CRISPR/Cas9-mediated Targeted Mutagenesis in Japanese Cedar (Cryptomeria japonica D. Don)

doi:10.21203/rs.3.rs-275612/v1

Download PDF

Research Article

CRISPR/Cas9-mediated Targeted Mutagenesis in Japanese Cedar (Cryptomeria japonica D. Don)

https://doi.org/10.21203/rs.3.rs-275612/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Aug, 2021

Read the published version in Scientific Reports →

You are reading this latest preprint version

Cryptomeria japonica (Japanese cedar or sugi) is one of the most important coniferous tree species in Japan and breeding programs for this species have been launched since 1950s. Genome editing technology can be used to shorten the breeding period. In this study, we performed targeted mutagenesis using the CRISPR/Cas9 system in C. japonica. First, the CRISPR/Cas9 system was tested using green fluorescent protein (GFP)-expressing transgenic embryogenic tissue lines. Knock-out efficiency of GFP ranged from 3.1–41.4% depending on U6 promoters and target sequences. The GFP knock-out region was mottled in many lines, indicating genome editing in individual cells. However, in 102 of 103 mutated individuals (> 99%) from 6 GFP knock-out lines, embryos had a single mutation pattern. Next, we knocked out endogenous C. japonica magnesium chelatase subunit I (CjChlI) using two guide RNA targets. Green, pale green, and albino phenotypes were obtained in genome-edited cell lines. Sequence analysis revealed random deletions, insertions, and replacements in the target region. Thus, targeted mutagenesis using the CRISPR/Cas9 system can be used to modify the C. japonica genome.

Plant Physiology and Morphology

Plant Molecular Biology and Genetics

Cryptomeria japonica

tree species

breeding programs

Genome editing technology

Cryptomeria japonica D. Don (Japanese cedar or sugi) is an evergreen conifer, which belongs to the cypress family (Cupressaceae) and is distributed across Japan. Outside Japan, C. japonica var. sinensis (formerly C. fortunei) is thought to be naturally distributed in southeast China¹. C. japonica is a commercially important tree in Japan and has been used since ancient times as timber and to produce household items, etc. because of its high productivity and utility. C. japonica cultivation began more than 500 years ago in some areas of Japan². A breeding program has been in progress since 1950s for screening plus trees; thus far, more than 3,500 plus C. japonica tree clones have been selected³. C. japonica was extensively planted after WWII because of the government's efforts to restore devastated forests. Consequently, C. japonica comprises 44% of the planted forest area in Japan, which covers approximately 11% of the land in Japan⁴. C. japonica pollinosis has become a severe public health problem in Japan due to the widespread distribution of C. japonica pollen⁵. Development of “male-sterile” C. japonica trees is a breeding target in Japan. Studies for identifying genes involved in pollen development are underway^6,7. Four male-sterility loci, namely MS1, MS2, MS3, and MS4, have been identified from 23 male-sterile C. japonica lines⁸, and Hasegawa et al. elucidated a causative male-sterile gene at the MS1 locus⁹. Additionally, SNP markers for distinguishing MS1-derived male-sterile plants have been developed¹⁰. Recently, an efficient technique for producing male-sterile C. japonica plants using somatic embryogenesis was reported¹¹.

To obtain the desired trait through gene modification in a short time, programmable nuclease-mediated targeted mutagenesis is the option of choice and several methods, such as zinc-finger nuclease (ZNF), transcription activator-like effector nuclease (TALEN), and clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 system (CRISPR/Cas9), have been developed. The use of CRISPR/Cas9 system, first reported in 2012¹², has exploded because of its efficiency and simplicity, and has been applied to at least 45 plant genera¹³. The CRSIPR/Cas9 system has been improved by expanding the targeting range of Cas9^14,15 and developing smaller Cas proteins^16,17. In addition, genome editing systems based on the CRISPR/Cas9 system without involving double-strand breaks, such as base editing^18,19 and prime editing²⁰ have been reported. Among woody plants, CRISPR/Cas9-mediated targeted mutagenesis in Populus, which is a model woody species, was first reported in 2015^21,22. However, the use of genome editing in conifers remains unexplored.

In this study, we demonstrated CRISPR/Cas9-mediated targeted mutagenesis in C. japonica through Agrobacterium-mediated transformation. First, we targeted the exogenous green fluorescent protein (GFP) gene, which was introduced into the cell mass of embryonic tissue, after examining various promoters to construct an efficient targeted mutagenesis system in C. japonica. Targeted GFP knock-out was observed in transgenic lines at a constant rate with the CRISPR/Cas9 expression vectors. Then, as a case study, we disrupted the endogenous magnesium chelatase subunit I (CjChlI) gene using a modified vector and obtained biallelic mutant lines. Thus, the CRISPR/Cas9 system is efficient in C. japonica. We discuss future perspectives in genome editing in conifers.

Plant material

An embryogenic tissue (ET) cell line #13-8-12 was initiated using megagametophyte explants of C. japonica²³. The ET was maintained in the dark at 25 °C in solid 1/2MD medium²⁴ and subcultured on fresh media after a 2-week interval.

Vector construction

The GFP expression vector pZmUbi-GFP-Dt (Fig. 1a) was constructed based on pUbiP-sGFP/HygR²³. The NPTII expression cassette was removed from pUbiP-sGFP/HygR using PmeI and ClaI followed by blunting with the KOD Plus polymerase (Toyobo, Osaka, Japan) and self-ligation using T4 DNA ligase (New England Biolabs, Ipswich, MA). The heat shock protein terminator from Arabidopsis thaliana²⁵ was inserted downstream of GFP using In-Fusion cloning (In-Fusion HD Cloning Kit, Takara Bio Inc., Shiga, Japan). pZK_FFCas9 (Fig. 1b) was constructed according to Mikami et al²⁶. Briefly, the PcUbi::SpCas9::PsBCB3At fragment from pDeCas9²⁷ and the OsAct1t::35S::NPTII::OsHSP17.3t fragment were cloned into pZK²⁸ using In-Fusion cloning. The gRNA expression cassette driven by the A. thaliana U6-26 promoter, derived from pEn-Chimera²⁷, was cloned into the multiple-cloning site of pUC19. To use the OsU6 promoter, pUC6gRNA²⁹ was used. U6 promoters from C. japonica were replaced with the OsU6 promoter in pUC6gRNA (described in Supplementary Information). All oligonucleotides used in this study are shown in Supplementary Table S1. Oligonucleotide pairs for target GFP sequences (p#84 and p#85 for target #1, p#86 and p#87 for target #2_rev, and p#88 and p#89 for target #3_rev) (Table 1, Supplementary Table S1) were annealed, and the resulting fragment was inserted into BbsI sites between the U6 promoter and gRNA scaffold sequence of the arbitrary gRNA expression cassette. The gRNA expression cassette was inserted into the I-SceI site between the right border and the ubiquitin promoter from Petroselinum crispum (PcUbi)³⁰ in pZK_FFCas9, resulting in the all-in-one CRISPR/Cas9 vector (Fig. 1b). For targeted mutagenesis of endogenous CjChlI, the modified CRISPR/Cas9 vector, namely pCRG-SpCas9 (Fig. 1c), was constructed. Briefly, the HSP terminator from A. thaliana and NOS terminator were tandemly inserted downstream of FFCas9. The gRNA expression cassette was inserted into the AscI site between the right border and PcUbi in the pCRG-SpCas9 vector through overlapping PCR³¹. The detailed method for vector construction is described in Supplementary Information.

Table 1

Target sequence of GFP
Target	Sequence (5'–3')	Reference
#1	GTGAACCGCATCGAGCTGAAGGG	Mali et al (2013)
#2_rev	CCTACGGCGTGCAGTGCTTCAGC	Jacobs et al (2015)
#3_rev	CCACCGGCAAGCTGCCCGTGCCC	Fu et al (2013)

Transformation of C. japonica

ET cell lines expressing GFP were generated through the Agrobacterium-mediated transformation of pZmUbi-GFP-Dt/HygR²⁴^,³². After screening with 5 mg/L hygromycin, lines with a strong GFP signal with a single-copy line (named N4) were selected through Southern blot analysis (Supplementary Fig. S1). The N4 line was transformed with pZK_FFCas9 vectors containing various gRNA expression cassettes. Transformed cell lines were selected on 1/2 MD medium containing 10 mg/L meropenem and 25 mg/L kanamycin. Transformed cell lines were maintained at 25 °C under dark. Somatic embryogenesis and germination were performed as described²⁴.

GFP visualization

After screening for 2–4 months in the selection medium, independent lines were isolated and considered a single event. GFP fluorescence of independent lines was evaluated using the MS FLIII fluorescence stereomicroscope (Leica microsystems, Wetzlar, Germany) with a GFP Plus filter system (excitation filter 480/40 nm, emission filter 510 nm). GFP signal was imaged using the DC300 F digital camera system (Leica microsystems).

Detection of mutations in genomic DNA

Genomic DNA was extracted from the cell mass, the aerial part, or the root using the DNAs-ici!-P kit (Rizo inc. Tsukuba, Japan) or “One-step method” according to the instructions of the KOD FX Neo kit (Toyobo, Osaka, Japan). Target regions were amplified using the KOD -Plus- Neo kit (Toyobo) or KOD FX neo kit (Toyobo). The GFP expression cassette was amplified using the p#113_f and p#49_r primer pair (Supplementary Table S1). PCR conditions were as follows: 94 °C for 2 min; 30–35 cycles at 98 °C for 10 s, 58 °C for 30 s, and 68 °C for 30 s; and final extension at 68 °C for 7 min. PCR products were sequenced directly using p#89_r for GFP target #1 and p#87_r for GFP target #2_rev and #3_rev. For cell lines with multiple indel patterns, PCR products were cloned into pCRII using the Zero-blunt PCR TOPO kit (Invitrogen, Waltham, Massachusetts). Sequence analysis was performed for each clone. To analyze mutation patterns of CjChlI-targeted mutagenesis individuals, a fragment containing the target sequence was amplified using primers p#468_f and p#648_r (Supplementary Table S1). PCR conditions were as follows: 94 °C for 2 min; 40 cycles at 98 °C for 10 s, 65 °C for 30 s, and 68 °C for 20 s; and final extension at 68 °C for 7 min. PCR products were cloned into pCRII using the Zero-blunt PCR TOPO kit, and then, sequenced using M13 forward or M13 reverse primers.

Southern blot analysis

Genomic DNA was isolated from ETs and young needles using Nucleon PhytoPure (Cytiva, Tokyo, Japan). DIG-labeled PCR probes were amplified using p#89_f and p#301_r primers for GFP and #466_f and #501_r primers for CjChlI (Supplementary Table S1), according to the manufacturer's instructions (PCR DIG Probe Synthesis Kit, Roche Diagnostics, Mannheim, Germany). Hybridized probes were detected using anti-Dioxigenin-AP (Roche Diagnostics) on an optical imaging system (Fusion Solo 4M, Vilber Lourmat, Marne la Vallee, France).

Heteroduplex mobility assay

A 215 bp fragment containing the target sites of CjChlI was amplified using primers p#468_f and p#469_r (Supplementary Table S1). PCR amplification was performed under the following conditions: 94 °C for 2 min; 40 cycles at 98 °C for 10 s, 65 °C for 30 s, and 68 °C for 20 s; and final extension at 68 °C for 7 min. To ensure full heteroduplex formation, a denaturation and re-annealing procedure was performed on the PCR products as follows: 95 °C for 5 min; 95 °C to 85 °C, ramping at −2 °C/s; and 85 °C to 25 °C at −0.1 °C. Reannealed products were analyzed using a microchip electrophoresis system (MCE-202 MultiNA, Shimazu, Kyoto, Japan) with the DNA-500 reagent kit (Shimazu).

Statistical analysis

Pairwise multiple comparison of proportions was performed using Tukey’s multiple comparison test conducted in R (https://www.R-project.org/). Significant results were assumed for P < 0.05.

Knock-out of a reporter GFP transgene using the CRISPR/Cas9 system with various U6 promoters

We tested the efficiency of the CRISPR/Cas9 system in C. japonica. To obtain an optimal promoter for driving the expression of SpCas9, we screened seven constitutive promoters (Supplementary Information) using the dual luciferase (LUC) transient expression assay. PcUbi was found to be the most active (Supplementary Fig. S2) in the ET of C. japonica and considered the optimal promoter for driving SpCas9 expression. Hereafter, PcUbi was used as the promoter for Cas9 (Fig. 1). Next, to screen for the optimum U6 promoter for gRNA expression, we isolated endogenous U6 promoters in C. japonica using TAIL-PCR³³ with specific primers corresponding to U6 snRNA consensus sequences and isolated 11 putative U6 promoter fragments (Supplementary Information). Sequence analysis of these fragments revealed that all had an upstream sequence element (USE) and TATA-like box sequence, which are typical characteristics of U6 promoters³⁴ (Supplementary Fig. S3). To test U6 promoter activity, the GFP-expressing ET line N4, which contains a single-copy transgene (Supplementary Fig. S1), was obtained and used for the CRISPR/Cas9-mediated GFP knock-out experiment. We selected target sites that have been reported^35–37 (Table 1). pZK_FFCas9 vectors containing the gRNA of GFP target #1 driven by 13 U6 promoters were introduced into N4, and 17–138 transgenic ET lines were obtained for each vector (Table 2) by screening in a medium with 25 mg/L kanamycin. Loss of GFP fluorescence lines were observed in 1–39 lines for each transformed line (Table 2). GFP fluorescence was lost in some lines completely, with others exhibiting GFP fluorescence in some areas of the cell mass (Fig. 2). By contrast, all transgenic lines with the Cas9 expression cassette alone (without the gRNA expression cassette) exhibited GFP fluorescence (Fig. 2, Table 2, Supplementary Fig. S4). GFP knock-out efficiency and number of lines isolated varied within U6 promoters (range, 3.1–37.9%) (Table 2). Target-dependent knock-out efficiency using the Arabidopsis U6 promoter (Table 3) was 41.4% and 31.2% using target #2_rev and target #3_rev, respectively, which were higher than that for target #1 (25.0%). Mutation patterns in each line were confirmed through sequencing (Fig. 3, Supplementary Fig. S5). Frequent modifications in all targets were single-nucleotide insertions. Additionally, single-nucleotide deletions were often observed in target #2_rev and target #3_rev. By contrast, large deletions, such as 15 bp deletions in target #1 and 33 bp deletion in target #3_rev, were the most frequent modifications. From the point onward, CjU6_#2 promoter was used for gRNA expression in C. japonica.

Table 2

Effect of U6 promoters on the efficiency of targeted mutagenesis of the GFP transgene
Target	U6 promoter	No. of transformed lines (A)	No. of GFP knock out lines^* (B)	Efficiency^†,‡ (%)
#1	–^§	63	0	0
	CjU6_#1	138	39	28.3^a
	CjU6_#2	134	33	24.6^a
	CjU6_#3	98	3	3.1^c
	CjU6_#4	29	11	37.9^a
	CjU6_#5	72	15	20.8^ab
	CjU6_#6	39	4	10.3^abc
	CjU6_#7	55	9	16.4^abc
	CjU6_#8	20	1	5.0^abc
	CjU6_#9	17	3	17.6^abc
	CjU6_#10	116	18	15.6^abc
	CjU6_#11	60	2	3.3^bc
	OsU6	50	12	24.0^ab
	AtU6-26	136	34	25.0^a
^*The number of calluses that completely lost GFP fluorescence or had GFP fluorescence in some parts of the cell mass was counted after 87 d of selective cultivation. ^†(B / A) × 100. ^‡Pairwise multiple comparison of proportions was performed using Tukey’s multiple comparison test. Proportions with significant difference were labeled with different letters (P < 0.05). ^§pZK_FFCas9 vector without gRNA expression cassette-introducing N4 transgenic lines (Negative control).

Table 3

Effect of target sequence on the efficiency of targeted mutagenesis of the GFP transgene
Target^*	No. of transformed lines (A)	No. of GFP-knock-out lines^† (B)	Mutation frequency (%)^‡	No. of lines having multiple mutation patterns^§ (C)	Mosaicism frequency (%)^¶
#1	136^※	34^※	25.0^{※, b}	15	44.1^c
#2_rev	70	29	41.4^a	17	58.6^c
#3_rev	77	24	31.2^ab	15	62.5^c
ET; embryogenic tissue. ^*pZK_FFCas9 vectors with gRNA expression cassettes driven by AtU6-26 promoter were transformed into ET. ^†The number of ET lines was counted after 87 d of selective cultivation. ^‡ (B / A) × 100. Pairwise multiple comparison of proportions was performed using Tukey’s multiple comparison test. Proportions with significant difference were labeled with different letters (P < 0.05). ^§The number of ET lines having multiple mutation patterns was counted. ^¶ (C / B) × 100. Pairwise multiple comparison of proportions was performed using Tukey’s multiple comparison test. Proportions with a significant difference were labeled with different letters (P < 0.05). ^※Data from Table 1.

Investigation of chimerism in the regenerated T0 plantlet

Loss of GFP fluorescence was frequently partial in many transformed lines (Fig. 2) and ranged from 44.1–62.5% depending on the target sequence (Table 3). This is because mutations occur independently in a single cell; therefore, a variety of mutations can be obtained from a single transgenic line³⁸. If the plantlet was derived from genomes of edited and non-edited cells, the plantlet may exhibit chimerism or mosaicism, such that the plantlet will have functional GFP in one portion and mutated non-functional GFP in the other portion. During the development of somatic cotyledonary embryos, GFP fluorescence clearly separated into positive or negative; based on our observations, no cotyledon exhibited chimeric GFP fluorescence (Fig. 4a–j). In a green germinating somatic embryo with active GFP, GFP fluorescence could hardly be observed due to strong chlorophyll autofluorescence; conversely, GFP fluorescence was observed in the callus at the base of the embryo (Fig. 4d, i). To investigate mosaicism in cotyledonary somatic embryos, sequencing analysis was performed using 8–30 cotyledonary embryos (139 from 6 lines). One cotyledonary embryo from line #47 − 2 had two modification patterns in one individual somatic embryo. However, in others, mutation patterns were clearly separated in individual cotyledonary embryos (Fig. 4k). Next, the stability of mutation patterns was analyzed in 10 plantlets regenerated through somatic embryogenesis in each of 4 lines, namely #42 − 2, #18, #31 − 2, and #11, by analyzing the sequence from multiple needle and root segments (Supplementary Fig. S6a). All plantlets regenerated from #31 − 2 and #11 lines had only one mutation pattern in all tissue segments. By contrast, in lines #42 − 2 and #18, plantlets with additional mutation(s) in root segments were observed (Supplementary Fig. S6b). No apparent mosaicism was detected in these tissues.

Targeted mutagenesis of an endogenous gene using the CRISPR/Cas9 system

We modified an endogenous C. japonica gene using CRISPR/Cas9. We selected ChlI, which is required for chlorophyll biosynthesis³⁹. ChlI mutants exhibit an albino phenotype⁴⁰. A 2,152 bp fragment corresponding to CjChlI was cloned (Accession no. LC603656) (Fig. 5a). Southern blot analysis suggested that CjChlI is a single gene (Fig. 5b). To introduce mutations in CjChlI, we designed two targeting sequences in exon 3 of CjChlI, named t1 and t2, respectively (Fig. 5a). Three binary vectors for disrupting CjChlI were constructed using the pCRG-SpCas9 vector (Fig. 5c, Supplementary Information). Transgenic lines were selected in a kanamycin-containing medium. Then, putative genome-edited lines were screened using the heteroduplex mobility assay (HMA) (Fig. 6a), leading to the selection of 7, 4, and 2 lines for t1, t2, and t1 + t2, respectively (Table 4). Transgenic plantlets were induced through mature somatic embryos; some lines failed to produce somatic embryos, and regenerated shoots with visible phenotypes, namely albino, pale green, and green (Fig. 6b–g). Albino transformants (Fig. 6b–e) grew very slowly. Pale green transformant (Fig. 6f) grew slower than wild-type. A green transformant (Fig. 6g) grew similar to wild-type (Fig. 6h). To verify the modification of sequences at target sites in transformants induced by the CRISPR/Cas9 system, sequences around the target site were analyzed from genomic DNA isolated from aerial part of transformants. PCR products were cloned into a cloning vector and 15–32 clones were analyzed for each transformant. Various mutations were detected at target sites in these lines (Fig. 6i), indicating that targeted mutagenesis of CjChlI occurred. Moreover, CjChlI was completely disrupted in albino transformants. By contrast, a point mutation was observed in 8 of 15 clones in the pale green transformant. In the green transformant (t1 + t2_#6 − 2_3), 1 of 16 clones had a deletion in the target site. Taken together, our results indicate that the CRISPR/Cas9 system induced targeted mutagenesis through double-strand breaks in an endogenous gene of C. japonica.

Table 4

Summary of endogenous *Cryptomeria japonica* magnesium chelatase subunit I (*CjChlI*) modification using the CRISPR/Cas9 system
Target^*	No. of transformed lines (A)	No. of HMA positive lines (B)	Mutation frequency (%)^†
t1	20	7	35^a
t2	17	4	23.5^a
t1 + t2	7	2	28.6^a
^*pCRG-SpCas9 vectors with gRNA expression cassettes driven by CjU6_#2 promoter were transformed into embryogenic tissue. ^† (B / A) × 100. Pairwise multiple comparison of proportions was performed using Tukey’s multiple comparison test. Proportions with significant difference were labeled with different letters (P < 0.05).

Here we report targeted mutagenesis through the CRISPR/Cas9 system in C. japonica, which is a first in coniferous trees species to the best of our knowledge. Genetic transformation of conifers is expected to be a powerful tool for modifying their characteristics in a short time. This technology has been used for producing herbicide-tolerant and insect-resistant crops, such as corn, soybean, and cotton⁴¹. However, these are mostly annual crops, and little research has been done on how transgenes behave long-term (> 10 years) in perennial plants, such as trees. In addition, unlike crop cultivation, trees grow in forests, where human management is a challenge. Studies have also raised concerns about transgene instability⁴². Genome-edited plants with no transgenes are attractive for perennial tree species in terms of public acceptance. Inducing gibberellin-mediated flowering in C. japonica is easy. Among conifers, obtaining null segregants through mating in a relatively short time is possible in C. japonica, because it is easy to induce earlier flowering in even one-year-old seedling plants by gibberellin treatment⁴³. Moreover, C. japonica, which has a stable culture, transformation system, and genome editing system, could be a model for coniferous tree species.

During vector development, AtHSP and NOS terminators in tandem were found to be important for the stable expression of exogenous proteins. The pZmUbi-GFP-Dt vector-introducing lines maintained strong GFP fluorescence after 5 years of subculture. In this study, we also surveyed the activity of U6 promoters isolated from C. japonica, in addition to the commonly used ones from A. thaliana and Oryza sativa, for improving mutation efficiency. In some plant species, such as soybean and cotton, mutation efficiency increased when their intrinsic U6 promoters were used instead of the Arabidopsis U6 promoter^44,45. However, contrary to expectations, the efficiency of genome editing using the U6 promoters of C. japonica was not significantly different from that with the U6 promoters of A. thaliana or O. sativa (Table 2). Whether this was due to the activity of the U6 promoter or the expression level of Cas9 is unknown. The terminator used for the Cas9 expression cassette in pZK_FFCas9 (Fig. 1b) might be unsuitable for Cas9 expression, compared with the tandem terminator unit of AtHSPt and NOSt in the pCRG-SpCas9 vector (Fig. 5c). Whether our results apply to all conifers warrants further study using other target tree species.

In the GFP-expressing line (N4), mutation frequency with GFP target #2_rev was 41.4% (Table 3). By contrast, Jacob et al.³⁷ detected indels in more than 70% transgenic lines when targeting the same GFP region in a genome editing study using GFP-expressing hairy roots of soybeans. These results may indicate that the amount of Cas9 in C. japonica was lower than that in soybean. Short indel patterns were observed in a large number of transgenic lines (Fig. 3, Supplementary Fig. S5), which is consistent with the results of others^21,46. In addition, some transgenic lines had large deletions, such as 15 and 33 bp in GFP target #1 and target #3_rev, respectively (Fig. 3 and Supplementary Fig. S5). This deletion may be a microhomology-associated deletion⁴⁷, that is, microhomologies, such as “TCGA” and “GCTG,” between the target sequence in GFP (Supplementary Fig. S5). Chimerism or mosaicism is an important concern in the application of genome editing in plant species; especially generation intervals are counted in years. Transgenic lines with mottled GFP knock-out regions were used to investigate chimerism in induced somatic embryos; however, more than 99% of embryos had a single modification pattern (Fig. 4k). The results support the hypothesis that the somatic embryo culture system originated from single cells⁴⁸. However, we also observed new modifications in the root tissue as the individual grew larger (Supplementary Fig. S6b). This result suggests that Cas9-mediated DNA cleavage is ongoing. Furthermore, the promoter activity of PcUbi is expected to be higher in the root tissue than in ET and needle tissue. These results also imply that if mutated embryos could be isolated, the chimerism would be eliminated. A difference in editing efficiency depending on the target sequence was observed (Table 3). Doench et al.⁴⁹ developed a tool to predict gRNA activity; however, no correlation between the score value and actual cutting efficiency was observed. No effective tool is available for predicting gRNA cleavage efficiency in plants⁵⁰.

We succeeded in performing targeted mutagenesis of endogenous CjChlI (Fig. 6b–g). By contrast, a mutation was observed in one of 16 clones from the green transformant line t1 + t2_#6 − 2_3 (Fig. 6g, i). This result indicates that continuous DNA cleavage by Cas9 and prolonged cultivation can lead to the modification of target regions. Further improvements in the CRISPR/Cas9 expression vector are required for more efficient mutagenesis. Codon optimization of Cas9 dramatically increases the efficiency of obtaining transformants with mutations in both alleles (Nanasato et al., in preparation). We are conducting genome editing studies using the improved vector and producing genome-edited male-sterile lines. The use of genome editing technology in confer species will directly contribute to the analysis of gene function in conifers, which has been difficult to analysis so far.

To achieve the full potential of genome editing technologies in conifer species, detailed genomic information needs to be available. In addition, an efficient technique for producing transgene-free individuals, through methods other than crossing, must be developed for practical use. In many crops, crossing has been used to obtain transgene-free individuals. However, crossing in conifers takes years. Furthermore, conifer species are not autogamous, and during crossing with another individual, useful parental traits are lost in the offspring. Direct delivery of the Cas9 and sgRNA complex into plant cells is an attractive solution^51,52. The cell wall is a major obstacle to the direct delivery of proteins. Yanagawa et al.⁵³ used a multi-gas plasma jet to deliver proteins into tobacco leaf. We have discovered a cell-penetrating peptide, which delivers proteins directly into C. japonica cells (Tanaka, Nanasato, et al., in submission). We believe that the integration of the efficient genome editing system we report here and direct protein delivery techniques will accelerate basic research and molecular breeding in conifers.

Acknowledgements

We are grateful to Dr. F. Fauser (Sangamo Therapeutics, Inc.), Dr S. Schiml and Professor H. Puchta at University of Karlsruhe Institute of Technology for providing the pDe-CAS9 vector and PcUbi promoter. We thank Professor M. Sakuta of Ochanomizu University for a gift of 35S::LUC and 35S::RUC vectors. We also thank Dr. H. Saika, Dr. S. Toki of NARO, and Professor K. Osakabe and Professor Y. Osakabe of Tokushima University for critical advice. Ms. T. Okuyama, Ms. F. Yamakawa, Ms. K. Ohbu, and J. Orita are warmly acknowledged for their experimental support. This work was supported by JSPS KAKENHI Grant Numbers JP16H04942 and JP17K07854.

Author Contributions

Y.N. is responsible for the overall design of the research. Y.N., K.K., and T.T. conceived, supervised, and designed the experiments; Y.N., M.M., N.F., M.E., Y.O., and M.N. performed experiments; Y.N. wrote the paper. All authors have discussed the results and agreed with the content of the submitted paper.

Conflict of Interest

The authors declare that they have no conflict of interest.

Tsumura, Y. et al. Effects of the last glacial period on genetic diversity and genetic differentiation in Cryptomeria japonica in East Asia. Tree Genet. Genomes 16, 19 (2020).
Ohba, K. Clonal Forestry with Sugi (Cryptomeria japonica). in Clonal Forestry II (eds. Ahuja, M. & Libby, W.) 66–90 (Springer Berlin Heidelberg, 1993). doi:10.1007/978-3-642-84813-1_4
Kondo, T. & Kuramoto, N. Cryptomeria japonica. in Forest Trees (ed. Kole, C.) 211–221 (Springer Berlin Heidelberg New York, 2007).
Forest Agency, Japan. State of Japan’s Forests and Forest Management –3rd Country Report of Japan to the Montreal Process–. http://www.rinya.maff.go.jp/j/kaigai/pdf/countryreport-1.pdf/ (2019).
Yamada, T., Saito, H. & Fujieda, S. Present state of Japanese cedar pollinosis: The national affliction. J. Allergy Clin. Immunol. 133, 632-639.e5 (2014).
Tsubomura, M., Kurita, M. & Watanabe, A. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica). Tree Physiol. 36, 653–666 (2016).
Futamura, N., Igasaki, T., Saito, M., Taira, H. & Shinohara, K. Comparison of fertile and sterile male gametogenesis in Cryptomeria japonica D. Don. Tree Genet. Genomes 15, (2019).
Hasegawa, Y. et al. Fine mapping of the male-sterile genes (MS1, MS2, MS3, and MS4) and development of SNP markers for marker-assisted selection in Japanese cedar (Cryptomeria japonica D. Don). PLoS One 13, e0206695 (2018).
Hasegawa, Y. et al. Identification and genetic diversity analysis of a male-sterile gene (MS1) in Japanese cedar (Cryptomeria japonica D. Don). Sci. Rep. 11, 1496 (2021).
Mishima, K. et al. Identification of novel putative causative genes and genetic marker for male sterility in Japanese cedar (Cryptomeria japonica D.Don). BMC Genomics 19, 1–16 (2018).
Maruyama, T. E., Ueno, S., Hirayama, S., Kaneeda, T. & Moriguchi, Y. Somatic embryogenesis and plant regeneration from sugi (Japanese cedar, Cryptomeria japonica D. Don, Cupressaceae) seed families by marker assisted selection for the male sterility allele ms1. Plants 9, 1029 (2020).
Jinek, M. et al. A programmable dual-RNA – Guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–822 (2012).
Shan, S., Soltis, P. S., Soltis, D. E. & Yang, B. Considerations in adapting CRISPR/Cas9 in nongenetic model plant systems. Appl. Plant Sci. 8, 1–17 (2020).
Nishimasu, H. et al. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 361, 1259–1262 (2018).
Walton, R. T., Christie, K. A., Whittaker, M. N. & Kleinstiver, B. P. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science 368, 290–296 (2020).
Ran, F. A. et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 186–190 (2015).
Pausch, P. et al. CRISPR-CasΦ from huge phages is a hypercompact genome editor. Science 369, 333–337 (2020).
Nishida, K. et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353, 1248 (2016).
Gaudelli, N. M. et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551, 464–471 (2017).
Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157 (2019).
Fan, D. et al. Efficient CRISPR/Cas9-mediated targeted mutagenesis in Populus in the first generation. Sci. Rep. 5, 12217 (2015).
Zhou, X., Jacobs, T. B., Xue, L.-J., Harding, S. A. & Tsai, C.-J. Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate : CoA ligase specificity and redundancy. New Phytol. 208, 298–301 (2015).
Taniguchi, T., Ohmiya, Y., Kurita, M., Tsubomura, M. & Kondo, T. Regeneration of transgenic Cryptomeria japonica D. Don after Agrobacterium tumefaciens-mediated transformation of embryogenic tissue. Plant Cell Rep. 27, 1461–1466 (2008).
Konagaya, K. I., Nanasato, Y. & Taniguchi, T. A protocol for Agrobacterium-mediated transformation of Japanese Cedar, Sugi (Cryptomeria japonica D. Don) using embryogenic tissue explants. Plant Biotechnol. 37, 147–156 (2020).
Nagaya, S., Kawamura, K., Shinmyo, A. & Kato, K. The HSP terminator of Arabidopsis thaliana increases gene expression in plant cells. Plant Cell Physiol. 51, 328–332 (2010).
Mikami, M., Toki, S. & Endo, M. Parameters affecting frequency of CRISPR/Cas9 mediated targeted mutagenesis in rice. Plant Cell Rep. 34, 1807–1815 (2015).
Fauser, F., Schiml, S. & Puchta, H. Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J. 79, 348–59 (2014).
Kuroda, M., Kimizu, M. & Mikami, C. A simple set of plasmids for the production of transgenic plants. Biosci. Biotechnol. Biochem. 74, 2348–2351 (2010).
Endo, M., Nishizawa-Yokoi, A. & Toki, S. Targeted Mutagenesis in Rice Using TALENs and the CRISPR/Cas9 System. in Chromosome and Genomic Engineering in Plants: Methods and Protocols (ed. Murata, M.) 1469, 123–135 (Springer Science+Business Media, LLC, NY, 2016).
Kawalleck, P., Somssich, I. E., Feldbrügge, M., Hahlbrock, K. & Weisshaar, B. Polyubiquitin gene expression and structural properties of the ubi4-2 gene in Petroselinum crispum. Plant Mol. Biol. 21, 673–684 (1993).
Hyun, Y. et al. Site-directed mutagenesis in Arabidopsis thaliana using dividing tissue-targeted RGEN of the CRISPR/Cas system to generate heritable null alleles. Planta 241, 271–284 (2014).
Konagaya, K. I., Kurita, M. & Taniguchi, T. High-efficiency Agrobacterium-mediated transformation of Cryptomeria japonica D. Don by co-cultivation on filter paper wicks followed by meropenem treatment to eliminate Agrobacterium. Plant Biotechnol. 30, 523–528 (2013).
Liu, Y.-G., Mitsukawa, N., Oosumi, T. & Whittier, R. F. Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant Journal 8, 457–463 (1995).
Waibel, F. & Filipowicz, W. U6 snRNA genes of Arabidopsis are transcribed by RNA polymerase III but contain the same two upstream promoter elements as RNA polymerase II-transcribed U-snRNA genes. Nucleic Acids Res. 18, 3451–3458 (1990).
Fu, Y. et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 31, 822–826 (2013).
Mali, P. et al. RNA-Guided Human Genome Engineering via Cas9. Science 339, 823–826 (2013).
Jacobs, T. B., Lafayette, P. R., Schmitz, R. J. & Parrott, W. A. Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnol. 15, 1–10 (2015).
Sugano, S. S. et al. Genome editing in the mushroom-forming basidiomycete Coprinopsis cinerea, optimized by a high-throughput transformation system. Sci. Rep. 7, 1–9 (2017).
Kruse, E., Mock, H. & Grimm, B. Isolation and characterisation of tobacco (Nicotiana tabacum) cDNA clones encoding proteins involved in magnesium chelation into protoporphyrin IX. Plant Mol. Biol. 35, 1053–1056 (1997).
Koncz, C. et al. Isolation of a gene encoding a novel chloroplast protein by T-DNA tagging in Arabidopsis thaliana. EMBO J. 9, 1337–1346 (1990).
Kumar, K. et al. Genetically modified crops: current status and future prospects. Planta 251, 1–27 (2020).
Hoenicka, H. & Fladung, M. Genome Instability in Woody Plants Derived from Genetic Engineering. in Tree Transgenesis (eds. Fladung, M. & Ewald, D.) 301–321 (Springer Berlin Heidelberg, 2006). doi:10.1007/3-540-32199-3_14
Hashizume, H. The effect of gibberellin upon flower formation in Cryptomeria japonica. J. Japanese For. Soc. 41, 375–381 (1959).
Long, L. et al. Optimization of CRISPR/Cas9 genome editing in cotton by improved sgRNA expression. Plant Methods 14, 1–9 (2018).
Sun, X. et al. Targeted mutagenesis in soybean using the CRISPR-Cas9 system. Sci. Rep. 5, 10342 (2015).
Feng, Z. et al. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 111, 4632–7 (2014).
Bae, S., Kweon, J., Kim, H. S. & Kim, J. S. Microhomology-based choice of Cas9 nuclease target sites. Nat. Methods 11, 705–706 (2014).
Nagmani, R., Becwar, M. R. & Wann, S. R. Single-cell origin and development of somatic embryos in Picea abies (L.) Karst. (Norway spruce) and P. glauca (Moench) Voss (white spruce). Plant Cell Rep. 6, 157–159 (1987).
Doench, J. G. et al. Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene inactivation. Nat. Biotechnol. 32, 1262–7 (2014).
Naim, F. et al. Are the current gRNA ranking prediction algorithms useful for genome editing in plants? PLoS One 15, 1–12 (2020).
Woo, J. W. et al. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat. Biotechnol. 33, 1162–1164 (2015).
Svitashev, S., Schwartz, C., Lenderts, B., Young, J. K. & Mark Cigan, A. Genome editing in maize directed by CRISPR–Cas9 ribonucleoprotein complexes. Nat. Commun. 7, 13274 (2016).
Yanagawa, Y. et al. Direct protein introduction into plant cells using a multi-gas plasma jet. PLoS One 12, e0171942 (2017).

No competing interests reported.

Download PDF

Journal Publication

published 10 Aug, 2021

Read the published version in Scientific Reports →

Editorial decision: Major revision
13 May, 2021
Reviewers agreed at journal
20 Apr, 2021
Reviews received at journal
06 Apr, 2021
Reviewers agreed at journal
19 Mar, 2021
Reviewers invited by journal
19 Mar, 2021
Editor assigned by journal
11 Mar, 2021
Editor invited by journal
04 Mar, 2021
Submission checks completed at journal
04 Mar, 2021
First submitted to journal
25 Feb, 2021

You are reading this latest preprint version

CRISPR/Cas9-mediated Targeted Mutagenesis in Japanese Cedar (Cryptomeria japonica D. Don)

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Plant material

Vector construction

Transformation of C. japonica

GFP visualization

Detection of mutations in genomic DNA

Southern blot analysis

Heteroduplex mobility assay

Statistical analysis

Results

Knock-out of a reporter GFP transgene using the CRISPR/Cas9 system with various U6 promoters

Investigation of chimerism in the regenerated T0 plantlet

Targeted mutagenesis of an endogenous gene using the CRISPR/Cas9 system

Discussion

Declarations

Acknowledgements

Author Contributions

Conflict of Interest

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1