Exploring the Pharmacological Mechanisms of Ginkgo biloba Extract in the Treatment of Sensorineural Hearing Loss

doi:10.21203/rs.3.rs-2757489/v1

Download PDF

Research Article

Exploring the Pharmacological Mechanisms of Ginkgo biloba Extract in the Treatment of Sensorineural Hearing Loss

https://doi.org/10.21203/rs.3.rs-2757489/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Backgrounds: Anincreasing people are suffering from sensorineural hearing loss (SNHL) and facing great psychological and physical stress. Although the extract of extract of Ginkgo biloba (EGb) has been widely used to treat SNHL for many years, underlying pharmacological mechanisms remain unclear.

Methods: Active ingredients of EGb and compounds targets were retrieved from Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP). SNHL-related genes were obtained from GeneCards. Venny 2.1 was used to select common targets between active ingredients of EGb and SNHL, and Gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed. Cytoscape was used to construct a network map to assess the relationship between active ingredients, interacting targets, and signaling pathways, and Chem3D, AutoDock Tools, and PyMol were employed to perform molecular docking between active ingredients and hub genes. Besides, House Ear Institute-Organ of Corti 1 (HEI-OC1) cells were treated with cisplatin and EGb to verify target genes by quantitative Real-time PCR (q-PCR).

Results: Venny diagram showing that SNHL and EGb had a total of 64 intersecting targets (core targets). The results of GO and KEGG analysis indicated that 64 core targets were involved in regulating of biological process, stabilization of cell membranes and organelles, protein binding, and diverse signaling pathways. According to the cytoscape and PPI network analyses, three genes (GSK3B, NOS3 and AKT1) and nine kinds of corresponding ingredients (kaempferol, quercetin, sesamin, luteolin, isorhamnetin, isogoycyrol, laricitrin, syringetin and chryseriol) were picked. Molecular docking demonstrates protein binding models for intersection genes and effective ingredients. Eventually, the results of q-PCR experiments further revealed that GSK3B, NOS3 and AKT1 genes exerted their functions in treatment of SNHL by EGb.

Conclusions: Our findings indicate the mechanisms of action of EGb in treating SNHL. There are five active components, including luteolin, quercetin, isorhamnetin, kaempferol, and sesamin. Those ingredients exert their effects through regulating three genes (GSK3B, NOS3 and AKT1), which are involved in the PI3K-Akt signaling pathway.

SNHL

EGb

network pharmacology

molecular docking

Sensorineural hearing loss (SNHL), characterized by varying degrees of hearing impairment, tinnitus, and vertigo in different age groups, is the most common type of permanent hearing impairment[1]. It results from damage to the hair cells in the inner ear, which can be caused by, for example, ototoxic drugs, aging, and noise exposure[2]. Apoptosis, oxidative stress damage, immune inflammation, metabolic disorders, and genetic mutations can also damage and even induce death of auditory cells, eventually resulting in hearing loss[3–5]. Because of its complex etiology, there are no effective methods for the treatment of hearing loss yet. Current therapeutic strategies confirm that Traditional Chinese Medicine (TCM) may reduce the development of hearing loss by improving microcirculation, increasing cochlear blood flow, antioxidant, anti-inflammatory, anti-apoptotic and neuroprotective activities[6]. Therefore, TCM, a relatively effective approach, provides a new strategy for the treatment of SNHL.

The extract of Ginkgo biloba (EGb) is widely used to treat many diseases, such as cardiovascular and neurodegenerative aging-related diseases[7–9]. EGb contains various chemical ingredients, such as flavonoids, terpenoid lactones, and organic acids. Such active compounds make EGb efficient in eliminating free radicals, maintaining mitochondrial membrane stability, inhibiting inflammatory factor release, combating apoptosis, and improving blood rheology[10]. In recent years, EGb has been reported to play an indispensable role in the treatment of SNHL: EGb prevented noise-induced hearing loss through protecting from noise trauma-induced cochlear ribbon synapse loss[11]; EGb prevents hearing loss in cisplatin-treated rats by inhibiting perturbation of gap junctional intercellular communication[12]. Despite this, in the context of SNHL, the potential pharmacological mechanisms of EGb still need further exploration.

Network pharmacology provides a predicative strategy to explore the therapeutic effects and mechanisms of herbs and compounds. Further, molecular docking can generate information pertaining to the active components of a drug and their targets, providing clarity on the mechanism of action of drugs. In this study, we employed network pharmacology to explore the active ingredients of EGb and targets of drug action as well as of disease, and the relationship between active ingredients and hub genes was investigated. Finally, we attempted to elucidate the pharmacological mechanisms of EGb in the treatment of SNHL (Fig. 1).

1. Active ingredients of EGb and their target prediction

According to TCMSP, 20 of the 27 active ingredients of EGb were selected and corresponding protein targets were obtained, such as quercetin, luteolin, kaempferol, isogoycyrol, stigmasterol, laricitrin, syringetin, sesamin, isorhamnetin, and beta-sitosterol. Overall, 513 targets were identified on searching in UniProtKB and database mining (seven ingredients had no related targets). At the end, 225 active targets of EGb remained after deleting duplicate values. Figure 2 shows the final relationship networks.

2. SNHL-related genes

We inputted “sensorineural hearing loss” in GeneCards, and 5,788 disease-related genes were thus obtained. The “relevance score” was set to “more than 14.08” and the top 1,450 disease targets with high scores were selected from GeneCards after calculating the median value twice in a row.

3. Structuring PPI networks between EGb compounds and SNHL

Venny 2.1 was used to find intersection targets between EGb and SNHL, which led to the identification of 64 common targets (Fig. 3). We submitted the common genes of EGb active ingredient targets and SNHL-related genes to STRING v11.5 to obtain PPI networks (Fig. 4). In conformity with PPI network data acquired via STRING, we selected the combined score top 15 interactivity genes with the highest combined score (AKT1, CCND1, CDK4, CDKN1A, EGF, GSK3B, PTEN, AHR, NOS3, ESR1, PCNA, RB1, TP53, ERBB2, and EGFR), which were considered to participate in the mechanism of EGb in the treatment of SNHL (Table 1).

Table 1: The combined score top 15 interactivity genes in STRING.

4. Enrichment analysis

To better illustrate the mechanism of EGb in /**********the treatment of SNHL, we used DAVID 6.8 to subject the 64 core targets to GO and KEGG pathway enrichment analysis. Subsequently, we selected top 10 of each GO term, including BP, CC, and MF (Fig. 5). The core genes play an important part in regulating the transcription, gene expression, stabilization of cell membranes and organelles, and protein binding. In addition, we identified top 20 results of KEGG pathway enrichment analysis. As evident from Fig. 6, 64 core targets participated in different types of cancers, parasite and virus infections, and diverse signaling pathways.

5. Network of active compounds, intersection targets, and signaling pathways

Figure 7 shows the network constructed between active ingredients of EGb and intersection genes to select gene targets that were the most likely to exert their action. Under the condition of degree value ≥ 3, closely connected points were chosen by constructing a relationship network between active ingredients of EGb and intersection genes by Cytoscape (PPAR, ESR1, SCN5A, GSK3B, GABRA1, ESR2, NOS3, CASP3, TNF, RB1, INSR, IL10, HMOX1, F2, CCND1, and AKT1).

Cytoscape and PPI network analyses led to the identification of six intersection genes: ESR1, GSK3B, NOS3, RB1, CCND1, and AKT1. The corresponding active ingredients, which included isogoycyrol, kaempferol, stigmasterol, (+)-catechin, luteolin, laricitrin, (−)-catechin, quercetin, syringetin, sesamin, chryseriol, and isorhamnetin, of hub gens were also acquired. Next, we constructed a network between active ingredients, hub targets, and pathways after determining signaling pathways of intersection targets (Fig. 8).

6. Molecular docking

After six genes (i.e., ESR1, GSK3B, NOS3, RB1, CCND1, and AKT1) were selected by Cytoscape and PPI network analyses, NOS3, AKT1, and GSK3B were eventually shortlisted by analyzing current studies related to hearing loss or inner hair cell damage. Next, the corresponding active ingredients of NOS3, AKT1, and GSK3B were determined, which included kaempferol, quercetin, sesamin, luteolin, isorhamnetin, isogoycyrol, laricitrin, syringetin, and chryseriol (Fig. 9). Finally, we detected active sites by molecular docking to elucidate the mechanism of action of these ingredients.

From an overall perspective, molecular docking data revealed that kaempferol and quercetin exerted their action in relation to AKT1 and NOS3 (Fig. 9A1-A2, B1-B2); luteolin acted on AKT1 (Fig. 9C); isorhamnetin combined with GSK3B and NOS3 (Fig. 9D1-D2); sesamin combined with NOS3 to perform diverse functions (Fig. 9E); and isogoycyrol, laricitrin, syringetin, and chryseriol were molecularly docked with GSK3B (Fig. 9F-9I).

7. Cell viability assay

According to half maximal inhibitory concentration (5.1033 ± 0.2087 ug/ml), we determined the experimental concentration of cisplatin to be 5 ug/ml (Fig. 10A). The changes of cellular activity between different treatment groups showed that the cellular activity of EGb group and EGb + Cisplatin group changed significantly compared with the control group, while the cellular proliferation activity of Cisplatin group decreased significantly; the cellular proliferation activity of EGb + Cisplatin group increased significantly compared with the Cisplatin group (Fig. 10B).

8. q-PCR

There were no significant differences in the expression of the AKT1, NOS3 and GSK3B in culture medium (DMEM) group and EGb group (Fig. 11). Compared to DMEM group, the expression level of AKT1 and NOS3 were all increased in EGb + Cisplatin group, while downregulated in the Cisplatin groups. However, the expression trend of GSK3B is the opposite of AKT1 and NOS3 (P < 0.05, all).

SNHL not only results in hearing impairment but may also lead to cognitive decline and dementia[13, 14]. Multiple strategies exist to treat SNHL, which involve steroids, drugs (for improving microcirculation), hyperbaric oxygenation, hearing aids, and cochlear implant[10, 15]. EGb is widely used to treat SNHL considering its curative properties and few side-effects. The protective effects of EGb on auditory hair cells have been established in different animal models, including ototoxicity[12, 16, 17], aging-related hearing loss[18], and noise damage[19]. However, the specific mechanism of EGb in the treatment of SNHL remains unclear. In this study, on adopting the network pharmacology approach and performing molecular docking and experimental verification, we found that EGb regulates the genes encoding AKT1, GSK3B, and NOS3 to effectively treat SNHL.

In terms of the relationship between intersection genes and drug compounds, recent studies have reported that five compounds (luteolin, quercetin, isorhamnetin, kaempferol, and sesamin) are associated with SNHL. Luteolin effectively protects against oxidative stress-induced cellular senescence through p53 and SIRT1 and has a significant therapeutic effect on age-related hearing loss[20]. Quercetin, a potent antioxidant, plays a vital role in attenuating ABR thresholds and histopathological lesions in the cochlea, conferring protection against gentamicin-induced ototoxicity in rats[21]. In addition, quercetin has been reported to play a key role in protecting against cisplatin-induced toxicity in zebrafish[22]. Isorhamnetin reportedly inhibits lipopolysaccharide-mediated inflammatory response in BV2 microglia by inactivating the NF-κB signaling pathway, blocking the TLR4 pathway, and reducing reactive oxygen species (ROS) generation[23]. Kaempferol has been found to confer protection against Dox-induced cardiotoxicity by regulating the 14-3-3γ, MAPK, and ADMA/DDAHⅡ/eNOS/NO signaling pathways, suppressing oxidative stress, and improving mitochondrial function[24]. Sesamin alters hearing loss-related gene expression levels to induce auditory-protective effects[25]. Whether other compounds have an effect on the treatment of hearing loss remains to be investigated.

In terms of BP, the target genes of EGb were associated with DNA and RNA transcription, protein phosphorylation, apoptosis inhibition, drug response, and cell proliferation regulation. In terms of CC, the core targets can stabilize the extracellular matrix, making up cell membrane, receptor complex, and the related structure of lysosome. Finally, in terms of MF, the core genes were involved in the binding of enzyme, protein, protein phosphorylation, transcription factor and the activities of cytokines, growth factors, and protein kinases. KEGG pathway enrichment analysis revealed that hub genes were associated with many types of cancers and tumors, chemical carcinogenesis, hepatitis B/C, lipid accumulation and atherosclerosis, influenza, tuberculosis, parasite and virus infections, and diverse cell signaling pathways. Based on our results and findings reported by relevant published studies, we found that EGb mediates the PI3K–Akt signaling pathway, chemical carcinogenesis-receptor activation, and chemical carcinogenesis–ROS by regulating AKT1, GSK3B, and NOS3 genes.

Drug-related hearing loss, a type of SNHL, can be caused by certain classes of chemotherapeutics[26–29]. Herein we treated HEI-OC1 cells with cisplatin to verify our results. q-PCR data indicated that the expression levels of AKT1, NOS3, and GSK3B were upregulated in the cisplatin group and downregulated in the group which mixed the cisplatin and EGb. Our experimental findings confirmed that AKT1, NOS3, and GSK3B genes play an important role in SNHL treatment. AKT1 is reportedly involved in, for example, AKT–NRF2–HO-1 and PI3K/AKT signaling pathways in cochlear cells. The enhancement of the AKT–NRF2–HO-1 pathway protects hair cells against oxygen/glucose deprivation-induced ototoxicity; activated NRF2 binds to downstream genes to promote inner hair cells to trigger an antioxidative reaction against cell damage by ROS[30]. The expression level of AKT1 was upregulated on treatment with cisplatin, which may be related to an increase in ROS levels in hair cells. The PI3K/AKT signaling pathway plays a pivotal role in the mechanism of hearing loss. Keeping the PIP3 in a low level may inhibit the actions of the PIP3/Akt signaling pathway, resulting in the damage and even death of outer hair cells[31]. In addition, it is reported that inhibition of the activities of PIP3/Akt pathway may contribute to a decline of the viability of aging outer hair cells[32], and enhance the sensitivity to noise-induced hearing loss caused by temporary-threshold-shift-inducing noise[33]. In summary, if the activities of the PI3K/AKT signaling pathway are inhibited, hair cell death can be induced to a greater extent. As a negative regulator, GSK3B plays a key role in hearing loss. Selective GSK3B inhibitors decrease cisplatin-induced auditory cell damage[34], and GSK3B downregulation has been found to attenuate cisplatin-induced ototoxicity by enhancing autophagy[35]. Therefore, HEI-OC1 cell death could be associated with GSK3B activation in the cisplatin group and the expression level of GSK3B is decreased after treated by EGb. In addition, activation of the PI3K/AKT/GSK3B signaling pathway has been associated with protection against glutamate-induced neurotoxicity[36]. NOS3, an isoform of NOS enzyme, is expressed in outer hair cells, supporting cells and spiral ganglion cells in the human cochlea[37]. The main function of NOS3 gene is to catalyze the synthesis of nitric oxide (NO), which can inhibit the rapid repolarization of potassium ions current and lead to high frequency hearing damage[38]. Therefore, inhibition of NOS3 can reduce the synthesis of NO to protect hearing. Moreover, eNOS3 gene evidently participates in microvascular damage in sudden sensorineural hearing loss patients[39]. The survival of inner cells is associated with blood flow and vascular lesions, and activation of the ROS/PI3K/AKT/eNOS signaling pathway at the early stage confers protection against apoptosis due to high glucose levels in vascular endothelial cells[40].

In this study, we clarified that Ginkgo biloba extract may be involved in the protection of hair cells through the regulation of AKT1, NOS3 and GSK3B by five components (luteolin, quercetin, isorhamnetin, kaempferol, and sesamin), thus treating sensorineural deafness by a network pharmacology approach. We determined the binding activity of the active ingredient of EGb to genes by molecular docking. The result of CCK-8 indicated that EGb exerted a protective effect by acting directly on the cochlear hair cells. Eventually, the results of AKT1, NOS3 and GSK3B genes expression were examined by q-PCR, demonstrating that the relevant effects of Ginkgo biloba extract may be related to AKT1, NOS3 and GSK3B. In combination with previous studies, we speculate that the regulation of expression of these genes may be related to the PI3K-Akt signaling pathway. The specific mechanism of action of this study still needs to be further explored.

Herein we adopted the network pharmacology approach to investigate the molecular mechanisms of EGb in the treatment of SNHL. Our findings suggest that the pharmacological mechanisms of EGb in the treatment of SNHL may be related to the regulation of GSK3B, NOS3 and AKT1 genes by five ingredients (luteolin, quercetin, isorhamnetin, kaempferol, and sesamin) to mediate the PI3K-Akt signaling pathway. However, further studies are warranted to validate our results.

1. Screening chemical components of EGb

The active ingredients of EGb were retrieved from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) [41] (http://lsp.nwsuaf.edu.cn/tcmsp.php). TCMSP is a robust systems pharmacology platform for TCM; data pertaining to oral bioavailability, drug likeness, blood–brain barrier permeability, intestinal epithelial permeability and aqueous solubility can be easily obtained from TCMSP[42]. The threshold for screening bioactive compounds was set as oral bioavailability ≥ 30% and drug likeness ≥ 0.18[43].

Target proteins chosen from TCMSP were converted to their official symbols using UniProt knowledge base[44] (UniProtKB, http://www.uniprot.org/), which is a comprehensive, high-quality, and freely accessible resource of protein sequences and functional annotation. In addition to capturing the core data mandatory for each UniProtKB entry (mainly including amino acid sequence, protein name or description and taxonomic data), much annotation information was also added. Finally, the gene name of each target protein was obtained from UniProtKB.

2. Searching for targets and genes of SNHL

GeneCards (https://www.genecards.org/) extracts and integrates gene-related data, including genomic, transcriptomic, proteomic, genetic, clinical and functional information; thus, it is widely used in the field of biology and medicine[45]. The targets and genes of SNHL were selected from GeneCards on the basis of “relevance score”.

3. Acquisition of interaction targets and construction of protein–protein interaction (PPI) networks

Venny 2.1 (https://bioinfogp.cnb.csic.es/tools/venny) was used to identify common targets between the active ingredients of EGb and SNHL and to plot a Venn diagram. Next, the intersection targets were submitted to STRING 11.5[46] (https://string-db.org) and a network model depicting protein interaction was constructed. To obtain relatively accurate PPI networks, the minimum interaction threshold was set to “highest confidence” (> 0.9), with unconnected nodes being hidden and keeping the remaining parameters at the default setting.

4. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis

For the functional and pathway enrichment analyses of target genes, we used Database for Annotation, Visualization, and Integrated Discovery (DAVID) v6.8[47]. Function annotations including biological process (BP), cellular component (CC) and molecular function (MF) were extracted from GO enrichment analysis, KEGG was used to identify and analyze significant gene enrichment pathways. DAVID, a popular web-based bioinformatics resource system, provides a comprehensive set of functional annotation tools, which enables us to better understand the biological significance of genes. The intersection targets between EGb and SNHL were imported into DAVID, and pathway enrichment data were eventually obtained.

5. Structuring network to evaluate the relationship between active ingredients, target genes, and signaling pathways

To construct a network map to assess the association between active ingredients, target genes and signaling pathways, we used Cytoscape v3.8.0[48], which is an open-source software platform for visualizing complex networks and integrating them with any type of attribute data. Finally, interacting networks were screened from Cytoscape based on association between ingredients, targets and pathway.

6. Molecular docking

After acquiring active compounds and target genes, molecular ID was retrieved from TCMSP and UniProtKB databases. Then, the molecular ID of active ingredients was searched in PubChem[49] (https://pubchem.ncbi.nlm.nih.gov/) and entry numbers were inputted into Protein Data Bank[50] (http://www.pdb.org). According to the processing results of Chem3D 15.1.0.114, AutoDock Tools 1.57, and AutoDock Vina 1.1.2, the molecular structure had to be adjusted so as to visualize docking results through PyMol. Chem3D is used for energy minimization and to convert SDF format into MOL2 format files. AutoDock Tools was utlilized to acquire the receptors and ligand standard format by regulating the drug active compounds and hub targets. Lastly, AutoDock Vina, which is based on Python, is commonly used for molecular docking; docking results can be eventually visualized via PyMol.

7. Experimental verification

7.1. Drugs and reagents

The House Ear Institute-Organ of Corti 1 (HEI-OC1) cells were purchased from MlBIO (Shanghai, China), cisplatin from Absin (Shanghai, China), and EGb (EGb761) from Dr. Willmar Schwabe GmbH & Co. KG (Taiwan). Fetal bovine serum and high-glucose media were obtained from BI (Shanghai, China), and Cell Counting Kit-8 (CCK-8) and semi-quantitative reverse-transcriptase PCR-related reagents were purchased from SparkJade (Qingdao, Shandong, China).

7.2. Cell culture

Frozen HEI-OC1 cells were recovered and suspended in high-glucose media containing 10% fetal bovine serum. Cells were differentiated at 33℃ in the absence of antibiotics, and then cultured at 33℃ and 10% carbon dioxide tanks with six-hole plates, fluid change every 1–2 days and transferred to 1:3 with cell density close to 85%.

7.3. CCK-8 assay to assess HEI-OC1 cell viability

HEI-OC1 cells treated with different drugs were digested with 0.25% trypsin. After culturing in high-glucose media for 6 h, HEI-OC1 cells (10,000 cells/well) were seeded in 96-well flat-bottom plates. According to the instruction of EGb injection, 30 ug/ml EGb was selected as the experimental concentration. To determine appropriate experimental concentration of cisplatin, we designed different concentration groups (10, 8, 5, 3 and 1 µg/mL cisplatin) and assayed the proliferative activity of the cells. We tested whether Ginkgo biloba extract at experimental concentrations could protect hair cells by measuring cell proliferation activity. A control group was established by culturing cells in high-glucose media; EGb group were established by 30 µg/mL EGb; cisplatin group were established by appropriate concentration of cisplatin; EGb + Cisplatin group were treated by appropriate concentration of cisplatin and EGb. After HEI-OC1 cells were cultured in 100 µL media for 48 h, the original medium was replaced with a mixture of 10 µL CCK-8 solution and 90 µL culture medium, followed by incubation under suitable conditions for 1 h. Finally, the experimental concentration was chosen after measuring optical density at 450 nm using a spectrophotometer.

7.4. Quantitative real-time PCR (q-PCR) to assess gene expression levels

We selected relevant gene targets based on degree values for q-PCR analyses. Total RNA was extracted from the aforementioned groups using TRIzol, as per manufacturer instructions. RNA was reverse transcribed into cDNA using a Superscript II Reverse Transcription kit, followed by q-PCR, which was performed on a Step One real-time PCR system. The sequences of the tested genes are as follows:

AKT1

Forward: ATGAACGACGTAGCCATTGTG

Reverse: TTGTAGCCAATAAAGGTGCCAT

NOS3

Forward: GGCTGGGTTTAGGGCTGTG

Reverse: CTGAGGGTGTCGTAGGTGATG

GSK3B

Forward: TGGCAGCAAGGTAACCACAG

Reverse: CGGTTCTTAAATCGCTTGTCCTG

GAPDH

Forward: GTCTCCTCTGACTTCAACAGCG

Reverse: ACCACCCTGTTGCTGTAGCCAA

8 Statistical methods

Statistical analysis was performed using GraphPad Prism (version 9.0). For qPCR results, one-way ANOVA was used to compare between two data. P < 0.05 was considered to be statistically significant. In molecular docking, the binding energy of ligand and receptor is considered to have good binding capacity at more than − 5.0 kcal/mol[51].

SNHL: Sensorineural hearing loss;

TCM: Chinese Medicine;

EGb: The extract of Ginkgo biloba;

TCMSP: Pharmacology Database and Analysis Platform;

UniProtKB: UniProt knowledge base;

GO: Gene ontology;

KEGG: Kyoto Encyclopedia of Genes and Genomes;

DAVID: Database for Annotation, Visualization, and Integrated Discovery;

BP: biological process;

CC: cellular component;

MF: molecular function;

PPI: protein–protein interaction;

HEI-OC1: The House Ear Institute-Organ of Corti 1;

CCK-8: Cell Counting Kit-8;

q-PCR: Quantitative real-time PCR.

Data Availability

The corresponding data used to support the findings of this study are included within the supplementary information files.

Conflicts of Interest

The authors declare no conflict of interest.

Ethics and Consent to Participate

Not applicable.

Consent for publication

Not applicable.

Funding Statement

1.Natural Science Foundation of Shandong Province (ZR2021MH378)

2.Natural Science Foundation of Shandong Province (ZR2022QH073)

Acknowledgments

We would like to thank all members for their efforts and contributions to this study.

Supplementary Materials

Table S1：Active Ingredients and Corresponding Gene Targets;

Table S2：Sensorineural Hearing Loss Gene Targets;

Table S3：Intersection genes between SNHL and EGb;

Table S4：BP, CC, MF-Bubble Diagram Data;

Table S5：KEGG Enrichment Analysis;

Table S6：STRING Analysis;

Table S7：Degree Values of Cytoscape.

Author Contributions

GL and YS: Conceptualization; GL and CW: Data acquisition; GL and JQ: Data analysis; JW and LMC: Experiment; GL, JW and LMC: Experimental data processing; GL and JQ: Software; LC, LMC, JW, XS, YY and YS: Supervision; LMC, JW and LC: Validation; GL, JQ and CW: Visualization; GL, JQ and CW: Writing—original draft; XS, YY and YS: Writing—review and editing.

Agarwal L, Pothier DD. Vasodilators and vasoactive substances for idiopathic sudden sensorineural hearing loss. Cochrane Database Syst Rev. 2009;CD003422.
Wu J, Ye J, Kong W, Zhang S, Zheng Y. Programmed cell death pathways in hearing loss: A review of apoptosis, autophagy and programmed necrosis. Cell Prolif. 2020;53:e12915.
Vlajkovic SM, Thorne PR. Molecular Mechanisms of Sensorineural Hearing Loss and Development of Inner Ear Therapeutics. Int J Mol Sci. 2021;22:5647.
Bai L, Wang M, Zhang S, Yue M, Guo Y, Wang P, et al. AT1-receptor autoantibody exposure in utero contributes to cardiac dysfunction and increased glycolysis in fetal mice. Acta Biochim Biophys Sin. 2020;52:1373–81.
Zhao Y, Bai Y, Li Y, Dong Y, Guo Y, Wang W, et al. Disturbance of myocardial metabolism participates in autoantibodies against β1 -adrenoceptor-induced cardiac dysfunction. Clin Exp Pharmacol Physiol. 2021;48:846–54.
Castañeda R, Natarajan S, Jeong SY, Hong BN, Kang TH. Traditional oriental medicine for sensorineural hearing loss: Can ethnopharmacology contribute to potential drug discovery? J Ethnopharmacol. 2019;231:409–28.
Singh SK, Srivastav S, Castellani RJ, Plascencia-Villa G, Perry G. Neuroprotective and Antioxidant Effect of Ginkgo biloba Extract Against AD and Other Neurological Disorders. Neurother J Am Soc Exp Neurother. 2019;16:666–74.
Tian J, Liu Y, Chen K. Ginkgo biloba Extract in Vascular Protection: Molecular Mechanisms and Clinical Applications. Curr Vasc Pharmacol. 2017;15:532–48.
Zuo W, Yan F, Zhang B, Li J, Mei D. Advances in the Studies of Ginkgo Biloba Leaves Extract on Aging-Related Diseases. Aging Dis. 2017;8:812–26.
Wang QL, Zhang MX, Wang QL, Guo, XD. Research progress on the mechanism of action of Ginkgo biloba extract against inner ear diseases. J Chinese Traditional Patent Medicine. 2022,44:3249–3253.
Tziridis K, Schulze H. Preventive Effects of Ginkgo-Extract EGb 761® on Noise Trauma-Induced Cochlear Synaptopathy. Nutrients. 2022;14:3015.
Choi SJ, Kim SW, Lee JB, Lim HJ, Kim YJ, Tian C, et al. Gingko biloba extracts protect auditory hair cells from cisplatin-induced ototoxicity by inhibiting perturbation of gap junctional intercellular communication. Neuroscience. 2013;244:49–61.
Deal JA, Sharrett AR, Albert MS, Coresh J, Mosley TH, Knopman D, et al. Hearing impairment and cognitive decline: a pilot study conducted within the atherosclerosis risk in communities neurocognitive study. Am J Epidemiol. 2015;181:680–90.
Leverton T. Hearing loss is important in dementia. BMJ. 2015;350:h3650.
Agarwal L, Pothier DD. Vasodilators and vasoactive substances for idiopathic sudden sensorineural hearing loss. Cochrane Database Syst Rev. 2009;CD003422.
Huang X, Whitworth CA, Rybak LP. Ginkgo biloba extract (EGb 761) protects against cisplatin-induced ototoxicity in rats. Otol Neurotol Off Publ Am Otol Soc Am Neurotol Soc Eur Acad Otol Neurotol. 2007;28:828–33.
Tian CJ, Kim YJ, Kim SW, Lim HJ, Kim YS, Choung Y-H. A combination of cilostazol and Ginkgo biloba extract protects against cisplatin-induced Cochleo-vestibular dysfunction by inhibiting the mitochondrial apoptotic and ERK pathways. Cell Death Dis. 2013;4:e509.
Nevado J, Sanz R, Sánchez-Rodríguez C, García-Berrocal JR, Martín-Sanz E, González-García JA, et al. Ginkgo biloba extract (EGb761) protects against aging-related caspase-mediated apoptosis in rat cochlea. Acta Otolaryngol (Stockh). 2010;130:1101–12.
Tziridis K, Korn S, Ahlf S, Schulze H. Protective effects of Ginkgo biloba extract EGb 761 against noise trauma-induced hearing loss and tinnitus development. Neural Plast. 2014;2014:427298.
Zhu RZ, Li BS, Gao SS, Seo JH, Choi B-M. Luteolin inhibits H2O2-induced cellular senescence via modulation of SIRT1 and p53. Korean J Physiol Pharmacol Off J Korean Physiol Soc Korean Soc Pharmacol. 2021;25:297–305.
Lee SK, Oh KH, Chung AY, Park HC, Lee SH, Kwon SY, et al. Protective role of quercetin against cisplatin-induced hair cell damage in zebrafish embryos. Hum Exp Toxicol. 2015;34:1043–52.
Sagit M, Korkmaz F, Gürgen SG, Gundogdu R, Akcadag A, Ozcan I. Quercetine attenuates the gentamicin-induced ototoxicity in a rat model. Int J Pediatr Otorhinolaryngol. 2015;79:2109–14.
Kim SY, Jin C-Y, Kim CH, Yoo YH, Choi SH, Kim G-Y, et al. Isorhamnetin alleviates lipopolysaccharide-induced inflammatory responses in BV2 microglia by inactivating NF-κB, blocking the TLR4 pathway and reducing ROS generation. Int J Mol Med. 2019;43:682–92.
Wu W, Yang B, Qiao Y, Zhou Q, He H, He M. Kaempferol protects mitochondria and alleviates damages against endotheliotoxicity induced by doxorubicin. Biomed Pharmacother Biomedecine Pharmacother. 2020;126:110040.
Kim YH, Kim EY, Rodriguez I, Nam YH, Jeong SY, Hong BN, et al. Sesamum indicum L. Oil and Sesamin Induce Auditory-Protective Effects Through Changes in Hearing Loss-Related Gene Expression. J Med Food. 2020;23:491–8.
Das N, Kaushal D, Patro SK, Pareek P, Dixit A, Soni K, et al. Relative contributions of radiation and cisplatin-based chemotherapy to sensorineural hearing loss in head-and-neck cancer patients. Acta Otolaryngol (Stockh). 2021;141:885–93.
Wang J, Tian K-Y, Fang Y, Chang H-M, Han Y-N, Chen F-Q. Sulforaphane attenuates cisplatin-induced hearing loss by inhibiting histone deacetylase expression. Int J Immunopathol Pharmacol. 2021;35:20587384211034090.
Mukherjea D, Jajoo S, Whitworth C, Bunch JR, Turner JG, Rybak LP, et al. Short interfering RNA against transient receptor potential vanilloid 1 attenuates cisplatin-induced hearing loss in the rat. J Neurosci Off J Soc Neurosci. 2008;28:13056–65.
Freyer DR, Brock P, Knight K, Reaman G, Cabral S, Robinson PD, et al. Interventions for cisplatin-induced hearing loss in children and adolescents with cancer. Lancet Child Adolesc Health. 2019;3:578–84.
Zhu W-Y, Jin X, Ma Y-C, Liu Z-B. MIF protects against oxygen-glucose deprivation-induced ototoxicity in HEI-OC1 cochlear cells by enhancement of Akt-Nrf2-HO-1 pathway. Biochem Biophys Res Commun. 2018;503:665–70.
Jiang H, Sha S-H, Schacht J. Kanamycin alters cytoplasmic and nuclear phosphoinositide signaling in the organ of Corti in vivo. J Neurochem. 2006;99:269–76.
Sha S-H, Chen F-Q, Schacht J. PTEN attenuates PIP3/Akt signaling in the cochlea of the aging CBA/J mouse. Hear Res. 2010;264:86–92.
Chen J, Yuan H, Talaska AE, Hill K, Sha S-H. Increased Sensitivity to Noise-Induced Hearing Loss by Blockade of Endogenous PI3K/Akt Signaling. J Assoc Res Otolaryngol JARO. 2015;16:347–56.
Park H-J, Kim H-J, Bae G-S, Seo S-W, Kim D-Y, Jung W-S, et al. Selective GSK-3beta inhibitors attenuate the cisplatin-induced cytotoxicity of auditory cells. Hear Res. 2009;257:53–62.
Liu T, Zong S, Luo P, Qu Y, Wen Y, Du P, et al. Enhancing autophagy by down-regulating GSK-3β alleviates cisplatin-induced ototoxicity in vivo and in vitro. Toxicol Lett. 2019;313:11–8.
Hu S, Cui W, Mak S, Tang J, Choi C, Pang Y, et al. Bis(propyl)-cognitin protects against glutamate-induced neuro-excitotoxicity via concurrent regulation of NO, MAPK/ERK and PI3-K/Akt/GSK3β pathways. Neurochem Int. 2013;62:468–77.
Popa R, Anniko M, Takumida M, Arnold W. Localization of nitric oxide synthase isoforms in the human cochlea. Acta Otolaryngol (Stockh). 2001;121:454–9.
Kimitsuki T. Nitric oxide influences potassium currents in inner hair cells isolated from guinea-pig cochlea. Auris Nasus Larynx. 2015;42:360–4.
Yazdani N, Kakavand Hamidi A, Soroush N, Jalili N, Vahidi A, Zarabi Ahrabi N, et al. eNOS gene Glu298Asp variant confer risk in sudden sensorineural hearing loss. Acta Otolaryngol (Stockh). 2018;138:904–8.
Ho FM, Lin WW, Chen BC, Chao CM, Yang C-R, Lin LY, et al. High glucose-induced apoptosis in human vascular endothelial cells is mediated through NF-kappaB and c-Jun NH2-terminal kinase pathway and prevented by PI3K/Akt/eNOS pathway. Cell Signal. 2006;18:391–9.
Ru J, Li P, Wang J, Zhou W, Li B, Huang C, et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J Cheminformatics. 2014;6:13.
Lee AY, Park W, Kang T-W, Cha MH, Chun JM. Network pharmacology-based prediction of active compounds and molecular targets in Yijin-Tang acting on hyperlipidaemia and atherosclerosis. J Ethnopharmacol. 2018;221:151–9.
Xu X, Zhang W, Huang C, Li Y, Yu H, Wang Y, et al. A novel chemometric method for the prediction of human oral bioavailability. Int J Mol Sci. 2012;13:6964–82.
Boutet E, Lieberherr D, Tognolli M, Schneider M, Bairoch A. UniProtKB/Swiss-Prot. Methods Mol Biol Clifton NJ. 2007;406:89–112.
Stelzer G, Rosen N, Plaschkes I, Zimmerman S, Twik M, Fishilevich S, et al. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr Protoc Bioinforma. 2016;54:1.30.1–1.30.33.
Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019;47:D607–13.
Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44–57.
Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–504.
Kim S, Thiessen PA, Bolton EE, Chen J, Fu G, Gindulyte A, et al. PubChem Substance and Compound databases. Nucleic Acids Res. 2016;44:D1202-1213.
Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. The Protein Data Bank. Nucleic Acids Res. 2000;28:235–42.
Hsin K-Y, Ghosh S, Kitano H. Combining Machine Learning Systems and Multiple Docking Simulation Packages to Improve Docking Prediction Reliability for Network Pharmacology. Fraternali F, editor. PLoS ONE. 2013;8:e83922.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Exploring the Pharmacological Mechanisms of Ginkgo biloba Extract in the Treatment of Sensorineural Hearing Loss

Status:

Version 1

Abstract

Figures

Background

Results

1. Active ingredients of EGb and their target prediction

2. SNHL-related genes

3. Structuring PPI networks between EGb compounds and SNHL

4. Enrichment analysis

5. Network of active compounds, intersection targets, and signaling pathways

6. Molecular docking

7. Cell viability assay

8. q-PCR

Discussion

Conclusions

Methods

1. Screening chemical components of EGb

2. Searching for targets and genes of SNHL

3. Acquisition of interaction targets and construction of protein–protein interaction (PPI) networks

4. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis

5. Structuring network to evaluate the relationship between active ingredients, target genes, and signaling pathways

6. Molecular docking

7. Experimental verification

7.1. Drugs and reagents

7.2. Cell culture

7.3. CCK-8 assay to assess HEI-OC1 cell viability

7.4. Quantitative real-time PCR (q-PCR) to assess gene expression levels

AKT1

NOS3

GSK3B

GAPDH

8 Statistical methods

Abbreviations

Declarations

Data Availability

Conflicts of Interest

Ethics and Consent to Participate

Consent for publication

Funding Statement

Acknowledgments

We would like to thank all members for their efforts and contributions to this study.

Supplementary Materials

Author Contributions

References

Additional Declarations

Supplementary Files

Status:

Version 1