F: TCCAAATCACAGCGCTTCAAAA R: TGAGGCTGAACAACCCATCCA	353	13
OXA-23	F: ACTTGCTATGTGGTTGCTTCTTCTT R: TTCAGCTGTTTTAATGATTTCATCA	501	13
OXA-24	F: CAGTGCATGTTCATCTATT R: TCTAAGTTGAGCGAAAAG	246	13
OXA-58	F: AAGTATTGGGGCTTGTGCTG R: CCCCTCTGCGCTCTACATAC	599	13

Statistical analyses were performed using R software (V 4.2.2) (https://www.r-project.org/). This study was approved by the Institutional Ethics Committee under the code PE2100010.

49 cases of A. baumannii infections were reported, with 69.3% (n = 34) females. The most prevalent age group was ≤ 1 month (44.8%, n = 22). The hospital length of stay had a median of 32 days (interquartile range [IQR], 19, 60), while the intensive care unit length of stay had a median of 18 days (interquartile range [IQR], 11, 34). Cases were mostly documented in intensive care units (95.9%, n = 47). The overall case fatality rate was 36.7% (n = 18), with half of the deaths occurring in neonates (Table 2).

Table 2

Epidemiological characteristics of *A. baumannii* infections.
	No. (%)
Age groups ≤ 1 month > 12 years > 6 year ≤ 12 years > 1 month ≤ 2 years > 2 year ≤ 6 years Female Male Overall case fatality rate Neonatal case fatality rate	26 (53%) 14 (28.5%) 5 (10.2%) 4 (8.2%) 0 (0%) 34 (69.3%) 15 (30.6%) 8 (38%) 5 (24%)
Median hospital length of stay Hospital length of stay Intensive care unit length of stay	Days (IQR) 32 (19–60) 18 (11–34)
Sample Respiratory tract specimen Blood culture Wound	24 (48.9%) 22 (44.4%) 3 (6.1%)
Diagnostics Ventilator-associated pneumonia Catheter-related blood stream infection Primary bacteriemia Skin and soft tissue infection	24 (48.9%) 12 (24.4%) 10 (20.4%) 3 (6.1%)

Isolates were recovered from respiratory samples (48.9%, n = 24), followed by blood (44.4%, n = 22). The two most common infections were ventilator-associated pneumonia (48.9%, n = 24) with a median of 16 ventilator days (interquartile range [IQR], 8, 26) at the time of diagnosis, and catheter-related bloodstream infections (24.4%, n = 12), and a median of 18 days (interquartile range [IQR], 10, 26), (Table 2).

The prevalence of carbapenem resistance was 81.6% (n = 40). High co-resistance rates were observed for ceftazidime (77.5%, n = 38), cefepime (77.5%, n = 38), amikacin (73.4%, n = 36), ciprofloxacin (73.4%, n = 36), gentamicin (71.4%, n = 35), ampicillin/sulbactam (59.1%, n = 29), and trimethoprim/sulfamethoxazole (40.8%, n = 20). Moderate resistance rates were observed for, tigecycline (38.7%, n = 19), and piperacillin/tazobactam (28.5%, n = 14). 2 isolates (4%) were resistant to colistin. According to the criteria of Magiorakos et al ¹², 48.9% (n = 24) of strains were multidrug-resistant (MDR), 26.5% (n = 13) were extremely-drug resistant and 4% (n = 2) were pan-drug-resistant.

Regarding the carbapenemase genes, all isolates carried bla_OXA−51. Bla_OXA−24 gene was detected in 92% (n = 45) of isolated. Class B carbapenemase genes, bla_IMP and bla_SPM were detected in 49% (n = 12) and 2% (n = 1) respectively. Interestingly, all strains carried bla_IMP, co-harboring gene bla_OXA−24. The antimicrobial resistance genes bla_OXA−23, bla_OXA−58, bla_KPC, bla_VIM, bla_NDM, and bla_IMI, were not detected in any of the isolates (see Table 3).

Table 3

Carbapenemase resistance genes and phenotype profile of A. baumannii isolates.
Carbapenemase genes	N. = 49 (%)
Class D carbapenemase bla_OXA−51 bla_OXA−24 bla_OXA−23 bla_OXA−58 Clase B carbapenemase bla_IMP bla_SPM bla_VIM bla_KPC bla_NDM bla_IMI Co-harboring genes bla_OXA−24 + bla_IMP	49 (100%) 49 (100%) 46 (92%) 0 (0%) 0 (0%) 25 (51%) 24 (48%) 1 (2%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 24 (48.9%)
Phenotype profile MDR XDR PDR	24 (48.9%) 13 (26.5%) 2 (4%)
^a multi-drug resistant; ^b extremely-drug resistant; ^c pan-drug resistant

A. baumannii is one of the main causative agents of healthcare-associated infections worldwide [10]. Currently, the information regarding the clinical and molecular characterization of carbapenem-resistant A. baumannii infections in the pediatric population is scarce [11, 12]. A high prevalence of the neonatal population (44.8%) was described in our study, with ventilator-associated pneumonia being most frequent type of infection (48.9%), and a high rate of MDR-resistant isolates (48.9%). Interestingly, A. baumannii isolates co-harboring bla_OXA−24, and bla_IMP genes were detected in 48% of cases.

The issue of CRAB infections in neonates has primarily been studied in the context of outbreaks in intensive care units, and there is limited information available regarding active epidemiological surveillance. In our study, the neonatal population had the highest incidence of infections, accounting for 62% of cases. The case fatality rate was 36.7%, although half of the deaths were reported in neonates. This mortality is similar to that observed in previous outbreaks in neonatal intensive care units, which ranged from 30.8%-42.9% [13].

The prevalence of CRAB poses a significant threat to public health, as per the data published by the European Center for Disease Prevention and Control for the 2020–2021 period, which showed a sharp increase of 121% in CRAB infections [14]. A recent study in Turkey on children demonstrated a rise in the prevalence of CRAB from 95–100% between 2015 and 2016. In all cases, co-resistance to cephalosporins and quinolones was observed, while 3.8% of the cases documented the emergence of colistin resistance [15]. In the United States, the proportion of CRAB in children escalated from 0.6% in 1999 to 6.1% in 2012 [16]. Similarly, in Latin America, a study conducted in Bolivia reported a high incidence of CRAB (90%) with a co-resistance of over 80% for all groups of antibiotics [17].

There is limited information available on the epidemiology of A. baumannii in Mexico. A multicenter study conducted in the adult population reported a prevalence of carbapenem resistance of more than 80%, with an alarming increase in co-resistance to cefepime (83.6%) [18]. Another study showed a significant increase in A. baumannii cases in intensive care units from 18 cases in 1999 to over 500 in 2010. This was accompanied by a decrease in carbapenem susceptibility from 91.7–11.8% [4]. In the pediatric population, a study of 54 cases reported a prevalence of carbapenem resistance of 21%, and co-resistance to amikacin, and trimethoprim/sulfamethoxazole of 29% and 33% respectively [12]. In comparison to these reports, our populations exhibit similar rates of co-resistance to most of the groups of antibiotics, with a colistin resistance of 4%.

Class D carbapenemases genes corresponding to oxacillinases are highly prevalent within Acinetobacter species. These genes are categorized into six groups: bla_{OXA−51−like}, bla_{OXA−23−like}, bla_{OXA−24/40−like}, bla_{OXA−58−like}, bla_{OXA−143−like} and bla_{OXA−235−like}. Among these groups, the presence of bla_OXA−51 is naturally present in A. baumannii strains. The distribution of the different types of oxacillinases differs by region. In Europe, a multinational study showed an endemic prevalence of bla_OXA−23 and bla_OXA−72 [19]. In Brazil, bla_OXA−23 accounts 51.2–97.9% of isolates, in comparison to 64.4% in Argentina [20–22]. In Mexico, a multicenter study conducted on the adult population described a prevalence of bla_OXA−40, and bla_OXA−23 of 60.4%, and 23.2%, respectively. Other national studies report a high prevalence of bla_OXA−72 (49.6%), and bla_OXA−58 (28.3%) [23, 24].

There is a lack of information regarding the molecular characterization of CRAB infections in children (25–26). Chen et al. (9) reported that bla_OXA−23 was present in 90.7% of cases, followed by bla_OXA−24 (23.3%), and bla_OXA−58 (22.1%). In Turkey, bla_OXA−23 (31%) and bla_OXA−58 (11%) were the most prevalent carbapenemase genes [25]. In Bolivia, the presence of bla_OXA−23 was detected in all CRAB cases in children [17], while in Mexico, bla_OXA−23 was identified in all cases in a study of five patients in Puebla, and in 51.13% of cases in another study from Mexico City, along with bla_OXA−24 (4.54%), and bla_OXA−58 (2.27%) [27, 28]. Notably, co-harboring genes were not observed in these studies. Our study found that 92% of CRAB cases carried bla_OXA−24, while bla_OXA−23, and bla_OXA−58 were not detected. This highlights the importance of increasing epidemiological reports on the molecular characterization of CRAB in children, especially considering regional variations within the same country.

The occurrence of class B carbapenemases genes in A. baumannii is relatively low, as noted in previous studies [29, 30]. Lukovic et al. [29] reported a prevalence of bla_NDM of 3%. In another study, bla_NDM was reported as the sole carbapenemase gene in 22% of CRAB cases, while co-harboring with class D carbapenemase genes, bla_OXA−24, and bla_OXA−58, was identified in 6% and 3% of cases, respectively. Although bla_IMP−1 was not detected alone, it was co-detected with bla_OXA−58 and bla_OXA−23 in 7% and 2% of cases, respectively. In Mexico, Alcántar-Curiel et al [24] reported a high prevalence of 78.3% A. baumannii with the class B phenotype, but only 1.2% were identified with bla_VIM−1, while the remaining cases were linked to class D carbapenemases. In contrast, our study showed a high prevalence of bla_IMP (48%); however, all bla_IMP genes were co-detected with bla_OXA−24. Our study highlights the first occurrence of co-detection of class B and D carbapenemase genes in children from Latin America and reports the highest prevalence of carbapenemase class B genes in this population.

There were some limitations of our study, including a lack of additional sequence data for carbapenemase genes and the inclusion of cases from only one medical center. Nevertheless, our study findings highlight the high incidence of CRAB infections in newborns, and a high rate of CRAB carried bla_OXA-24, and bla_IMP. Given the high mortality rate associated with CRAB and the limited treatment options available, it is imperative that antimicrobial stewardship programs be implemented to curb the spread of carbapenem-resistant Acinetobacter baumannii.

CRAB

Carbapenem- resistant Acinetobacter baumanii

MDR

Multidrug-resistant

Ethical approval: This study was approved by the Institutional Ethics Committee under the code PE2100010. Verbal informed consent was obtained from the patient's parents to obtain clinical data from the clinical record.

Competing interests: The authors declare that they have no competing interests.

Author Contributions: Conceptualization, JICB and AMS; methodology, RAS; validation, NCV; formal analysis, JLD and DVA; investigation, JICB and DVA; data curation, JICB; writing—original draft preparation, JICB; writing—review and editing, NCV; visualization, MOC; supervision, JLD; project administration, JICB. All authors have read and agreed to the published version of the manuscript.

Funding: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Availability of data and materials: All the material described in the manuscript will be freely available and can be requested from the corresponding author. Besides, the manuscript will be available within In Review plataform.

Acknowledgments: The authors thank the Department of Clinical Pathology of the University Hospital “Dr. Jose Eleuterio González” from the Universidad Autónoma de Nuevo León for the processing and identification of the isolates.

De Freitas LC. Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. Vol. 43, Geneva. 2013. p. 348–65.
Piperaki ET, Tzouvelekis LS, Miriagou V, Daikos GL. Carbapenem-resistant Acinetobacter baumannii: in pursuit of an effective treatment. Clin Microbiol Infect. 2019;25(8):951–7.
Morfin-Otero R, Alcántar-Curiel MD, Rocha MJ, Alpuche-Aranda CM, Santos-Preciado JI, Gayosso-Vázquez C, et al. Acinetobacter baumannii infections in a tertiary care Hospital in Mexico over the past 13 years. Chemotherapy. 2013;59(1):57–65.
Bocanegra-Ibarias P, Peña-López C, Camacho-Ortiz A, Llaca-Díaz J, Silva-Sánchez J, Barrios H, et al. Genetic characterisation of drug resistance and clonal dynamics of Acinetobacter baumannii in a hospital setting in Mexico. Int J Antimicrob Agents. 2015;45(3):309–13.
Mancilla-Rojano J, Ochoa SA, Reyes-Grajeda JP, Flores V, Medina-Contreras O, Espinosa-Mazariego K, et al. Molecular Epidemiology of Acinetobacter calcoaceticus-Acinetobacter baumannii Complex Isolated From Children at the Hospital Infantil de México Federico Gómez. Front Microbiol. 2020;11(October):1–15.
Higgins PG, Wisplinghoff H, Krut O, Seifert H. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clin Microbiol Infect. 2007 Dec;13(12):1199-201.
Wayne P. CLSI. Performance standars for antimicrobial susceptibility testing. 30th ed. Clinical and Laboratory Institute; 2020.
Magiorakos A, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria : an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2011;18:268–81.
Chen Y, Ai L, Guo P, Huang H, Wu Z, Liang X, et al. Molecular characterization of multidrug resistant strains of Acinetobacter baumannii isolated from pediatric intensive care unit in a Chinese tertiary hospital. BMC Infect Dis. 2018;18(1):1–7.
Lukić-Grlić A, Kos M, ŽiŽek M, Luxner J, Grisold A, Zarfel G, et al. Emergence of Carbapenem-Hydrolyzing Oxacillinases in Acinetobacter baumannii in Children from Croatia. Chemotherapy. 2020;64(4):167–72.
Bello-López E et al. Antibiotic resistance mechanisms in Acinetobacter spp. isolated from patients in a pediatric hospital in Mexico. J of Glob Antimicrob Resist. 2020; 23: 120-129.
McGrath EJ et al. An outbreak of carbapenem-resistant Acinetobacter baumanii infection in a neonatal intensive care unit: investigation and control. Infect Control Hosp Epidemiol. 2011; 32(1): 34-41.
Gajic I et al. Clinical and molecular characteristics of OXA-72-producing Acinetobacter baumanii ST636 outbreak at a neonatal intensive care unit in Serbia. J Hosp Infect. 2021; 11: 54-60.
European Centre for Disease Prevention and Control. Antimicrobial resistance in the EU/EEA (EARS-Net) - Annual Epidemiological Report 2021. Stockholm: ECDC; 2022.
Konca C, Tekin M, Geyik M. Susceptibility patterns of multidrug-resistant Acinetobacter baumanii. The Indian Journal of Pediatrics. 2021; 88 (2): 120-126.
Logan L, Gandra S, Trett A, Weinstein R, Laxminarayan R. Acinetobacter baumannii resistance trends in children in the United States, 1999-2012. J Pediatric Infect Dise Soc. 2019; 8 (2): 136-142.
Cerezales M et al. High prevalence of extensively drug-resistant Acinetobacter baumanii at a Children Hospital in Bolivia. Pediatr Infect Dis J. 2018; 37 (11): 1118-23.
Garza-González E et al. The evolution of antimicrobial resistance in Mexico during the last decade: results from the INVIFAR Group. Microbial Drug Resistance. 2020; 26 (11); 1372-82.
Goic-Barisic I et al. Endemicity of OXA-23 and OXA-72 in clinical isolates of Acinetobacter baumannii from three neighbouring countries in Southeast Europe. Journal of Applied Genetics. 2021; 62: 353-59.
Cordeiro Neves F et al. Clinical and microbiological characteristics of OXA-23- and OXA-143-producing Acinetobacter baumannii in ICU patients at a teaching hospital, Brazil. Braz J Infect Dis. 2016; 20 (6): 556-63.
Romanin P et al. Multidrug- and Extensively Drug-Resistant Acinetobacter baumannii in a Tertiary Hospital from Brazil: The Importance of Carbapenemase Encoding Genes and Epidemic Clonal Complexes in a 10-Year Study. Microbial Drug Resistance. 2019; 25 (9): 1365-73.
Merkier AK, Catalano M, Ramirez MS, Quiroga C, Orman B, Ratier L, Famiglietti A, Vay C, Di Martino A, Kaufman S, Centrón D. Polyclonal spread of blaOXA-23 and blaOXA-58 in Acinetobacter baumannii isolates from Argentina. J Infect Dev Ctries. 2008; 2:235–240.
Bocanenegra-Ibarias P, et al. Genetic characterisation of drug resistance and clonal dynamics of Acinetobacter baumannii in a hospital setting in Mexico. Int J Antimicrob Agents. 2015; 45 (3): 309-13.
Alcántar-Curiel MD, García-Torres LF, González-Chávez MI, Morfín-Otero R, Gayosso-Vázquez C, Jarillo-Quijada MD, et al. Molecular Mechanisms Associated with Nosocomial Carbapenem-resistant Acinetobacter baumannii in Mexico. Arch Med Res. 2014;45(7):553–60.
Karaaslan A, Soysal A, Gelmez A, Kepenekli E, Söyletir G, Bakir M. Molecular characterization and risk factors for carbapenem-resistant Gram-negative bacilli colonization in children: emergence of NDM-producing Acinetobacter baumannii in a newborn intensive care unit in Turkey. Journal of Hospital Infection. 2015; 92 (1): 67-72.
Hu Z, Wang Z, Liu D, Chen P, Wang H, Chen Y, et al. Clinical and molecular microbiological characteristics of carbapenem-resistant Acinetobacter baumannii strains in an NICU. Pediatr Int. 2011;53(6):867–72.
Bello-López E, Castro-Jaimes S, Cevallos MÁ, Rocha-Gracia RDC, Castañeda-Lucio M, Sáenz Y, et al. Resistome and a Novel blaNDM-1-Harboring Plasmid of an Acinetobacter haemolyticus Strain from a Children’s Hospital in Puebla, Mexico. Microb Drug Resist. 2019;25(7):1023–31.
Mancilla-Rojano J, Ochoa SA, Reyes-Grajeda JP, Flores V, Medina-Contreras O, Espinosa-Mazariego K, Parra-Ortega I, Rosa-Zamboni DDL, Castellanos-Cruz MdC, Arellano-Galindo J, Cevallos MA, Hernández-Castro R, Xicohtencatl-Cortes J and Cruz-Córdova A. Molecular Epidemiology of Acinetobacter calcoaceticus-Acinetobacter baumannii Complex Isolated From Children at the Hospital Infantil de México Federico Gómez. Front Microbiol. 2020; 11: 576673.
Lukovic B et al. The first nationwide multicenter study of Acinetobacter baumannii recovered in Serbia: emergence of OXA-72, OXA-23 and NDM-1-producing isolates. Antimicrobial Resistance and Infection Control. 2020; 9: 101.
Kostyanev T. Phenotypic and molecular characterizations of carbapenem-resistant Acinetobacter baumannii isolates collected within the EURECA study. Int J Antimicrob Agents. 2021; 57 (6): 106345.

No competing interests reported.

Molecular characterization and drug susceptibility of Acinetobacter baumannii infection in children from a third-level hospital in Mexico

Status:

Version 1

Abstract

Objectives

Methods

Results

Conclusion

Background

Methods

Results

Discussion

Conclusions

List Of Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1