Analysis of immunomodulation to intestinal inflammatory injury in chickens caused by Clostridium perfringens C57-1 infection

doi:10.21203/rs.3.rs-2757321/v1

Download PDF

Research Article

Analysis of immunomodulation to intestinal inflammatory injury in chickens caused by Clostridium perfringens C57-1 infection

https://doi.org/10.21203/rs.3.rs-2757321/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

By releasing a variety of toxins and invasive enzymes, Clostridium perfringens (C. perfringens) attached to the intestinal epithelium triggers receptors on intestinal target cells and activates intracellular signalling pathways, resulting in intestinal inflammation and immunological responses. We developed a model of experimental induction of necrotic enteritis (NE) in chickens in order to investigate the intestinal immunomodulatory to inflammatory damage caused by C. perfringenstype A C57-1 infection. Growth rate and feed intake of the challenged chickens reduced, and the intestinal mucosa had varying degrees of injury and necrosis along with widespread inflammatory infiltration. The relative abundance of Lactobacillus was significantly reduced in the challenged intestine compared to the control, while the level of Clostridiales, Bacteroidales, and Erysipelotrichalesincreased. The activity of the β-glucuronidase and β-glucosidase enzymes in the challenged chickens was also significantly higher. The Th17/Treg balance in the gut was upset, and the proinflammatory cytokines IL-17 and IL-1β and IL-13 also elevated dramatically, which together synergistically induced inflammation. As the inflammation intensified, TGF-4 and IL-2 levels in the gut of the challenge group fell at first and then moderately recovered in comparison to the control group. Immunomodulated by Th2 and Th17 immunity, the challenged chickens were able to produce specific IgY against C. perfringens C57-1, thus exerting limited anti-inflammatory effects. From the standpoint of immunological prevention, this study established a theoretical foundation for C. perfringens infection.

Clostridium perfringens

Chickens

Necrotic Enteritis

Intestinal microbiota

Immunomodulatory response

C. perfringens infection could induce NE in chickens.

C. perfringens infection disrupted the balance of the intestinal microbiota.

C. perfringens infection increased activity of harmful enzymes of chicken intestine.

Th17/Treg immune imbalance exacerbated intestinal inflammatory response.

The immunomodulation to C. perfringens was mediated by Th2 and Th17 immunity.

Clostridium perfringens (C. perfringens) is classified into seven toxin types from A to G depending on the six extracellular toxins from it produced [1]. The necrotizing enteritis (NE) and enterotoxaemia are common diseases in animals, mainly caused by a variety of toxins. However, the type A toxin of C. perfringens is one of the most significant virulence factors due to its toxin-releasing and enzymatic capabilities [2]. In recent years, the prevalence of NE caused by C. perfringens has considerably increased, costing the poultry industry up to US$6 billion annually in production losses [3]. C. perfringens pathogenesis begins in the intestine, where the bacteria enter the epithelial tissue's surface and then bind to epithelial cells [4, 5]. Stress alters the intestinal milieu, causing C. perfringens to grow quickly and release a lot of poisons. By building up in the gut, the α-predominant toxin generated by C. perfringens type A causes severe inflammatory exudation and infiltration, necrosis of the intestinal mucosa, and increases the permeability of the intestinal wall, and eventually forming necrotizing inflammation [6, 7].

While investigating the pathophysiology of C. perfringens infection, host-pathogen interactions are critical. As a result, NE animal models are frequently used to tackle this challenge. As the host body fights against C. perfringens infection, it triggers a cascade of complicated biological processes such as immune response and enzyme metabolic control. Bacteria bind to gut epithelial cells by recognizing and binding pathogen-associated molecular patterns (PAMPs) in highly conserved pathogen recognition areas [8]. The interaction between bacterial PAMPs and TLRs causes a cascade of reactions that impact the activity of dendritic cells and immune cells, allowing naive T helper (Th) cells to differentiate into mature Th1, Th2, Th17, and Treg cells [8-10]. Mature immune cells influence the immune system by secreting cytokines in the cell-cell communication pathway, such as interferon-γ (IFN-γ) by Th1 cells and IL13 by Th2 cells [11, 12]. The CD4+ T cell subset includes Th17 and Treg cells. To initiate inflammatory responses, Th17 cells release pro-inflammatory proteins such as IL-2, IL-6, and IL-17. Treg cells, on the other hand, have a negative feedback immunomodulatory impact by modulating anti-inflammatory molecules such as IL-10 and TGF-β [13].

The intestinal microbiota contributes to intestinal immunity through enteroendocrine, an essential intestinal biological barrier that is intrinsically related to inflammatory bowel disorders. Dysbacteriosis can cause a decrease in the abundance of intestinal probiotics and the proliferation of conditioned pathogenic bacteria, which accumulate large amounts of toxins and invading enzymes in the intestines, affecting intestinal immune and metabolic functions [14, 15]. Furthermore, the composition of the intestinal microbiota influences Th17/Treg immunity in the gastrointestinal tract. The intestinal microbiota regulates the differentiation of initial CD4+ T cells into Th17 or Treg cells by acting on receptors such as thymus stromal lymphopoietin, and it can also affect the Th17/Treg immune balance via cytokine pathways [16, 17]. Ivanov et al. demonstrated that infection of mice's gastrointestinal tracts with segmented filamentous bacteria was sufficient to cause the development of Th17 cells in the small intestine and enhanced expression of genes related to inflammation [18]. Kim et al. discovered that coccidia challenge significantly increased the proportion of Th17 cells in the spleen and cecal tonsils of chickens[19].

Pathogenesis is an important target for disease prevention and treatment since it represents the initial stage in the pathological mechanism. Based on the development of a clinical trial model of chicken NE of C. perfringens C57-1 infection, the changes in intestinal microbiota and immunomodulatory response of the intestine inflammatory infection were investigated in this study. Our findings lay the groundwork for future research into the pathogenesis of enterotoxemic diseases caused by C. perfringens infection.

Bacterial strain and animals

C. perfringens toxinotype A (C57-1) bacterial strain was obtained from the Institute of Veterinary Drug Control (Beijing, China) and anaerobically grown at 37°C in Schaedler Anaerobic Broth (Oxoid Limited, UK).

One-day-old specific pathogen-free (SPF) chickens were obtained from the Harbin Institute of Veterinary Medicine (Harbin, Heilongjiang, China). All chickens were weighed and checked before being randomly assigned to 36-floor cages lined with hardwood shreds. The room temperature was set at 28°C for the first three days of the trial, then reduced by 2°C every week. Temperature, humidity, and lighting were all set according to the strain guiding principle (Aviagen et al. 2014). In each group, the chickens were cared for twice daily for a 28-day observation period.

C. perfringens challenge design

The chickens were divided into two groups (control and challenge), each with fifty chickens. Both groups were raised in an isolated pen with an antibiotic-free diet, starter feed (from day 1 to 14), and finisher feed (from day 14 to 28).

C. perfringens challenges were performed in the manner as described by Shojadoost et al. (2012) and Ho TO et al. (2017)[20, 21]. Inoculation of C. perfringens C57-1 to induce infection began on day 14 with oral gavage twice daily at a dose of 2 mL of the resulting cultures (10⁹ colony-forming units [CFU]) for 7 consecutive days, while the control group was inoculated with 2 mL of PBS.

Growth performance

Feed intake and mortality were monitored throughout the experiment to gauge the chickens' development performance. Daily fatality, average feed intake (FI), body weight gain (BWG), and feed consumption ratio (FCR) calculations were made in accordance with Gharib et al.'s instructions[22].

Gross pathology

Experimental chickens' intestinal tracts were examined for obvious necrotic abrasions. Gross pathological necrotic abrasions in the intestine (from the duodenum to the ileum and from the cecum to the rectum) were counted and scored according to the method described by Walid et al.[23], as follows: 0=no gross lesion; 1=thin or friable walls with crumpled mucosa; 2=focal necrosis or ulceration (1–5 foci); 3= focal necrosis or ulceration, or non-removable fibrin deposits (6–15 foci); 4=focal necrosis or ulceration, or non-removable fibrin deposits (16 or more foci); 5=blotches of necrosis 2–3 cm long; and 6=rambling or diffuse necrosis. Lesions in the intestine with scores 2 or more were considered NE-positive.

Histopathological examination

Histopathological examination of intestinal tissues was performed. 3 to 4 cm long tissue samples from the intestine (duodenum, jejunum, and cecum) were fixed in 4% paraformaldehyde solution. Furthermore, 4-m-thick sections were cut from paraffin-embedded tissue blocks and stained with haematoxylin and eosin (HE). Histopathology was performed on lesions in intestinal sections[24].

Exploration of gut microbiota via 16sRNA sequence

To assess the effect of C. perfringens C57-1 on gut microbiota, we collected intestinal contents from three parts (Jejunum, Ileum, and Cecum) of challenged and control chickens on day 7 after C. perfringens inoculation. Microbial DNA was extracted using the Tiangen Stool DNA kit (Biotech, Beijing, China) in accordance with the manufacturer's instructions. The V3-V4 region of 16S rDNA was amplified with specific PCR primers (341F: 5'-CCTACGGGNGGCWGCAG-3', 806R: 5'-GGACTACHVGGGTATCTAAT-3') after genomic DNA was extracted from the samples. The amplified fragments were sequenced and analyzed using an Illumina HiSeq2500 (GeneDenovo, Guangzhou, China).

β-glucosidase and β-glucuronidase activity assay

The activity of β-glucosidase and β-glucuronidase in caecal content was measured using the method described by Shokryazdan et al.[25], with minor modifications. 1 g of caecal tissue was suspended in 12 mL of PBS (pH 7.1) and centrifuged at 4 000×g for 4 min. 0.2 mL of the sample was then treated for 1 hour at 37°C with 0.8 mL of 2 mM P-nitrophenyl β-D-glucupyranoside for β-glucosidase or 2 mM p-nitrophenyl-β-D-glucuronide for β-glucuronidase, were incubated for 1 h at 37°C. The reaction was then stopped by adding one milliliter of 0.5 M NaOH, and the resultant solution was centrifuged at 5000×g for ten minutes. Enzymatic activity was determined by measuring the absorbance at 405 nm using a spectrophotometer with the unit g^-1caecal content. One unit of enzymatic activity is defined as the amount of caecal content required to release 1 μMp-nitrophenol in 1 h.

RNA extraction and Quantitative real-time polymerase chain reaction (RT-qPCR)

Total RNA was isolated from homogenates of jejunal tissue and caecal tonsils using the TRIzol Plus RNA Purification kit (Invitrogen, USA) following the manufacturer’s instructions. cDNA was synthesized with M-MLV reverse transcriptase (Promega) and quantified using real-time PCR (RT-qPCR). Table 1 shows the primers for the oligonucleotides, GAPDH, and specific target genes used in subsequent analyses. The mean threshold cycle (Ct) values for product amplification were considered for normalizing RNA levels by pooling the value standards from all samples in the experiment. Relative expression levels of each sample was calculated according to Pfaffl’s method[26].

Enzyme-Linked Immunosorbent Assay (ELISA)

Total IgY was detected in challenged chickens on days 7 and 14 using an ELISA kit (Meilian Biological Biological Technology Co., Ltd. Shanghai, China) as directed by the manufacturer. Blood was collected using the method described by Hamal et al.[27]. Each ELISA plate contained its own standards and the samples were analyzed in triplicate. IgY was used as a detected antibody at a dilution of 1:20,000. After 30 minutes of incubation with tetramethylbenzidine (Sigma, USA), the reaction was stopped with 2 M H₂SO₄ (55 µL/well). The absorbance was measured at 490 nm and read at 450 nm using an ELX 800 universal microplate reader (BIO-RAD Model 680, Japan). The standard concentration and absorbance value for each plate were counted, and the antibody concentration in each sample was expressed as micrograms per millilitre.

Statistical analysis Data are presented as mean ± standard deviation of three replicates per test in a single experiment repeated three times. Statistical differences were analysed using the T-test via Prism 7 software. Statistical differences among groups with P values < 0.05 were considered significant.

Effect of C. perfringens C57-1 on the performance of chickens

In comparison to control chickens, challenged chickens' growth was impacted by C. perfringens C57-1 inoculation. Growth rate, BW, and FCR were calculated from days 1 to 28. (Table 2). According to the results, there were no significant differences from days 1 to 14 but there were significant differences from days 1 to 28. In contrast to the control chickens, the challenged chickens' FCR increased while their growth rate and feed intake decreased. By influencing feed digestion and absorption through clinical or subclinical intestinal disturbance, C. perfringens also had an impact on the BW gain of challenged hens with higher FCR. This performance impact was evident from the chickens' higher BW gains.

Gross pathology

The gross intestinal pathology score was shown in Table 3, and the gross pathological results are revealed in Figure 1. Compared with the control group, the mesenteric vessels of challenged group appeared bloated with blood; there were excessive haemorrhage blood clots; the villi disappeared; and the intestinal mucosa appeared reddish (Fig 1, A-B). The mucosal lining of the duodenum intestines where necrosis was observed was yellow or reddish, with no sign of villi folds (Fig 1, C-D). The jejunum presented symptoms of acute mucosal inflammation with laxity, red color, and haemorrhage (Fig 1, E-F). Severe signs of the cecum crumbs with clotted blood and central extensive dispersal were commonly seen along with the disappearance of mucosa layers throughout the affected sections of the intestine (Fig 1, G-H). In our study, viable broilers were exposed to high levels of C. perfringens C57-1, which resulted in severe gross intestinal lesions that manifest typical NE symptoms.

Histological examination

Enterocytes and villi, as well as fully normal mucosa muscularis and goblet cells, appeared well organized in the control group (Fig 2, A-C), with some major structural changes in histopathological samples from both challenged and control chickens. In challenged chickens, the epithelial tissue of the intestine was surrounded by necrotic cells, tissue fragments, and a mucus matrix, resembling the histopathological features of a pseudomembrane. The lamina muscularis and serosa were affected, and the villi were damaged to varying degrees, ranging from severe to mild to moderate (Fig 2, D-F), with patchy congestion and hemorrhage appearing throughout the mucosa, particularly around the crypts. Sporadic necrosis of enterocytes was observed in some areas (Fig 2E), goblet cells disappeared along with disrupted muscularis, and there was severe interior destruction of the intestinal villi. The cecum region of the intestine was severely oedematous (Fig 2F), with inflammatory cellular infiltration, hemorrhage, and significant villi structure disruption. In this study, experimental chickens developed necrotizing enteritis, which displayed typical symptoms of inflammatory damage or necrosis of the intestine, in response to the challenge of oral inoculation.

Analysis of the structure and difference of the intestinal microbiota among the groups

Illumina MiSeq analysis was performed on intestinal contents samples from the challenge group (C.P-Jejunum, C.P-Ileum, and C.P-Cecum) and the control group (C-Jejunum, C-Ileum, and C-Cecum). The findings revealed that on the same days, 87 core operational taxonomic units (OTUs) were shared among all groups at the OTU level (Fig. 3A). The results of the α-diversity indices (Sob, PD-tree indices) (Fig. 3B-C, P < 0.01) and the Principal Co-ordinates Analysis (PCoA) (Fig. 4A) revealed significant differences in the intestinal microbiota in the jejunum, Ileum, and cecum between the control and challenge groups. Figure 4B-C depicts the species composition of the intestinal microbiota at the species classification and genus level. The relative abundance of Lactobacillus in the jejunum, ileum, and cecum of the challenge group decreased significantly when compared to the control group, while the levels of Clostrdium, Ruminococcaceae, Bacteroides, Enterobacteriaceae, Faecalibacterium, and others increased at the species and Genus levels. C. perfringens C57-1 infection decreased beneficial species while increasing amounts of pathogenic bacteria, disrupting the intestinal immune balance and increasing the likelihood of intestinal inflammation.

C. perfringens infection increased activity of β-glucosidase and β-glucuronidase

β-glucuronidase and β-glucosidase levels are frequently used to identify microbiota pathogenic activity for harmful metabolic changes[28]. As shown in Figure 5A-B, after 2 weeks of normal feeding, there was no significant difference between the two groups on day 14. The challenge group was then inoculated with a high dose of C. perfringens C57-1, and on day 28 there was a significant rise in β-glucosidase and β-glucuronidase activity (P≤0.05). The results showed that C. perfringens C57-1 infection altered the intestinal microbial populations. When the normal balance of the intestinal microbiota is disrupted, the activity of harmful enzymes increases in reaction to an increase in the number of pathogenic microorganisms, accelerating the accumulation of toxic metabolites in the intestine and damaging the intestinal epithelium.

Results of immunomodulatory response to intestinal inflammatory injury

The expression levels of cytokines were measured in chickens infected with C. perfringens C57-1 to evaluate the immune response (Fig. 6). In the early infection (day 7), the intestinal proinflammatory cytokines IL-1β and IL-17 of challenge chickens increased significantly, while IL-13 exerting pro-inflammatory effects in the early stage was also upregulated. Meanwhile, IL-2 and TGF-β4 in the jejunum was downregulated compared to the control at early stage. On the 14th day of infection, IL-13 and IL-17 levels continued to rise significantly, while TGF-4 levels fell significantly in comparison to the control groups. The level of IL-2 was higher than in the early stages of infection, but the difference was not statistically significant. These results suggested that C. perfringens C57-1 infection could induce Th2 and Th17 cellular immune response, and the presence of a strong humoral immune response was also supported by the high levels of IgY found in the challenged chickens (Fig. 7).

C. perfringens is a common adaptable gastrointestinal tract pathogen in poultry and livestock, causing a variety of acute and chronic diseases such as dysentery, haemorrhagic enteritis, and enterotoxaemia[29, 30]. The main pathogenesis of C. perfringens infection is disruption of the microecological balance of the intestinal microbiota, as well as the production of exotoxins and invasive enzymes[31]. Through subclinical and clinical diagnosis in the presence of C. perfringens infection, mortality levels, along with severe microscopic lesions, are accepted indicators of established NE disease in chickens[24, 32, 33]. A previous study has reported that performance losses in chickens were linked to the chronic form of intestinal mucosal damage, showing poor absorption and nutrient digestion with an increase in FCR, ultimately leading to BW loss [34]. In this study, chickens with an established C. perfringens infection were confirmed by an apparent effect on growth performance and FCR, as well as significant bleeding, inflammatory, and necrotizing lesions in the intestine, as previously described for different levels of NE severity in broiler chickens[22, 34].

The intestinal microbiota are densely colonized on the surface of the intestinal mucosa, forming a natural microbial film barrier in a mutually beneficial symbiosis. Under pathological conditions, C. perfringens grows explosively, competes with normal flora for adhesion sites in the intestinal epithelium, consumes intestinal nutrients, produces toxins, and increases the activity of harmful enzymes. Its invasion, adhesion, and proliferation alter the intestinal flora and cause microecological disorders[35].In this study, the composition of the intestinal mucosa of diseased and normal chickens was analyzed. Ruminococcus, Clostrdium, and Bacteroides levels increased significantly in the intestines of challenged chickens, while probiotic bacteria such as Lactobacillus and Romboutsias abundance decreased dramatically. Ruminococcus growth is potentially associated with intestinal diseases. Ruminococcus metabolizes mucins and produces large amounts of phenylethylamine and tryptamine in the intestine, affecting the intestinal mucosal barrier function [36]. Also, it was shown that microorganisms in fecal samples of patients with irritable bowel syndrome (IBS) were significantly higher in Ruminococcus, Clostrdium, and Bacteroides compared to healthy population, while bacteria of the genera Bifidobacterium and Faecalibacterium were significantly lower than healthy population, which is consistent with our study [37]. Metwaly A et al. also demonstrated that in a mouse model of inflammatory bowel disease (IBD), alterations in the intestinal microbial community, such as increased abundance of Enterobacteriaceae, Clostrdium, Faecalibacterium and Bacteroides, and decreased abundance of Lactobacillus, Parabacteroides, Bifidobacterium, etc., which can lead to disruption of the intestinal barrier and an increase in the inflammatory response [38].

Furthermore, harmful enzymes produced by bacterial strains may result in the release of toxic metabolites, resulting in a prolonged presence of toxicants in the body (Jin et al., 2000). Escherichia coli, Bacteroides species, and C. perfringens were the only species found to produce β-glucuronidase [39]. β-glucuronidase, which is released by the intestinal mucosa, which is released by the intestinal mucosa, is essential for the glucuronidation of many endogenous substances and pharmaceuticalsinto the enterohepatic circulation, a process that is closely linked to the onset of various disorders and the gastrointestinal toxicity of many medications[40]. Gorbach et al. has shown that these enzymes could hydrolyse glucuronidase in the intestine, producing toxic by-products and organotoxicity[41]. In this study, the harmful caecal bacterial enzymes β-glucosidase and β-glucuronidase increased significantly in challenged group at day 28. This result corresponded with the previously measured activity of β-glucuronidase in the bile of human patients, since these bacteria have a significantly high average enzyme activity[39]. These results suggested that C. perfringens infection disrupts the balance of the intestinal mucosa, with a rise in the number of harmful bacteria and the production of large amounts of β-glucuronidase, leading to the accumulation of harmful compounds that exacerbate the intestinal inflammatory response and disrupt the intestinal epithelial barrier. These findings were corroborated by the gross pathology and histological examination of the intestinal tract of the attacked chickens.

The growth of intestine-associated lymphoid tissues and immune cell differentiation is efficiently encouraged by the intestinal microbiota, which acts as a biological barrier. Intestinal microbiota dysfunction can result from a decline in flora diversity and abundance, which can cause inflammation. According to earlier research, numerous T helper cell subtypes release various cytokines with a range of activities and immunomodulatory qualities[12, 42]. The dysfunction of the Th17/Treg immune homeostasis axis is one of the primary pathophysiological underpinnings for the onset and progression of chronic inflammatory illnesses of the gut. Dysbiosis of intestinal microbiota can directly or indirectly disrupt the Th17/Treg balance, which in turn is involved in the development of inflammatory diseases of the intestine[43, 44]. IL-2 is a key immunomodulatory cytokine that Treg cells require to regulate differentiation, immune levels, and homeostasis. TGF-β secreted by Treg cells plays a dominant role in the inflammatory response[45, 46]. Pro-inflammatory IL-17 released by TH17 helper cells encourages the release of inflammatory mediators by monocytes, such as tumor necrosis factor TNF-α and IL-1β, and works in concert with these mediators to intensify the inflammatory response[12, 47].

This study analyzed the immunological response of NE chickens to C. perfringens C57-1 infection. In the early stages of infection, the pro-inflammatory cytokines IL-1β, IL-17 and IL-13 increased significantly, indicating that excessive C. perfringens C57-1 attack immediately caused intestinal inflammation and activated Th2 and Th17 cell immunity in chickens. As the inflammatory response intensified (day 14), the levels of IL-13 and IL-17 continued to increase significantly, while 1L-2 and TGF-4 levels showed a modest recovery compared to the early infection. These results demonstrated that the Th17/Treg balance in the gut was disrupted, and neither the IL-2 secreted by Th1 cells nor the TGF-4 secreted by Treg cells could compensate for it. The absence of significant changes in IFN-γ mRNA expression also indicated that Th1 immunity plays a limited immunomodulatory role in this inflammation. Under the immunomodulatory effect dominated by Th17/Treg balance and Th2 cell immunity, high levels of IgY antibodies against C. perfringens C57-1 were produced of challenged chickens than in control group chickens. These results provided evidence that the organism exerted an immunomodulatory response against intestinal C. perfringens necrotic enteritis.

In conclusion, C. perfringens C57-1 could cause intestinal dysbacteria and enteritis in chickens, resulting in damage and even death, and the challenged chickens produced an immunomodulatory response to C57-1 (Fig. 8). The upregulation of IL-1β, IL-13, and IL-17, along with the downregulation of TGF-β4, indicated that C. perfringens could prompt the pathology of subclinical NE and induce an inflammatory immune response in the chicken intestine. Furthermore, the presence of high levels of antibodies to C. perfringens in challenged chickens provided proof to support the cytokine gene expression results. These findings could help to improve the efficacy of a vaccine or a specific drug against NE by evaluating the pathogenicity of C. perfringens toxins and their impact on chicken performance.

Ethics approval and consent to participate: For the care of laboratory animals, all appropriate international (OIE Terrene animal code) and national guiding principles (CNAS-CL 06:2018) were followed, as approved by the Institutional Committee of Northeast Agriculture University, College of Veterinary Medicine (Harbin, China). All procedures involving laboratory animals, birds, health, and care were in accordance with the code of preparation for the use of animals for scientific purposes.

Consent for publication: Not Applicable.

Data Availability Statement: The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding authors.

Competing interests: The authors declare that they have no conflicts of interest.

Funding: This work was supported by the National Key Research and Development Plan under Grant 2022YFD1800304.

Authors’ Contributions: L.T. (Lijie Tang) and X.W. (Xiaona Wang) contributed to the study conception. M.Z.K(Mohammad Zeb Khan), H.Z. (Hailin Zhang), H.Z. (Huijun Zhang) and H.Z. (Haiyuan Zhao) conducted experiments. H.Z. (Hailin Zhang) drafted the manuscript. J.L. (Jiaxuan Li), Y.S. (Yilan Shao), Z.S. (Zhifu Shan), Y.J. (Yanping Jiang), W.C. (Wen Cui), H.Z. (Han Zhou), and L.W. (Li wang) performed data analyses. Y.L. (Yijing Li) and X.Q. (Xinyuan Qiao) supervised the project.

Liu L, Wang H, Xu W, Yin Y, Ren Y, Bu H, Zhao D: Tracking Clostridium perfringens strains from breeding duck farm to commercial meat duck farm by multilocus sequence typing. Vet Microbiol 2022, 266:109356.
Awad MM, Bryant AE, Stevens DL, Rood JI: Virulence studies on chromosomal alpha-toxin and theta-toxin mutants constructed by allelic exchange provide genetic evidence for the essential role of alpha-toxin in Clostridium perfringens-mediated gas gangrene. Mol Microbiol 1995, 15(2):191-202.
Gao X, Ma Y, Wang Z, Bai J, Jia S, Feng B, Jiang Y, Cui W, Tang L, Li Y et al: Oral immunization of mice with a probiotic Lactobacillus casei constitutively expressing the alpha-toxoid induces protective immunity against Clostridium perfringens alpha-toxin. Virulence 2019, 10(1):166-179.
Baba E, Ikemoto T, Fukata T, Sasai K, Arakawa A, McDougald LR: Clostridial population and the intestinal lesions in chickens infected with Clostridium perfringens and Eimeria necatrix. Vet Microbiol 1997, 54(3-4):301-308.
Keyburn AL, Boyce JD, Vaz P, Bannam TL, Ford ME, Parker D, Di Rubbo A, Rood JI, Moore RJ: NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog 2008, 4(2):e26.
Uzal FA, Vidal JE, McClane BA, Gurjar AA: Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. Open Toxinology J 2010, 2:24-42.
Petit L, Maier E, Gibert M, Popoff MR, Benz R: Clostridium perfringens epsilon toxin induces a rapid change of cell membrane permeability to ions and forms channels in artificial lipid bilayers. J Biol Chem 2001, 276(19):15736-15740.
Oh ST, Lillehoj HS: The role of host genetic factors and host immunity in necrotic enteritis. Avian Pathol 2016, 45(3):313-316.
St Paul M, Brisbin JT, Abdul-Careem MF, Sharif S: Immunostimulatory properties of Toll-like receptor ligands in chickens. Vet Immunol Immunopathol 2013, 152(3-4):191-199.
Du E, Wang W, Gan L, Li Z, Guo S, Guo Y: Effects of thymol and carvacrol supplementation on intestinal integrity and immune responses of broiler chickens challenged with Clostridium perfringens. J Anim Sci Biotechnol 2016, 7:19.
Cosmi L, Maggi L, Santarlasci V, Liotta F, Annunziato F: T helper cells plasticity in inflammation. Cytometry A 2014, 85(1):36-42.
Narsale A, Moya R, Davies JD: Human CD4(+) CD25(+) CD127(hi) cells and the Th1/Th2 phenotype. Clin Immunol 2018, 188:103-112.
Knochelmann HM, Dwyer CJ, Bailey SR, Amaya SM, Elston DM, Mazza-McCrann JM, Paulos CM: When worlds collide: Th17 and Treg cells in cancer and autoimmunity. Cell Mol Immunol 2018, 15(5):458-469.
Takiishi T, Fenero CIM, Camara NOS: Intestinal barrier and gut microbiota: Shaping our immune responses throughout life. Tissue Barriers 2017, 5(4):e1373208.
Schwarzer M, Strigini M, Leulier F: Gut Microbiota and Host Juvenile Growth. Calcif Tissue Int 2018, 102(4):387-405.
Tanabe S: The effect of probiotics and gut microbiota on Th17 cells. Int Rev Immunol 2013, 32(5-6):511-525.
Chewning JH, Weaver CT: Development and survival of Th17 cells within the intestines: the influence of microbiome- and diet-derived signals. J Immunol 2014, 193(10):4769-4777.
Ivanov, II, Frutos Rde L, Manel N, Yoshinaga K, Rifkin DB, Sartor RB, Finlay BB, Littman DR: Specific microbiota direct the differentiation of IL-17-producing T-helper cells in the mucosa of the small intestine. Cell Host Microbe 2008, 4(4):337-349.
Kim WH, Lillehoj HS, Min W: Indole Treatment Alleviates Intestinal Tissue Damage Induced by Chicken Coccidiosis Through Activation of the Aryl Hydrocarbon Receptor. Front Immunol 2019, 10:560.
Shojadoost B, Vince AR, Prescott JF: The successful experimental induction of necrotic enteritis in chickens by Clostridium perfringens: a critical review. Vet Res 2012, 43(1):74.
To H, Suzuki T, Kawahara F, Uetsuka K, Nagai S, Nunoya T: Experimental induction of necrotic enteritis in chickens by a netB-positive Japanese isolate of Clostridium perfringens. J Vet Med Sci 2017, 79(2):350-358.
Gharib-Naseri K, Kheravii SK, Keerqin C, Morgan N, Swick RA, Choct M, Wu SB: Two different Clostridium perfringens strains produce different levels of necrotic enteritis in broiler chickens. Poult Sci 2019, 98(12):6422-6432.
Wilde S, Jiang Y, Tafoya AM, Horsman J, Yousif M, Vazquez LA, Roland KL: Salmonella-vectored vaccine delivering three Clostridium perfringens antigens protects poultry against necrotic enteritis. PLoS One 2019, 14(2):e0197721.
Smyth JA: Pathology and diagnosis of necrotic enteritis: is it clear-cut? Avian Pathol 2016, 45(3):282-287.
Shokryazdan P, Faseleh Jahromi M, Liang JB, Ramasamy K, Sieo CC, Ho YW: Effects of a Lactobacillus salivarius mixture on performance, intestinal health and serum lipids of broiler chickens. PLoS One 2017, 12(5):e0175959.
Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001, 29(9):e45.
Hamal KR, Burgess SC, Pevzner IY, Erf GF: Maternal antibody transfer from dams to their egg yolks, egg whites, and chicks in meat lines of chickens. Poult Sci 2006, 85(8):1364-1372.
Zdunczyk Z, Juskiewicz J, Jankowski J, Koncicki A: Performance and caecal adaptation of turkeys to diets without or with antibiotic and with different levels of mannan-oligosaccharide. Arch Anim Nutr 2004, 58(5):367-378.
Zhao L, Guo Z, Liu J, Wang Z, Wang R, Li Y, Wang L, Xu Y, Tang L, Qiao X: Recombinant Lactobacillus casei expressing Clostridium perfringens toxoids alpha, beta2, epsilon and beta1 gives protection against Clostridium perfringens in rabbits. Vaccine 2017, 35(32):4010-4021.
Uzal FA, Freedman JC, Shrestha A, Theoret JR, Garcia J, Awad MM, Adams V, Moore RJ, Rood JI, McClane BA: Towards an understanding of the role of Clostridium perfringens toxins in human and animal disease. Future Microbiol 2014, 9(3):361-377.
Nijland R, Lindner C, van Hartskamp M, Hamoen LW, Kuipers OP: Heterologous production and secretion of Clostridium perfringens beta-toxoid in closely related Gram-positive hosts. J Biotechnol 2007, 127(3):361-372.
Prescott JF, Smyth JA, Shojadoost B, Vince A: Experimental reproduction of necrotic enteritis in chickens: a review. Avian Pathol 2016, 45(3):317-322.
Hofacre CL, Smith JA, Mathis GF: An optimist's view on limiting necrotic enteritis and maintaining broiler gut health and performance in today's marketing, food safety, and regulatory climate. Poult Sci 2018, 97(6):1929-1933.
Timbermont L, Haesebrouck F, Ducatelle R, Van Immerseel F: Necrotic enteritis in broilers: an updated review on the pathogenesis. Avian Pathol 2011, 40(4):341-347.
Sonnenburg JL, Chen CT, Gordon JI: Genomic and metabolic studies of the impact of probiotics on a model gut symbiont and host. PLoS Biol 2006, 4(12):e413.
Zhai L, Huang C, Ning Z, Zhang Y, Zhuang M, Yang W, Wang X, Wang J, Zhang L, Xiao H et al: Ruminococcus gnavus plays a pathogenic role in diarrhea-predominant irritable bowel syndrome by increasing serotonin biosynthesis. Cell Host Microbe 2023, 31(1):33-44 e35.
Rajilic-Stojanovic M, Biagi E, Heilig HG, Kajander K, Kekkonen RA, Tims S, de Vos WM: Global and deep molecular analysis of microbiota signatures in fecal samples from patients with irritable bowel syndrome. Gastroenterology 2011, 141(5):1792-1801.
Metwaly A, Reitmeier S, Haller D: Microbiome risk profiles as biomarkers for inflammatory and metabolic disorders. Nat Rev Gastroenterol Hepatol 2022, 19(6):383-397.
Skar V, Skar AG, Stromme JH: Beta-glucuronidase activity related to bacterial growth in common bile duct bile in gallstone patients. Scand J Gastroenterol 1988, 23(1):83-90.
Cummings JH, Macfarlane GT: Role of intestinal bacteria in nutrient metabolism. JPEN J Parenter Enteral Nutr 1997, 21(6):357-365.
Gorbach SL: Bengt E. Gustafsson memorial lecture. Function of the normal human microflora. Scand J Infect Dis Suppl 1986, 49:17-30.
Vignali DA, Collison LW, Workman CJ: How regulatory T cells work. Nat Rev Immunol 2008, 8(7):523-532.
Liu YJ, Tang B, Wang FC, Tang L, Lei YY, Luo Y, Huang SJ, Yang M, Wu LY, Wang W et al: Parthenolide ameliorates colon inflammation through regulating Treg/Th17 balance in a gut microbiota-dependent manner. Theranostics 2020, 10(12):5225-5241.
Zhu L, Xu LZ, Zhao S, Shen ZF, Shen H, Zhan LB: Protective effect of baicalin on the regulation of Treg/Th17 balance, gut microbiota and short-chain fatty acids in rats with ulcerative colitis. Appl Microbiol Biotechnol 2020, 104(12):5449-5460.
Hsieh EW, Hernandez JD: Clean up by aisle 2: roles for IL-2 receptors in host defense and tolerance. Curr Opin Immunol 2021, 72:298-308.
Li Y, Strick-Marchand H, Lim AI, Ren J, Masse-Ranson G, Dan L, Jouvion G, Rogge L, Lucas S, Bin L et al: Regulatory T cells control toxicity in a humanized model of IL-2 therapy. Nat Commun 2017, 8(1):1762.
Fasina YO, Lillehoj HS: Characterization of intestinal immune response to Clostridium perfringens infection in broiler chickens. Poult Sci 2019, 98(1):188-198.

Table 1. List of RT-qPCR primers used, with the corresponding references.

ID	Primers Sequence (5^’→3^’)	Target gene	Length
GAPDH-F	GGTGGTGCTAAGCGTGTTAT	GAPDH (K01458)	264 bp
GAPDH-R	ACCTCTGTCATCTCTCCACA
IL-1β-F	TGGGCATCAAGGGCTACA	IL-1β (Y15006)	244 bp
IL-1β-R	TCGGGTTGGTTGGTGATG
IFN-F	AGCTGACGGTGGACCTATTATT	IFN-γ (Y07922)	259 bp
IFN-R	GGCTTTGCGCTGGATTC
IL-2-F	TCTGGGACCACTGTATGCTCT	IL-2 (AF000631)	256 bp
IL-2-R	ACACCAGTGGGAAACAGTATCA
IL-13-F	CCAGGGCATCCAGAAGC	IL-13 (AJ621735)	256 bp
IL-13-R	CAGTGCCGGCAAGAAGTT
IL-17-F	CTCCGATCCCTTATTCTCCTC	IL-17 (AJ493595)	292 bp
IL-17-R	AAGCGGTTGTGGTCCTCAT
TGF-F	CGGGACGGATGAGAAGAAC	TGF-β4 (M31160)	258 bp
TGF-R	CGGCCCACGTAGTAAATGAT

Table 2. Effect of inoculated C. perfringens on chicken performance

Item	Challenged	Control	P-value
Starter phase (day 1–14)
BWG (g)	482.83±13.4^a	493.5±13.3^a	0.82
FI (g)	644.3±21.3^a	653.8±26.0^a	0.90
FCR	1.33±0.03^a	1.32±0.04^a	0.97
Finisher phase (day 1–28)
BWG (g)	966.8±22.4^a	1197.9±22.9^b	0.03
FI (g)	1545.5±36.1^a	1749.7±25.3^b	0.02
FCR	1.60±0.04^a	1.46±0.05^b	0.04

The effect of C. perfringens challenge on chicken performance at days 1 to 14 and 1 to 28. Each value is represented as the mean ± SD of triplicates, along with the corresponding P values.

Table 3. Gross intestinal pathology score

Intestinal segments	Score
Intestinal segments	Challenged	Control
Duodenum	4^a	0
Jejunum	3^a	0
cecum	6^a	0

^aIntestinal lesions with a score of 2 or more are considered NE-positive.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Analysis of immunomodulation to intestinal inflammatory injury in chickens caused by Clostridium perfringens C57-1 infection

Status:

Version 1

Abstract

Figures

Research Highlights

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1