Contribution to the Knowledgment of Feeding Habbits of Lutzomyia (Lutzomyia) Longipalpis (Lutz &amp; Neiva, 1912) in Association to Natural Infection by Leishmania (Leishmania) Infantum Chagasi (Cunha &amp; Chagas, 1937)

doi:10.21203/rs.3.rs-27579/v1

Download PDF

Research

Contribution to the Knowledgment of Feeding Habbits of Lutzomyia (Lutzomyia) Longipalpis (Lutz & Neiva, 1912) in Association to Natural Infection by Leishmania (Leishmania) Infantum Chagasi (Cunha & Chagas, 1937)

https://doi.org/10.21203/rs.3.rs-27579/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 15 Jun, 2020

You are reading this latest preprint version

Background: Brazil faces the expansion and urbanization of American Visceral Leishmaniasis. The presence of the vector in the urban area is one of the major challenges of the Brazilian Program for Control of Visceral Leishmaniasis, which refers the need for a better understanding the behavior of Lutzomyia longipalpis, as well as the factors of its adaptation to new habitats. The aim of the study was to combine diagnostic molecular tools capable to identifying natural infection by Leishmania (L.) infantum chagasi and the origin of food sources in L. longipalpis.

Methods: The specimens were captured in the municipalities of Araguaína/Tocantins, Fortaleza/Ceará, Sobral/Ceará, and Rio de Janeiro/Rio de Janeiro. Molecular diagnoses were performed through Polymerase Chain Reaction using primers that amplify kinetoplast deoxyribonucleic acid in Leishmania sp. and the cacophony gene in phlebotomines for the diagnosis of natural infection, primers that amplify the cytochrome b gene, in addition to the sequencing technique, for the study of alimentary habit.

Results: Among the analyzed females, 28.6% were diagnosed in the food evaluation. Among the total of 141 samples that were analyzed, showed a higher positivity for the human food source (62.5%), followed by dogs (27.5%) and birds (10%). In Araguaína, the samples showed positivity for human blood (61.5%) and dogs (38.5%). In Fortaleza and Sobral, specimens showed a positive percentage for human blood (54.5% and 66.7%), followed by dogs (27.3% and 20.0%) and birds (18.2% and 13.3%). In the females of Rio de Janeiro was detected exclusive feeding of human blood. In the natural infection, a general index of positivity was obtained equal to 4.3%. When associated, detection of the power source and natural infection, two infected specimens were found in Araguaína, with dog and human feeding; and in Sobral, 3 specimens infected and positive for human blood.

Conclusions: The results corroborate with studies that demonstrate the eclecticism and food opportunism of L. longipalpis, as well as their occurrence in several environments, which are determinant factors of the important process of domiciliary vectorization. The low positivity feeding on human blood may suggest that other mammals, possibly rodents, would be acting as a food source.

Parasitology

Lutzomyia (Lutzomyia) longipalpis

Feeding Habits

Infection of Leishmania (L.) infantum chagasi

American Visceral Leishmaniasis

In a global setting, leishmaniasis is among the most neglected diseases [1]. Leishmaniases are emerging endemic in Brazil, being the country with the highest prevalence of those diseases in the Americas [2,3].

In the context of the expansion and the urbanization of American Visceral Leishmaniasis (AVL), with a high case fatality rate, Brazil has not been successful in actions to combat the vector, although it has a well elaborated planning with well defined policies of surveillance and control. It is hypothesized that the presence of the vector in the urban area is one of the major challenges for the Brazilian Visceral Leishmaniasis Control Program, which clearly points to the need to better understand the behavior of Lutzomyia (Lutzomyia) longipalpis, in the urban area and the factors of its adaptation to the new habitats, which is unequivocal proof of its ecological valence.

The knowledge of the eating habits of phlebotomines, which are leishmaniasis vectors, can help in the use of more adequate and effective measures for their control, thus prompting the understanding of their adaptation to affected environments and the acceptance of different dietary sources, which are probable determinants of LVA expansion [4-17].

The present study aims to associate molecular diagnostic tools capable of identifying natural infection by Leishmania (Leishmania) infantum chagasi and the origin of the food source in L. (L.) longipalpis specimens from municipalities with different AVL transmission profiles: Araguaína/Tocantins (intense transmission area, urban profile), Fortaleza/Ceará (intense transmission area, urban profile), Sobral/Ceará (intense transmission area, rural profile), and Rio de Janeiro/Rio de Janeiro sporadic transmission, urban profile). It is worth mentioning that the focus on the locality of Caju, a port area, is the first urban focus of the city of Rio de Janeiro. Finally, we intend to define and better elucidate aspects concerning the epidemiology of AVL in different transmission areas with different epidemiological profiles in Brazil.

Municipalities of the origin of the specimens. The municipalities were chosen according to the categorization of AVL transmission and epidemiological profile [3] (Figures 1).

Catch stations. The catch sites were defined considering Probable Infection Sites and sites whose entomological survey had previously identified the presence of L. (L.) longipalpis. Phlebotomines were captured using modified CDC (Centers for Disease Control) light traps [18] (HP model, Hoover Pugedo) [19]. The traps were randomly installed from 6:00 p.m. to 6:00 a.m., in the peridomiciliary environment during the years of 2013 and 2016, in periods which were favorable to productive catches. The specimens were identified according to the Galati criteria [20]. Females from all municipalities, containing blood residues and males (used as negative control), were individualized in eppendorf tubes and stored in freezer -200C, with the exception of one sample from the city of Rio de Janeiro, which was analyzed as a pool (10 copies).

Molecular analyses

Obtaining total extract. The samples were analyzed in 100 μl of lysis buffer (10 mM Tris-HCl pH 9.2 containing 10 mM EDTA and 100 μg/ml proteinase K) and stored (-20 ° C) until extraction of the total deoxyribonucleic acid (DNA). DNA Extraction DNA extraction was performed from the lysates using the Wizard SV Genomic DNA Purification System (PROMEGA) commercial kit, according to the manufacturer's specifications. All the steps for DNA extraction were monitored by the inclusion of samples for negative control (male insects captured in the field). Such samples determine the control to possible contaminations, since they do not present DNA of Leishmania spp. The laminar fluxes proper for DNA extraction, as well as all the material used during DNA extraction, were properly decontaminated with the use of chlorine and exposure to ultraviolet rays [21,22].

Diagnosis of Natural Infection. For the analysis of natural infection, the Polymerase Chain Reaction (PCR) technique was utilized, where a multiplex assay was used [21] via two pairs of primers that amplified simultaneously. A first 120 bp product for Leishmania kDNA (samples of positive females) and another of 220 bp corresponding to phlebotomine DNA (samples of males and females). The first pair amplifies the constant region of the mini-circle of kDNA of the genus Leishmania; primer A [5 'GGC CCA TAC TAC ACC AAC CCC 3'] and primer B [5 'GGG GTA GGG GCG TTC TGC GAA 3'] [23]; the second pair amplifies a specific constituent gene of phlebotomines (cacophony): 5Llcac [5'GTG GCC GAA CAT AAT GTT AG 3'] and 3Llcac [5'CCA CGA ACA AGT TCA ACA TC 3'] [24]. The amplified products were visualized by 2% agarose gel electrophoresis stained with Nancy. Dot-Blot. The amplified product (positive samples) in the PCR was also analyzed by solid phase hybridization with 25 pmol/μL of the subgenus-specific or species-specific probe labeled with 5'-biotin for Leishmania (L.) infantum chagasi, primer [5'AAAAATGGGTGCAGAAAT3 '] (Table 1). The hybridization reaction was developed with chemiluminescence solution.

Analysis of the Eating Habits. To evaluate eating habits, only engorged females or blood residues were analyzed, where five pairs of primers were used [25,26] for Homo sapiens (first A: 5 'ATACGCAAAATTAACCCCCTAATAA 3' and first B: 5 'ATG TTT CAG GCT TCT GAG TAG AGA A 3 '), Canis lupus familiaris (first A: 5' CTA ACA TCT CTG CTT GAT GGA ACT T3 'and primer B: 5' TGC GAA TAA TAG TAC AAT TCC AAT G 3 '), Didelphis albiventris (first A: 5 'TAT GCC TAA TTA TTA TCC AAA TC 3' and primer B: 5 'AAA GCC ACC CTA ACC CGA TT 3') and Gallus gallus (primer A: 5'AATTAACAACTCCCTAATCGACCTC 3 'and primer B: 5 'TGTGAAGGAAGATACAGATGAAGAA 3'). The choice of targets was based on the animals that have some relation with the epidemiology of AVL; birds, because it is known that coops near houses act as an attractive for phlebotomines, as well as functioning as breeding grounds, which facilitates the domiciliation of the vector [27]; dogs, which are considered important domestic reservoirs [17] and the opossums suggested as possible reservoirs [2], and in addition to these, humans. Primers that amplify a region of the cytochrome b (cyt b) gene were also used for all vertebrates: 3'CCC CTC AGA ATG ATA TTT GTC CTC 5 'and 3' CCA TCC AAC ATC TCA GCA TGA TGA AA 5 '(Table 1).

Sequencing - Given the importance of the first urban focus in the city of Rio de Janeiro (Porto area), a new methodology was applied to part of its samples (total of seven individualized samples and one pooled sample). The products obtained for the cyt b gene, obtained by the above methodology, were purified using the Wizard SV PCR Clean-up System kit (Promega), then sequenced with the same primers used for PCR. Sequencing was performed in an automatic sequencer (ABI PRISM ® BigDye ™ Terminator Cycle Sequencing) at Oswaldo Cruz Foundation (IOC) (Genomic Platform - DNA sequencing, PDTIS-FIOCRUZ). The sequences obtained were aligned and compared with those already deposited in the NCBI nucleotide database (http://blast.ncbi.nlm.nih.gov/Blast).

Identification of eating habits

From the total of L. (L.) longipalpis females tested (141), a general positivity index of 29.3% was obtained, with the municipality of Sobral having the highest index, 36.6%. In none of the localities multiple feeds were observed (Table 2).

The different populations of L. (L.) longipalpis presented a constant pattern of blood tests in the digestive tract, with a higher positivity for human blood (63.4%), followed by dogs (26.8%) and birds (9,8%); no females fed on opossum were found (Table 3, Fig. 2).

In Araguaína, the samples showed positivity for human blood (61.5%), followed by dogs (38.5%).

The samples from Ceará, Fortaleza and Sobral presented a higher percentage of positivity for human blood (54.5% and 66.7%), followed by dogs (27.3% and 20.0%) and birds (18.2% % and 13.3%) (Table 3).

From the positive samples for the city of Rio de Janeiro, only positive results were obtained for human blood (100%). These samples had their results sequenced, one sample analyzed individually (identity index equal to 96%, Query Cover value of 94% and Accession number: KX697544.1), and one sample in the form of a pool equal to 98%, Query Cover value of 97% and Accession number: KX697544.1), although in the pool there were 10 females for evaluations and in order to avoid any false positive result in the pool, only one female was considered positive (Table 3).

Identification of the natural infection by Leishmania (Leishmania) infantum chagasi

One of the analyzed specimens was obtained with a general index of positivity of 4.3%. A total of 6 positive specimens were found, with a positive index of 4.9% in Araguaína and 9.8% in Sobral (Table 4, Figs. 3, 4). In the municipalities of Fortaleza and Rio de Janeiro, no positive females were detected for L. (L.) infantum chagasi.

Association between identification of eating habits and natural infection

In 141 female L. (L.) longipalpis, in 5 (3.6%) specimens, natural infection and the food source were identified, four of which were fed in human blood and one in dog blood (Table 5).

In the municipality of Araguaína, a L. (L.) longipalpis female was found infected with L. (L.) infantum chagasi fed on dog blood and a female fed on human blood. In the municipality of Sobral, 3 females were naturally infected and fed on human blood, and one female with unidentified food source (Table 5).

Several methods are used to identify eating habits in phlebotomines, such as immunological methods, through the precipitin technique [4, 8, 11, 28–30] and immunoenzymatic tests [7, 9, 15, 31–32]; and recently molecular methods using PCR [33–42]. Studies that seek to determine the dietary pattern of phlebotomines are of great ecological and epidemiological relevance, since they may at the same time increase the knowledge about the habits of this vector, but mainly suggest potential reservoirs of Leishmania spp., which can help in the planning of better strategies [11, 33, 37, 40].

The literature has recorded, on the basis of field work, the eclecticism of L. (L.) longipalpis in feeding on a wide range of mammals, including dogs, pigs, horses, cattle, and birds [17, 43]. In addition to the favorable environmental conditions, the abundance of food sources is a determinant factor in the population growth of the vector, especially in periurban areas, which brings it closer to humans.

The data from the present study revealed that the specimens of the populations of Araguaína, Fortaleza and Sobral, areas that were classified as intensive transmission for AVL, fed mainly on humans. The anthropophilia of L. (L.) longipalpis has already been described in several studies [12, 17, 43], being one of the essential criteria for the species to be incriminated as a vector [44]. In Ceará we have already described the attraction of L. (L.) longipalpis by humans, including individuals and populations of the vector originated from Massapê, through the ELISA test proving the ingestion of human blood [15].

Research in Campo Grande (Mato Grosso do Sul) and Marajó Island (Pará) shows the high attraction of the vector by humans [7, 14]. However, investigations in Colombia and Araçatuba (São Paulo) have suggested low anthropophilia [28, 29]. The anthropophilia of L. (L.) longipalpis observed in the populations of Araguaína, Fortaleza and Sobral, certainly plays a relevant role in the classification of intense transmission to AVL, which is attributed to these municipalities. On the other hand, the data so far do not suggest that the populations of the different biomes (Cerrado and Caatinga) have different habits regarding the attraction to humans. The fact is that the species is highly anthropophilic, but due to its opportunistic character, characteristic of some species of phlebotomines, one can not expect the same pattern of feeding.

In Araguaina, the feeding of the analyzed specimens showed the attraction to dogs, as observed in the populations of, Fortaleza and Sobral, which are areas that present a high incidence of canine visceral leishmaniasis. In the 1950s, in Sobral [43], dogs had already been suggested as important domestic reservoirs of L. (L.) infantum chagasi and as sources of infection for L. (L.) longipalpis, in the home environment; in Araçatuba (São Paulo), the highest percentage of canine blood female feeding was observed, correlating its epidemiological role in the AVL transmission chain, with the hypothesis that canine enzootia precedes human transmission [30]. In other countries of South America, such as Colombia, in an area endemic to AVL, the population of L. (L.) longipalpis showed a strong attraction to dogs [28]. Studys in Montes Claros (Minas Gerais) shows that even with the adoption of euthanasia for seropositive AVL dogs, the canine population will be continue serving as a source of Leishmania sp. infection for sand flies [45]. The data obtained in this study confirm the importance of dogs in the maintenance of the AVL transmission.

However, it is possible to observe a weak attraction of L. (L.) longipalpis to birds, different from the analyzes that demonstrate opposite behavior, in Northeast areas [15] and in Raposo (Maranhão) [14]. It is well known that coops near houses act as attractive for phlebotomines [43], which serve as breeding grounds, since immature forms develop in soil that is rich in organic matter. In this context, the contact between vectors and humans increases, besides allowing the domiciliation of the vector, and consequently the transmission of AVL within the home, a situation that is observed both in the rural area and in the periphery of the cities [12, 17, 27]. In terms of environmental determinants of occurrence of AVL transmission in the home environment, the maintenance of coops near homes increases the risk of human exposure to the phlebotomine vector [40].

The analyses of the present study did not reveal positivity of L. (L.) longipalpis to opossum blood, a synanthropic animal, which was suggested as a reservoir of L. (L.) infantum chagasi, as already observed in populations of the vector from Sobral (Ceará ), Massapê (Ceará) and Jequié (Bahia), Brazil [15] and Colombia [28]. Some studies have reported the natural infection of Didelphis marsupialis, by Leishmania spp. possibly L. (L.) infantum chagasi, thus discussing the role of these mammals as potential reservoirs for AVL [2, 46, 47].

Literature has demonstrated that L. (L.) longipalpis is an eclectic, and opportunistic, species in the search for food sources [7, 12, 14, 15, 28–30]. Thus, the non-positivity in the general context of this study, about 71% of the analyzed specimens, may have a direct relation with the chosen targets. In the catch areas, besides the sources tested (humans, dogs, birds and opossums), it was possible to observe other potential sources of food, such as pigs, cats, oxen, horses, rodents, goats, sheep and foxes. Another possibility is the viability of DNA. Studies indicate that molecular assays are able to detect host DNA only within 5 days after the blood supply [33, 34, 40].

In relation to the other females that were fed, where it was not possible to detect the food source, probably other animals may be involved in the maintenance of the local population of L. (L.) longipalpis. Rodents must be taken into account, which are frequently observed during catches in areas of work and in the home environment. Rattus norvegivus and Rattus Rattus were found to be infected with L. infantum (= L. (infantum chagasi)), with analysis using Leishmania Nested PCR and hsp70 PCR-RFLP, suggesting the possibility of participation of this rodent in the zoonotic cycle of the LVA [48, 49].

From the analyses performed with the few (13) copies from Rio de Janeiro (RJ), one specimen was detected with human blood DNA. This fact corroborates with the findings that already indicated the local transmission, demonstrating the first urban focus of the city in the Bairro do Caju; the autochthonous human case, canine cases due to visceral leishmaniasis and vector findings (L. (L.) longipalpis) [50–53].

New studies should be done, seeking to better understand the ecoepidemiological dynamics of LVA in the city of Rio de Janeiro. The literature suggests that this recent (and first) urban focus has been installed from passive vector dispersion, due to the transfer of used soil to the flower pots of the Caju Cemetery, from presence of L. (L.) longipalpis vector [54]. On the other hand, it can be assumed that in the area there was already the presence of the vector, a population that was in equilibrium and well adapted to the dens of rodents, which are very common in the cemetery. The canine transmission occurred by the introduction of an infected animal, because in the area adjacent to the cemetery there was a kennel, which triggered the local transmission to a considerable number of dogs.

The rate of naturally infected phlebotomines in endemic areas as well as the correct identification of the Leishmania species are of great importance for a better understanding of the epidemiology of leishmaniasis. The classic methodology, used until then, consists of the direct search of the parasite by microscopy, through dissection of the digestive tract, followed by microscopic analysis, isolation and culture of parasites, with subsequent identification/diagnosis of the species [55–58]. Although it is considered a "gold standard" technique, in some cases it is very laborious and unfeasible, given the amount of material to be analyzed, time and specific training for this process, sometimes rendering the technique imprecise and not always allowing the isolation and the correct identification of the parasite.

Diagnostic assays using PCR have been developed based on different molecular targets such as ribosome minor subunit genes, mini-exon gene spacer sequences, single-copy nuclear sequences such as the DNA polymerase alpha gene, but the minicircle kDNA are the ones that present the highest sensitivity for detection of Leishmania [22, 58–63].

In the present study, the molecular analyses were performed individually, since the real scenario of infection rate and of identification of the food source was searched. When working with a female pool, some information may be lost as it would not be possible to detect the exact amount of positive females (for infection or food source analysis). In addition, we sought to associate the two approaches, food source and natural infection with Leishmania sp, in view of this association, individual analysis became mandatory. When parasite load analyses are performed on phlebotomines, one should consider the possibility that parasitic load may be different in each infected female, and the level of individual infection may interfere with the total pool load. Thus, if a sample showed a high parasitic load, this may be due to one or more infected phlebotomines [64]. In Camaçari (Salvador) was performed a compared study in diferents periods of captures from L. longipalpis, the results of parasite load was low and did not vary regardless of the season, despite the number of collected sand flies [65].

In this study, it was possible to detect the natural infection of L. (L.) longipalpis by L. (L.) infantum chagasi in Araguaína and Sobral, which are areas of intense transmission of AVL, with rates of 4.9% and 9, 8% respectively. In Fortaleza, a minimum natural infection rate of 3.7% was detected [61]. These results reinforce the practicality of the use of molecular techniques in the identification of natural infection, since it is known that infection rates are low in nature, even in areas endemic for AVL.

It was also possible to carry out the association between food identification and the detection of natural infection by L. (L.) infantum chagasi in 5 specimens; four specimens of L. (L.) longipalpis performed blood meal in human, and one in dog, the latter with its role already widely discussed in the transmission of AVL [2, 12, 43]. The non-identification of the source of the food source in a female L. (L.) longipalpis, from Sobral, corroborates the idea that, possibly, other mammals (in this untested study) can serve as food sources for well-known eclectic phlebotomines.

The presence of L. (L.) longipalpis in the urban area is one of the major challenges for the Brazilian Program for Control of Visceral Leishmaniasis. Studies that contribute to the knowledge of the rate of naturally infected phlebotomines, the correct identification of phlebotomines infected by L. (L.) infantum chagasi, and the analysis of the vector food identification, can help to understand the behavior of L. (L.) longipalpis in urban areas, as well as their adaptation factors to the new habitats, besides helping to elucidate the expansion of AVL in the Brazilian territory, which is clearly evidenced in the South region. The results generated in this study may contribute to the strategies of more effective controls, besides reinforcing the pepticity of the vector as an important aspect associated with its domiciliation.

Deoxyribonucleic Acid

DNA

Centers for Disease Control

CDC

Ethics approval and consent to participate

Not applicable for that section.

Consent for publication

Not applicable for that section.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior. Conselho Nacional de Desenvolvimento Científico e Tecnológico (Papes VI, 407707/2012-3, 421836/2017-2). Instituto Oswaldo Cruz / Fundação Oswaldo Cruz.

Authors' contributions

Idealization and design of the experiments: MMSA, DPP, EFR. Sampling: MMSA. Interpretation of the experiments: MMSA, DPP. Interpretation of data: MMSA, SAMC, EFR. Writing the manuscript: MMSA, EFR. All authors read and approved the final version of the manuscript.

Acknowledgements

We thank to Dra. Constança Felicia de Paoli de Carvalho Britto (Laboratório de Biologia Molecular e Doenças Endêmicas/IOC) for having given her laboratory to perform the molecular tests. To Dr. Paulo Sergio D'Andrea (Laboratório de Biologia e Parasitologia de Mamíferos Silvestres Reservatórios/IOC) for having given us blood sample of animals, which were used as controls of food source tests. Taiana Amâncio da Costa Rego (Laboratório de Biologia Molecular e Doenças Endêmicas/IOC) for the support provided during the molecular tests. Professor Cristina Giordano (Secretaria do Estado do Rio de Janeiro), for the support and assistance in activities carried out in Rio de Janeiro. To the Biologist Antônio Luis Ferreira de Santana and Dr. Júlia dos Santos Silva (Laboratório Interdisciplinar de Vigilância Entomológica em Diptera e Hemiptera/IOC); Lindenberg Caranha, Luiz Silva, Fabrício Santos, Neitom Pascoal, Holanda and Azevedo Sousa (Secretaria de Saúde do Estado do Ceará); José Helder Farrapo and Francisco Antônio da Silva (11⁰ Célula Regional Estadual de Saúde); Veterinarian Carina Azevedo, Adailton Martins, Ketlin Gomes, Caio Rocha, Christiane Barbosa, Shirley Galvão, José Silva, Angra Oliveira, Marli Denis, Diana Paixão, Clenice Souza and Jordel Silva (Secretaria de Saúde do Estado do Tocantins) for assistance during collections of samples. The Genomic Platform - DNA sequencing, PDTIS-FIOCRUZ.

WHO. Control of Leishmaniasis: report of a meeting of the WHO Expert Committee on the Control of Leishmaniases, Geneva, 22–26 March 2010. 186p.
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Manual de Vigilância e Controle da Leishmaniose Visceral Americana / Ministério da Saúde, Secretaria de Vigilância em Saúde, Departamento de Vigilância Epidemiológica. 1. ed., 5. reimpr. Ministério da Saúde. 2014. 120p.
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Manual de Vigilância da Leishmaniose Tegumentar / Ministério da Saúde, Secretaria de Vigilância em Saúde, Departamento de Vigilância Epidemiológica. 2. ed. Ministério da Saúde. 2017. 189p.
Tesh RB, Chaniotis BN, Aranson MD, Jahnson KM. Natural host preference of Panamanian phebotomine sandflies as determined by precipitin test. J Trop Med Hyg. 1971;20:150–6.
Forattini OP. 1973. Entomologia médica. São Paulo, E. Blucher/EDUSP, 658.
Christensen HA, Alias JA, Vasquez AM, Freitas RA. Hosts of sandfly vectors of Leishmania brasiliensis gyanensis in the Central Amazon in Brazil. Am J Trop Med Hyg. 1982;31:239–42.
Quinnell RJ, DYE C, Shaw JJ. Host preference of the phebotomine sandfly Lutzomyia longipalpis in Amazonian Brazil. Med Vet Entom. 1992;6:195–200.
Ogosuku E, Perez JE, Paz L, Nieto E, Monje J, Guerra H. Identification of bloodmeal sources of Leishmania spp. in Peru. Ann Trop Med Parasitol. 1994;88:329–35.
Colmenares M, Portús M, Botet J, Dobaño C, Gállego M, Wolff M, Seguí G. Identification of blood meals of Phebotomus perniciosus (Diptera: Psychodidae) in Spain by a competitive enzime-linked immunosordent assay biotin/avidinmetrod. J Med Entomol. 1995;32:229–33.
Nery LCR, Lorosa ES, Franco AMR. Feeding preference of the sand flies Lutzomyia umbratilis and Lutzomyia spathotrichia (Diptera: Psychodidae, Phebotominae) in an urban forest patch in the city of Manaus, Amazonas, Brazil. Mem Inst Oswaldo Cruz. 2004;99:571–4.
Afonso MMS, Gomes AC, Meneses CRV, Rangel EF. Studies on the feeding habits of Lutzomyia (N.) intermedia (Diptera, Psychodidae), vector of cutaneous Leishmaniasis in Brazil. Cad de Saúde Pública. 2005;21:109–18.
Lainson R, Rangel EF. Lutzomyia longipalpis and the eco-epidemiology of American visceral leishmaniasis, with particular reference to Brazil – A review. Mem Inst Oswaldo Cruz. 2005;100:811–27.
Dias-Sversutti A, Scodro RB, Reinhold-Castro KR, Neitzke HC, Teodoro U. Estudo preliminar de preferência alimentar de Nyssomyia neivai (Pinto) e Nyssomyia whitmani (Antunes & Coutinho) (Diptera: Psychodidae) em área rural do Paraná. Neotropical Entomology. 2007;36: 953 – 59.
Oliveira-Pereira YN, Moraes JLP, Lorosa ES, Rabelo JMM. Preferência alimentar sanguínea de flebotomíneos da Amazônia do Maranhão. Brasil Cad Saúde Pública. 2008;24:2183–6.
10.1155/2012/858657
Afonso MMS, Duarte R, Miranda JC, Caranha L, Rangel EF. Studies on the feedind habits of Lutzomyia (L.) longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidade: Phebotominae) populations from endemic areas of American leishmaniasis in northeastern Brazil. J Trop Med. 2012;2012:858657. doi: 10.1155/2012/858657.
Afonso MMS, Chaves SAM, Magalhães MAFM, Gracie R, Azevedo C, Carvalho BM, Rangel EF. Ecoepidemiology of American Visceral Leishmaniasis in Tocantins statem Brazil: factors associated with the occurrence and spreading of the vector Lutzomyia (Lutzomyia) longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidae: Phebotominae). In: The Epidemiology and Ecology of Leishmaniasis. InTech; 2017. p. 91–115.
Rangel EF, Lainson R, Afonso MMS, Shaw JJ. Eco-epidemiology of visceral leishmaniasis with particular reference to Brazil. In: Rangel EF, Shaw JJ, editors. Brazilian Sand Flies. Springer; 2018. p. 381–416.
Sudia WA, Chamberlain RW. 1962. Battery operated light trap, an improved model. Mosquito News. 1962;22 126-9.
Pugedo H, Barata RA, França-Silva JC, Silva JC, Dias ES. HP: an improved model of suction light trap for the capture of small insects. Rev Soc Bras Med Trop. 2005;38:70–2.
Galati EAB. Phebotominae (Diptera, Psychodidae): classification, morphology and terminology of adults and identification of American taxa. In: Rangel EF, Shaw JJ, editors. Brazilian Sand Flies. Springer; 2018. p. 9-212.
de Pita-Pereira D, Alves CB, Souza MB, Brazil RP, Bertho AL, Barbosa AF, Britto CC. Identification of naturally infected Lutzomyia intermedia and Lutzomyia migonei with Leishmania (Viannia) braziliensis in Rio de Janeiro (Brazil) revealed by a PCR multiplexnon-isotopic hybridisation assay. Trans R Soc Trop Med Hg. 2005;99:905–13.
de Pita-Pereira D, Souza GD, Zwetsch A, Alves CR, Britto C, Rangel EF. First report of Lutzomyia (Nyssomyia) neivai (Diptera: Psychodidae: Phlebotominae) naturally infected by Leishmania (V.) braziliensis in a periurban area of South Brazil, State Of Rio Grande do Sul, using a PCR multiplex assay. The American Journal of Tropical Medicine Hygiene. 2009;80:593–5.
Passos VM, Lasmar EB, Gontijo CM, Fernandes O, Degrave W. Natural infection os a domestic cat (Felisdomesticus) with Leishmania (Viannia) in the metropolitan region of Belo Horizonte, State of Minas Gerais, Brazil. MemInstOswaldo Cruz. 1996;91(1):19–20.
Lins RM, Oliveira SG, Souza NA, de Queiroz RG, Justiano SC, Ward RD, et al. Molecular evolution of the cacophony IVS6 region in sandflies. 2002;11(2):117–22.
Lavergne A, Verneau O, Patton JL, Catzeflis FM. Molecular discrimination of two sympatric species of opossum (genus Didelphis: Didelphidae) in French Guiana. Mol Ecol 1997;6(9);889 – 91..
Silva VPM. Preferência alimentar e identificação das principais fontes de repasto sanguíneo de fêmeas de Lutzomyia (Diptera: Psychodidade) em áreas endêmicas para leishmaniose visceral na Grande Natal [dissertation]. Universidade Federal do Rio Grande do Norte; 2008.
Alexander B, Carvalho RL, McCallum H, Pereira MH. Role of the domestic chicken (Gallus gallus) in the epidemiology of urban visceral leishmaniasis in Brazil. Emerg Infect Dis. 2002;8:1480–5.
Morrison AC, Ferro C, Tesh RB. Host preference of the sand fly Lutzomyia longipalpis at an endemic focus of american visceral Leishmaniasis in Colômbia. Am J Trop Med Hyg. 1993;49:68–75.
Dias FO, Lorosa ES, Rebêlo JM. Blood feeding sources and peridomiciliation of Lutzomyia longipalpis (Lutz & Neiva, 1912) (Psychodidae, Phlebotominae). Cad Saúde Pública. 2003;19:1373-80.
Camargo-Neves VLF, Rodas LAC, Gomes AC. Avaliação do hábito alimentar de Lutzomyia longipalpis no Estado de São Paulo. Boletim Epidemiológico Paulista. 2007;4:2–7.
Marassá AM, Consales CA, Galati EAB. Padronização da técnica imunoenzimática do ELISA de captura, no sistema avidina-biotina para a identificação de sangue ingerido por Lutzomyia (Lutzomyia) longipalpis (Lutz & Neiva, 1912). Rev Soc Bras Med Trop. 2004;37:441-6.
Brito VN, Almeida ABPF, Nakazato L, Duarte R, Souza CO, Sousa VRF. Phlebotomine fauna, natural infection rate and feeding habits of Lutzomyia cruzi in Jaciara, state of Mato Grosso, Brazil. Mem Inst Oswaldo Cruz. 2014;107:899–04.
Heouas N, Pesson B, Boudabous R, Dedet JP, Babba H, Ravel C. Development of molecular tool for the identification of Leishmania reservoir hosts by blood meal analysis in the insect vectors. Am J Trop Med Hyg. 2007;77(6):1054–9.
Sant'anna MR, Jones NG, Hindley JA, Mendes-Sousa AF, Dillon RJ, Cavalcante RR, Alexander B, Bates PA. Blood meal identification and parasite detection in laboratory-fed and field-captured Lutzomyia longipalpis by PCR using FTA databasing paper. Acta Trop. 2008;107(3):230–7.
Paiva BR. Utilização da PCR na identificação de espécimes de leishmânia e hábitos alimentar de flebotomíneos (Diptera: Psychodidade) de regiões do Mato Grosso do Sul [dissertation]; 2009.
Quaresma PF, Carvalho GM, Ramos MC, Andrade Filho JD. Natural Leishmania sp. reservoirs and phlebotomine sandfly food source identification in Ibitipoca State Park, Minas Gerais, Brazil. Mem Inst Oswaldo Cruz. 2012;07(4):480–5.
Soares VYR, Silva JC, Silva KR, Cruz MSP, Santos MPD, Ribolla PEM, Alonso DP, Coelho LFL, Costa DL, Costa CHN. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene. Mem Inst Oswaldo Cruz. 2014;109(3):379–83.
Macedo-Silva VP, Martins DRA, Queiroz PVS, Pinheiro MPG, Freire CCM, Queiroz JW, Dupnik KM, Pearson RD, Wilson ME, Jeronimo SMB, Ximenes MFFM. Feeding Preferences of Lutzomyia longipalpis (Diptera: Psychodidae), the Sand Fly Vector, for Leishmania infantum (Kinetoplastida: Trypanosomatidae). J Med Entomol. 2014;51(1):237–44.
Maia C, Pereira R, Cristóvão JM, Freitas FB, Afonso MO, Campino L. Molecular detection of Leishmania DNA and identification of blood meals in wild caught phlebotomine sand flies (Diptera: Psychodidae) from southern Portugal. Parasit Vectors. 2015;doi:10.1186/s13071-015-0787-4.
Sales KGS, Costa PL, Morais RCS, Otranto D, Brandão-Filho SP, Cavalcanti MP, Dantas-Torres F. Identification of phlebotomine sand fly blood meals by real-time PCR. Parasites Vectors. 2015. doi:10.1186/s13071-015-0840-3.
González E, Gállego M, Molina R, Abras A, Alcover MM, Ballart C, Fernández A, Jiménez M. Identification of blood meals in field captured sand flies by a PCR-RFLP approach based on cytochrome b gene. Acta Trop. 2015. doi:10.1016/j.actatropica.2015.08.020.
Patermina LE, Verbel-Vergara D, Romero-Ricardi L, Pérez-Doria A, Paternina-Gómez M, Martínez L, Bejarano EE. Evidence for anthropophily in five species of phlebotomine sand flies (Diptera: Psychodidae) from northern Colombia, revealed by molecular identification of bloodmeals. Acta Trop. 2016;doi:10.1016/j.actatropica.2015.10.005.
Deane LM. Leishmaniose visceral no Brasil. Estudos sobre reservatórios e transmissores realizados no Estado do Ceará. Rio de Janeiro, Serviço Nacional de Educação Sanitária. 1956.
Killick-Kendrick R. Phlebotomine vectors of leishmaniasis: A review Medical and veterinary entomology. 1990;4:1–24.
Rocha MF, Michalsky ÉM, de Oliveira Lara-Silva F, Valadão JL, França-Silva JC, Pinheiro LC, de Sousa JF, Dos Santos RC, Soares MD, Fortes-Dias CL, Dias ES. Dogs with divergent serology for visceral leishmaniasis as sources of Leishmania infection for Lutzomyia longipalpis phlebotomine sand flies - an observational study in an endemic area in Brazil. PLoS Negl Trop Dis. 2020;14(2):e0008079. doi:10.1371/journal.pntd.0008079.
Cabrera MAA, Paula A, Camacho LAB, Marzochi MC, Xavier S, Silva AVM, Jansen AM. Canine visceral leishmaniasis in Barra de Guaratiba, Rio de Janeiro, Brazil: assessmentofriskfactors. Rev Inst Med Trop. 2003;45:79–83.
Schalling HD, da Silva ES, Van der Meide WF, Schoone GJ, Gontijo CM. Didelphismarsupialis (commom opossum): a potential reservoir host for zoonotic leishmaniasis in the metropolitan region of Belo Horizonte (Minas Gerais, Brazil). Vector Borne Zoonotic Dis. 2007;7:387–93.
Lara-Silva FO, Barata RA, Michalsky EM, Ferreira EC, Lopes MOG, Pinheiro AC, Fortes-Dias CL, Dias ES. Rattus norvegicus (Rodentia: Muridae) Infected by Leishmania (Leishmania) infantum (syn. Le. chagasi) in Brazil. Bio Med Research International. 2014. doi:10.1155/2014/592986.
Pereira AAS, Ferreira EC, Lima ACVMDR, Tonelli GB, Rêgo FD, Paglia AP, Andrade-Filho JD, Paz GF, Gontijo CMF. Detection of Leishmania spp. in silvatic mammals and isolation of Leishmania (Viannia) braziliensis from Rattus rattus in an endemic area for leishmaniasis in Minas Gerais State, Brazil. PLoS One. 2017. doi:10.1371/journal.pone.0187704.
Brasil. Nota Técnica NOTA TÉCNICA Nº 5/2012 - Intensificação da Vigilância para Leishmaniose Visceral no Estado do Rio de Janeiro. GDTVZ/DTI/CVE/SVEA/SVS-SESRJ. 2012.
Brasil. Boletim Epidemiológico n0 2/2013 - Leishmaniose Visceral - GDTVZ -SES-RJ. 2013.
Pimentel JD, Borges DT, Máspero RC, da Costa CM, Ferreira FC, Barbosa PRA, et al. A new focus of leishmaniasis in the city of Rio de Janeiro, Brazil. Wordleish 5 Fifth World Congress on Leishmaniasis. Porto de Galinhas. 1406. 2013.
Silva GA, Boechat TO, Ferry FR, Pinto JF, Azevedo MC, Corvalho RS, Motta RN, Veras MF. First case of autochthonous human visceral leishmaniasis in the urban center of Rio de Janeiro: case report. Rev Inst Med Trop Sao Paulo. 2014;doi:10.1590/S0036-46652014000100013.
Brazil RP. The dispersion of Lutzomyia longipalpis in urban areas. Rev Soc Bras Med. 2013. doi:10.1590/0037-8682-0101-2013.
Infecção natural de
Rangel EF, Souza NA, Wermelinger ED, Barboza AF. Infecção natural de.
Lutzomyia intermedia (Lutz & Neiva, 1912) em área endêmica de leishmaniose.
tegumentar do Estado do Rio de Janeiro. Mem Inst Oswaldo Cruz. 1994;79:395–6.
Marsden PD

Epidemiological
Vexenat JA, Barretto AC, Cuba CC. Marsden PD. Epidemiological.
characteristics of American cutaneous leishmaniasis in an endemic region of theState of Bahia. III. Phlebotomine fauna. Mem Inst Oswaldo Cruz. 1986;81:293–301.
Ryan L, Vexenat A, Marsden PD, Lainson R, Shaw JJ. The importance of rapid diagnosis of new cases of cutaneous leishmaniasis in pin-pointing the sandfly vector. Trans R Soc Trop Med Hyg. 1990;84:786.
Freitas-Lidani KC, Messias-Reason IJ, Ishikawa EA. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania) infantum. Mem Inst Oswaldo Cruz. 2014;109(4):442–7.
Soares MR, Carvalho CC, Silva LA, Lima MS, Barral AM, Rebêlo JM, Pereira SR. Molecular analysis of natural infection of Lutzomyia longipalpis in an endemic area for visceral leishmaniasis in Brazil. Cad Saúde Pública. 2010;26(12):2409–13.
Acardi AS, Liotta DJ, Santini MS, Romaagosa CM, Salomón OD. Detection of Leishmania infantum in naturally infected Lutzomyia longipalpis (Diptera: Psychodidae: Phlebotominae) and Canis familiaris in Misiones, Argentina: the first report of a PCR-RFLP and sequencing-based confirmation assay. Mem Inst Oswaldo Cruz. 2010;105(6):796-9.
Rodrigues ACM, Silva RA, Melo LM, Luciano MCS, Bevilaqua CML. Epidemiological survey of Lutzomyia longipalpis infected by Leishmania infantum in an endemic area of Brazil. Braz J Vet Parasitol. 2014;23(1):55–62.
Cunha RC, Andreotti R, Cominetti MC, Silva EA. Detection of Leishmania infantum in Lutzomyia longipalpis captured in Campo Grande, MS. Braz J Vet Parasitol. 2014. doi:10.1590/S1984-29612014049.
10.1590/1414-431X20198224
Castro JC, Bueno LL, Milagres TF, Rêgo FD, Gontijo CMF, Peconick AP, Andrade AJ, Barçante TA, Barçante JMP. Molecular detection of Leishmania spp. in Lutzomyia longipalpis in the city of Lavras, Minas Gerais, Brazil. Braz J Med Biol Res. 2019;52(9): doi: 10.1590/1414-431X20198224.
Bezerra-Vasconcelos DR, Melo LM, Albuquerque ES, Luciano MCS. Real-time PCR to assess the Leishmania load in Lutzomyia longipalpis sand flies: Screening of target genes and assessment of quantitative methods. Exp Parasitol. 2011;129:234–9.
Mota TF, de Sousa OMF, Silva YJ, Borja LS, Leite BMM, Solcà MDS, de Melo DA, Brodskyn CI, Dias ES, Veras PST, Fraga DBM. Natural infection by Leishmania infantum in the Lutzomyia longipalpis population of an endemic coastal area to visceral leishmaniasis in Brazil is not associated with bioclimatic factors. PLoS Negl Trop Dis. 2019;26(13.(8):e0007626. doi:10.1371/journal.pntd.0007626.

Table 1. Primers used for food source detection and natural infection in Lutzomyia (Lutzomyia) longipalpis specimens from Sobral / CE, Fortaleza / CE, Araguaína / TO, Rio de Janeiro / RJ.

Targets	Primers	Temperature
Homo sapiens	ATACGCAAAATTAACCCCCTAATAA ATG TTT CAG GCT TCT GAG TAG AGA A	60 ⁰C
Canis familiaris	CTA ACA TCT CTG CTT GAT GGA ACT T TGC GAA TAA TAG TAC AAT TCC AAT G	60 ⁰C
Gallus gallus	AATTAACAACTCCCTAATCGACCTC TGTGAAGGAAGATACAGATGAAGAA	60 ⁰C
Didelphis sp.	ATT GCA AAA CAC ATC CAC TAG TTT TCT AGT ATT CCT GT	50 ⁰C
Lutzomyia sp. (cacophony)	GTG GCC GAA CAT AAT GTT AG CCA CGA ACA AGT TCA ACA TC	55 ⁰C
Leishmania sp.	(G/C)(G/C)(C/G) CC(A/C) CTA T(A/T)T TAC ACC AAC CCC GGG GTA GGG GCG TTC TGC GAA	55 ⁰C
Leishmania (L.) chagasi	AAAAATGGGTGCAGAAAT	55 ⁰C
cyt b	CCC CTC AGA ATG ATA TTT GTC CTC A CCA TCC AAC ATC TCA GCA TGA TGA AA’

Table 2. Identification of sources detection in Lutzomyia (Lutzomyia) longipalpis females, using the PCR technique.

Municipality	Number of females
	Females tested	Positive	Negative
	Females tested	N (%)	N (%)
Araguaína – TO	41	13 (31.7%)	28 (68.3%)
Fortaleza – CE	45	11 (24.4%)	34 (75.6%)
Rio de Janeiro – RJ	14	2 (14.3%)	12 (85.7%)
Sobral – CE	41	15 (36.6%)	26 (63.4%)
Total	141	41	100
%		29.3%	70.9%

Table 3. Distribution of food source types in Lutzomyia (Lutzomyia) longipalpis females, by PCR, in the studied areas.

Positives samples	Bird	Dog	Opossum	Human
Araguaína – TO
Total	NR	5	NR	8
%	-	38.5%	-	61.5%
Fortaleza – CE
Total	2	3	NR	6
%	18.2%	27.3%	-	54.5%
Rio de Janeiro – RJ
Total	NR	NR	NR	2
%	-	-	-	100%
Sobral
Total	2	3	NR	10
%	13.3%	20.0%	-	66.7%
Total of samples	4	11	NR	26
%	9.8%	26.8%	-	63.4%
NR – not reactive

Table 4. Female of Lutzomyia (Lutzomyia) longipalpis submitted to the search for natural infection by Leishmania (Leishmania) infantum chagasi

Municipality	Positive N (%)	Negative N	Total N
Araguaína – TO	2 (4.9%)	39	41
Fortaleza – CE	0 (0%)	45	45
Rio de Janeiro – RJ	0 (0%)	13	14
Sobral – CE	4 (9.8%)	37	41
Total of samples	6 (4.3%)	134	141

Table 5. Association of identification of natural infection by Leishmania (Leishmania) infantum chagasi and food source detection in Lutzomyia (Lutzomyia) longipalpis females.

Municipality	N	Dog	Human	Unidentified Food Source
Araguaína – TO	2	1	1	-
Fortaleza – CE	-	-	-	-
Rio de Janeiro – RJ	-	-	-	-
Sobral – CE	4	-	3	1
N	6	1	4	1

Download PDF

Version 1

posted 15 Jun, 2020

You are reading this latest preprint version

Contribution to the Knowledgment of Feeding Habbits of Lutzomyia (Lutzomyia) Longipalpis (Lutz & Neiva, 1912) in Association to Natural Infection by Leishmania (Leishmania) Infantum Chagasi (Cunha & Chagas, 1937)

Status:

Version 1

Abstract

Figures

Background

Methodology

Results

Identification of eating habits

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Version 1