Determination of Dominant Phyllosphere Microbial Community in Rubber Trees with Powdery Mildew

doi:10.21203/rs.3.rs-2760625/v1

Download PDF

Research Article

Determination of Dominant Phyllosphere Microbial Community in Rubber Trees with Powdery Mildew

https://doi.org/10.21203/rs.3.rs-2760625/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Rubber tree powdery mildew is an important fungal leaf disease of rubber tree caused by obligate parasitic bacteria. It is one of the most important diseases in rubber planting areas around the world. The pathogen of rubber tree powdery mildew was previously named Oidium heveae, and its pathogen name is currently Erysiphe quercicola. Leaf-associated microbiomes are currently a new and hot research field for molecular ecology, and the biomass in plant ecosystems is also very large and the biological community is extremely rich.

Results

This study used high-throughput sequencing and other molecular techniques to analyze the structure and diversity of the dominant fungi and bacteria communities of rubber tree leaves in four representative rubber-producing areas in Hainan Province, China (BS, DZ, WN, WZS) after white powder disease occurred. It was found that the dominant bacterial phyla in the four regions were Cyanobacteria, Proteobacteria and Actinobacteria, and the dominant bacterial genus was Cyanobacteria. The dominant fungal phyla in the four regions were Ascomycota, Fungi_unclassified and Basidiomycota.There is significant difference in fungal community composition and relative abundance at genus levels between different areas. We explored the effect of rubber tree powdery mildew on its phyllosphere microbes found that in the same area, there is little difference in community structure between healthy leaves and grade 3 diseased leaves, which only affect the community abundance, while there is significant difference in community composition of different areas. This conclusion also confirms that in the harsh phyllosphere environment, rubber tree phyllosphere microbes need to maintain a good symbiotic relationship with hosts and pathogenic bacteria for surviving and evolving.

Conclusions

This study analyze the structure and diversity of the dominant fungi and bacteria communities of rubber tree leaves in four representative rubber-producing areas in Hainan Province, China after white powder disease occurred. This project the first time to study the influence of Erysiphe on leaf microorganisms of rubber trees. The conclusion confirms that in the harsh phyllosphere environment, rubber tree phyllosphere microbes need to maintain a good symbiotic relationship with hosts and pathogenic bacteria for surviving and evolving.

Rubber Tree Powdery Mildew

Phyllosphere Microorganism

High-throughput Sequencing

Rubber Tree Powdery Mildew

The Heveae brasiliensis or rubber tree, native to the Amazon basin, is a tall perennial tree that has been introduced to more than 40 countries and regions in the hot areas and plays a highly important role in the economic development of the plantation (Lieberei Reinhard, 2007). As a major producer and consumer of natural rubber, China planted rubber trees in 1906. In 1954, a group of outstanding Chinese researchers made a breakthrough for the large-scale cultivation of rubber tree in regions from latitude 18°N and above, making China the fourth largest producer of rubber in the world from a country without no rubber plantation before. Now, five natural rubber plantations have been established in Hainan, Yunnan, Guangdong, Guangxi and Fujian Province in China, and this experiment in the essay will be performed in the Hainan plantation.

Rubber tree powdery mildew is one of the most damaging and widespread foliar diseases of rubber trees, which affects the profit of the natural rubber industry by causing defoliation and reduction in latex yield. It is shown by research studies that both phenological- and meteorological-related factors can influence the powdery mildew disease. (Zhai et al., 2021), and that in the optimum conditions, the conidia can repeatedly infect the tree throughout the year, leading to reduced photosynthesis, resulting in slower growth and great reduction of yields (K.K. Liyanage, et al., 2017).

The pathogen of Rubber tree powdery mildew is Erysiphe quercicola (Wu et al., 2019). Erysiphe quercicola is an obligate parasitic fungal pathogen, which cannot be cultured in vitro without the host (Sheng et al., 2021). The pathogen spreads easily through air, causing serious damage to rubber trees, notably the leaves, and inflorescences, buds and other tissues. White powder appears on infected leaves, buds, and shoots, which are conidia and hyphae of powdery mildew. In the later stage, light yellow spots appear on infected leaves, causing the leaves to twist, buckle, or otherwise distort and fall off.

Phyllosphere microorganisms are intimately related to plant growth, and even the occurrence of plant diseases (Liu He, et al., 2022). In 1981, the concept of phyllosphere microorganisms was first proposed by Blackman, who defined them as microorganisms that inhabit on surface of plant leaves. The phyllosphere microbial community is determined by various factors such as leaf age, canopy position, season, and chemical spraying (Jager E.S., et al., 2001). Two important indicators for judging phyllosphere microecology are community structure and metabolic function (Liu Tingting, et al., 2022). The regulation of phyllosphere microbial communities has become a new and alternative approach to the biological control of foliar diseases. The structural dynamics of microorganisms on leaf surfaces has great significance for the near-surface environment and ecology (Li Huijuan, et al. 2021).

Although the phyllosphere provides a relatively stable condition for the growth and reproduction of its microorganisms, the phyllosphere living environment is relatively harsh. The phyllosphere microbial community has its diversity and complexity to better adapt to the adversity environment and show its VBNC(Viable But Nonculturable) features. Even though the phyllosphere environment is extremely changeable and hostile, the phyllosphere microbial communities are still highly diverse. The phyllosphere consists of diverse numerous microbial communities including bacteria, filamentous fungi, yeasts, algae, and protozoans. The main microorganisms are mostly bacteria. The diversity, dispersal and community development on the leaf surface, are mainly associated to the physiological and biochemical changes in host leaf, living environment and immunity (Liu Rui, et al., 2022).

Phyllosphere microorganisms have co-evolved with their hosts or epiphytes, and play key roles in plant productivity and health by affecting leaf function and lifespan, seed mass, apical growth, flowering, and fruit development. It is also helpful in the removal and degradation of environmental pollutants (Stone BW, Weingarten EA, Jackson CR., 2018)

The study of phyllosphere microorganisms is relatively recent, but it is now an emerging and popular area of research on the molecular ecology of microorganisms. New research has been conducted on the origin of the phyllosphere microbiome, the assembly of the phyllosphere microbiome, and the function of the phyllosphere microbiome. With the development of molecular biotechnology and the use of newer research techniques, it is now possible to achieve a deeper insight into the molecular interactions of phyllosphere microorganisms.

The community structure and diversity of phyllosphere microorganisms determine the characteristics and strength of the ecological functions of leaves. The phyllosphere microecological balance is relevant to the composition of the microbial community. The influence of phyllosphere microbes on host plants, surrounding atmospheric conditions and microbial interactions has been previously studied and results suggest that global climate change has altered phyllosphere microbial communities with potential cascading effects on plant function, plant evolution and ecosystem function (Corinne Vacher, et al., 2016), but little research has been conducted on the relationship between phyllosphere microbes and their hosts and pathogens following powdery mildew in a cash crop such as rubber trees. We therefore employed MiSeq high-throughput sequencing to investigate the similarities and differences in the composition of the phyllosphere microbial community of rubber trees in different regions of Hainan where powdery mildew occurs and where it does not, and to understand the effects of powdery mildew on the phyllosphere microbial community of rubber tree leaves and the changes in each microbial community, with the aim of providing a theoretical basis for the biological control of powdery mildew and the elucidation of life phenomena such as the evolution of powdery mildew in rubber trees.

Test Material

In order to study the structure and diverse differences of phyllosphere microbial communities of rubber trees with powdery mildew in different regions of Hainan, four representative rubber plantation farms were selected as sampling sites, namely Baisha (BS), Danzhou (DZ), Wanning (WN) and Wuzhishan (WZS).

Samples were taken in April (in the phenological stage when leaves are in pale green) from infected rubber tree leaves at the level 3 of infection (white spots covering more than 33% of the leaf area) (Qin et al., 2015).

The five-point sampling method was employed to collect samples from each rubber farm, with 3 trees in each plot and 4 leaves from each tree in one sterile bag as a sample. Three biological replicates were marked as _1, _2 and _3. Uninfected leaves of the same size (at Level 0) were collected b the same method as a blank control and marked as _CK.

The sample number, time and place of collection, latitude, longitude, altitude and ambient temperature and humidity on the day of collection were well recorded (Table 1).

Table 1

The detailed information of the tested specimens
Simple number	Sampling time	Leaf disease level	Place of collection	Latitude and longitude	Altitude (m)
BS_1、BS_2、BS_3	2017.04.05	3 级	Baisha (BS) Bangxi Farm	109°06′39.79″E 19°21′34.91″N	119.7
BS_CK	2017.04.05	0 级	Baisha (BS) Bangxi Farm	109°06′39.79″E 19°21′34.91″N	119.7
DZ_1、DZ_2、DZ_3	2017.04.05	3 级	Danzhou (DZ) Xilian Farm	109°29′25.39″E 19°30′59.65″N	142.80
DZ_CK	2017.04.05	0 级	Danzhou (DZ) Xilian Farm	109°29′25.39″E 19°30′59.65″N	142.80
WN_1、WN_2、WN_3	2017.04.06	3 级	Wanning (WN) Xingzhong Farm	110°5′49″E 18°50′45″N	252.9
WN_CK	2017.04.06	0 级	Wanning (WN) Xingzhong Farm	110°5′49″E 18°50′45″N	252.9
WZS_1、WZS_2、WZS_3	2017.04.06	3 级	Wuzhishan (WZS) Changhao Farm	109°25′34.25″E 18°52′53.70″N	190.10
WZS_CK	2017.04.06	0 级	Wuzhishan (WZS) Changhao Farm	109°25′34.25″E 18°52′53.70″N	190.10

Extraction Of Dna From Phyllosphere Microbia

Extraction of DNA from Phyllosphere Microbia

Genomic DNA was extracted from samples using the FastDNA® Spin Kit for Soil. In the process, sample was treated with a special lysis medium, E, followed by further purification using the GENECLEAN procedure based on the silica adsorption of DNA with a spin filter. The resulting DNA were to be used for PCR, restriction digestion, electrophoresis and other following experiments. The concentration and purity of the genomic DNA was determined by using the NanoDrop 2000C with purity of 1.8-2.0 for A260/A280, stored at -20°C for extended periods until use.

Amplification And Sequencing Of 16s Rrna And Its Of Phyllosphere Microbia

Using the genomic DNA of the sample as a template, the amplification of bacterial 16S rRNA gene and fungal ITS gene was performed by PCR with universal primers (Lee et al., 2012).

List of Reaction Primers (Table 2)

The PCR Setup (50ul reaction) (Table 3)

PCR Amplification Protocol(Fig. 1)

Table 2

List of Reaction Primers
Primer name	Primer Sequence(5′-3′)
16S-338F	ACTCCTACGGGAGGCAGCA
16S-806R	GGACTACHVGGGTWTCTAAT
ITS-1F	CTTGGTCATTTAGAGGAAGTAA
ITS-2043R	GCTGCGTTCTTCATCGATGC

Table 3

The PCR Setup (50ul reaction)
10×TransTaq-T buffer(含Mg2+)	5.0 ul
dNTP(2.5 mmol/L)	4.0 ul
forward primers(10 umol/L)	1.0 ul
reverse primers(10 umol/L)	1.0 ul
DNA Template	2.0 ul
TransTaq-T DNA Enzyme(5 U /ul)	1.0 ul
ddH2O	36.0 ul
Total	50.0 ul

PCR products were detected by agarose gel electrophoresis

The products were purified were purified and sent to Shanghai Majorbio Bio-pharm Technology Co.,Ltd for MiSeq high-throughput sequencing.

Sequence Data Processing And Statistical Analysis

(1) Calculate the DNA matrix, use the UPARSE program (Edgar, 2013) to divide the OTUs, and cluster all the sequences that are considered to be similar (97% identity threshold). The RDP-Classifer software was used to classify and annotate the sample sequences, and the confidence parameter was set to 50%. Microorganisms corresponding to sequences with a genetic distance of less than 3% are genuslly considered to belong to the same species.

(2) The data were homogenised, the number of OTUs at different taxonomic levels was calculated and dilution curves were plotted. The alpha diversity of the sequences was evaluated by Chao1, richness index, Shannon index and Simpson index.

(3) Differences in microbial community structure among the four regions were analysed using DCA (Detrended Correspondence Analsis) and the non-parametric test Adonis. The analyses were performed on the Galaxy website (http:/ /rccc.ou.edu) and through the R Programming package.

Basic Composition and Structure of the Phyllosphere Microbia Community of Rubber Tree Powdery Mildew

Four samples from each sampling site were sequenced by MiSeq high-throughput sequencing. A total of 16 samples from four areas in Hainan, namely Baisha (BS), Danzhou (DZ), Wuzhishan (WZS) and Wanning (WN), were sequenced for phyllosphere microbial DNA of powdery mildew. A total of 567,903 high quality sequence fragments were read after processing the raw data, with the number of sequences in a single sample ranging from 30, 261 to 44, 775, with an average of 35,494, and a total of 529 OTUs detected. The average sequence length was found to be 429.50 bp, with 89.14% of the sequences in the range of 421–440 bp.

The dilution curves showed differences in the diversity of the different sample species. The flattening of the dilution curves for each sample indicates that the amount of sequenced data is reasonable and the depth of sequencing has covered all species in the samples (Fig. 2).

The community composition of each sample was counted at different taxonomic levels and all samples were identified to a total of 24 phyla, 49 class, 100 orders, 172 families and 256 genus of bacteria. With the exception of WZS_3,15, other 15 of the samples from the four regions were dominated at the phylum level by Cyanobacteria, Poteobacteria and Actinobacteria. The dominant phylum in individual regions also includes Firmicutes and Bacteroidetes, which have different relative abundances in different regions (Figs. 3 and 4).

Except for WZS_3, in the 15 sampls the relative abundance of Cyanobacteria ranged from 71.24–98.29%; Proteobacteria from 1.55–23.13%; and Actinobacteria from 0.82–1.23% in the remaining 15 samples. The relative abundance of WZS_3 was 0.04%, 28.92% and 10.59%, respectively.

Except for WZS_3, at the genus level, the dominant genus in Baisha (BS) were Cyanobacteria, Mitochondria and Rhodococcus; in Danzhou (DZ), Cyanobacteria, Mitochondria and Curtobacterium; in Wanning (WN), Cyanobacteria, Pseudomonas and Pantoea; and in Wuzhishan (WZS), Cyanobacteria, Pseudomonas and Pantoea. The dominant genus in Wanning (WN) are Cyanobacteria, Pseudomonas, Pantoea; the dominant genus in Wuzhishan (WZS) sample WZS_3 are Acidobacteria and other unknown bacteria, the dominant genus in WZS_1 and WZS_2 are Cyanobacteria, Pantoea, and the dominant genus in WZS_CK are Cyanobacteria and Rhodobacteria. Cyanobacteria and Rhodococcus (Fig. 5, Fig. 6)

At the genus level, the most dominant communities at the healthy leave (level 0) of BS, DZ, WN and WZS were Cyanobacteria, with relative abundances of 96.93%, 93.78%, 93.93% and 83.04%, respectively, while the most dominant community at the infected leave (level 3) was also Cyanobacteria, with relative abundances (mean) of 97.34%, 91.2%, 77.64% and 49.88%, respectively (Table 4).

Table 4

Haplotypes information of rubber tree powdery mildew samples
Haplotype	No. of Samples	Herbarium accession No.	Country/Countries
H1	2	YN-306, HN-509	China
H2	1	GD-102	China
H3	1	HB1	Viet Nam
H4	11	HB2, HO-73, HN-101, HN-205, HN-404, HN-407, MUMH2545, MUMH2602, HKAS 94620, HKAS 94622, HN-501	Viet Nam, China, Malaysia,Thailand
H5	1	HKAS 95625	Sri Lanka
H6	7	HKAS 94629, HKAS 94633, YN-305, HKAS 94638, HN-102, YN-206, YN-302	Sri Lanka, China
H7	1	HN-103	China
H8	1	HN-104	China
H9	1	HN-105	China
H10	1	HN-201	China
H11	1	HN-202	China
H12	1	HN-203	China
H13	1	HN-204	China
H14	1	HN-206	China
H15	1	HN-207	China
H16	1	HN-301	China
H17	1	HN-302	China
H18	1	HN-303	China
H19	1	HN-304	China
H20	1	HN-305	China
H21	1	HN-306	China
H22	1	HN-307	China
H23	1	HN-308	China
H24	1	HN-402	China
H25	1	HN-405	China
H26	1	HN-406	China
H27	1	HN-408	China
H28	1	HN-502	China
H29	1	HN-507	China
H30	1	HO-373	China
H31	1	HO-473	China
H32	2	MUMH2418, MUMH2419	Brazil
H33	1	YN-101	China
H34	1	YN-102	China
H35	1	YN-103	China
H36	1	YN-105	China
H37	1	YN-201	China
H38	1	YN-203	China
H39	1	YN-204	China
H40	1	YN-303	China

For the subdominant genus, Mitochondria and Rhodococcus were reported to be found on both uninfected and Level 3 infected leaves of BS. The relative abundance on uninfected leaves was 2.51% and 0.2%, while it was 0.58% and 0.72% on Level 3 infected leaves. For samples of DZ, the relative abundance of uninfected leaves was 2.51% and 0.2%, while the relative abundance of Level 3 affected leaves (at average) was 0.58% and 0.72%. For samples collected from DZ, the subdominant genus on healthy leaves was Mitochondria with the relative abundance at 6.03%, while the relative abundance of Level 3 infected leaves was 1.41% and 2.18% with Mitochondria and Curtobacterium as subdominant genus. For samples from WN, the subdominant genus were Mitochondria and Bacillus (Bacillus spp.) on healthy leaves with relative abundances of 3.59% and 1.87% respectively, while Mitochondria, Pseudomonas, Pantoea and Curtobacterium were found in Level 3 affected leaves with relative abundances (average) of 3.36%, 9.39%, 6.72% and 1.45%. Mitochondria and Rhodococcus were found as subdominant on healthy leaves from WZS with relative abundances of 1.05% and 6.63%, while Mitochondria, Pantoea, Acidobacteria and Enterobacteriaceae were found in Level 3. The WZS healthy leaves had Mitochondria and Rhodococcus, with relative abundances of 1.05% and 6.63%, while the Level 3 affected leaves had Mitochondria, Pantoea, Acidobacteria and Enterobacteriaceae as the subdominant genus, with relative abundances (at average) of 2.59%, 6.25%, 4.47% and 3.51% respectively (Table 5).

Table 5

The relative abundance of bacterial community in rubber phyllosphere at genus level
Genus	Community relative abundance of BS (%)		Community relative abundance of DZ (%)		Community relative abundance of WN (%)		Community relative abundance of WZS (%)
Genus	Level 3(Average)	Level 0	Level 3(Average)	Level 0	Level 3(Average)	Level 0	Level 3(Average)	Level 0
Cyanobacteria_norank	97.34 ± 1.32	96.93	91.2 ± 3.12	93.78	77.64 ± 9.10	93.93	49.88 ± 43.18	83.04
Pantoea	0.05 ± 0.04	0.00	0.84 ± 1.27	0.02	6.72 ± 7.51	0.02	6.25 ± 5.44	0.36
Mitochondria_norank	0.58 ± 0.36	2.51	1.41 ± 0.03	6.03	3.36 ± 2.14	3.59	2.59 ± 2.59	1.05
Pseudomonas	/	/	0.26 ± 0.03	0.02	9.39 ± 7.87	0.01	1.38 ± 2.0	1.16
Acidobacteria_norank	/	/	/	/	/	/	4.47 ± 7.7	0.13
Curtobacterium	/	/	2.18 ± 1.29	0.00	1.45 ± 0.58	0.16	0.64 ± 0.75	0.21
Rhodococcus	0.72 ± 0.48	0.20	0.44 ± 0.08	0.01	0.23 ± 0.1	0.10	0.29 ± 0.31	6.63
Enterobacteriaceae_unclassified	/	/	/	/	/	/	3.51 ± 5.22	0.01
Ralstonia	0.34 ± 0.21	0.13	0.92 ± 0.05	0.03	0.17 + 0.06	0.14	0.58 ± 0.59	0.43
Sphingomonas	/	/	0.85 ± 0.72	0.04	/	/	0.93 ± 1.1	0.15
Bacillus	/	/	/	/	0.08 ± 0.1	1.87	0.65 ± 0.97	0.00
Others	0.89 ± 0.56	0.20	1.87 ± 0.57	0.07	0.76 ± 0.09	0.19	9.41 ± 12.92	6.69
Note: Bacterial communities of < 0.02% were not counted.

In summary, except for the WZS samples, the dominant genus of healthy leaves in all three regions were Cyanobacteria and Mitochondria, while the composition of the dominant genus on in Level 3 infected leaves did not vary much, as they all included Cyanobacteria and Mitochondria. Other dominant genus were different in different regions, but their relative abundance was not high. Therefore, the composition of the genus-level communities of the three levels of infected and healthy leaves in the same region was similar, except for differences in relative abundance, while the composition of the genus-level communities differed significantly between regions.

A total of 520 OTUs were detected in the four regions after quality control, 102 OTUs in BS, 113 OTUs in DZ, 81 OTUs in WN and 479 OTUs in WZS (Fig. 7). The proportion of OTUs unique to each of the four regions was 3.27% for BS, 1.54% for DZ, 0.77% for WN and 67.69% for WZS, showing that WZS > BS > DZ > WN. There were 36 overlapping OTUs in the four regions, accounting for 6.92% of the total number of samples. This indicates that although the samples were all collected from rubber powdery mildew phyllosphere environment, there were significant differences in OTU levels between the four regions.

Diversity Index Analysis Of Phyllosphere Microbia Of Rubber Tree Powdery Mildew

Table 6

Diversity indexes for bacterial community in rubber phyllosphere
Sample ID	Reads	97% identity
Sample ID	Reads	OTU	ACE	Chao 1	Coverage	Shannon	Simpson
BS_1	12214	36	49	54	99.89%	0.14	0.96
BS_2	12214	73	163	126	99.73%	0.31	0.91
BS_3	12214	33	144	76	99.84%	0.16	0.96
BS_CK	12214	24	86	47	99.89%	0.17	0.94
DZ_1	12214	65	110	138	99.75%	0.59	0.81
DZ_2	12214	60	82	95	99.83%	0.68	0.78
DZ_3	12214	60	83	76	99.83%	0.4	0.88
DZ_CK	12214	18	34	63	99.92%	0.26	0.88
WN_1	12214	41	85	61	99.87%	0.9	0.58
WN_2	12214	42	133	105	99.84%	0.62	0.78
WN_3	12214	50	170	89	99.80%	1.04	0.53
WN_CK	12214	25	48	29	99.93%	0.32	0.88
WZS_1	12214	104	136	130	99.74%	1.28	0.55
WZS_2	12214	78	282	146	99.66%	1.15	0.57
WZS_3	12214	324	329	329	99.89%	5.09	0.01
WZS_CK	12214	128	132	135	99.90%	1.02	0.69

Note: BS is Baisha, DZ is Danzhou, WN is Wanning, WZS is Wuzhishan; fungal communities which are less than 0.02 % are not included in the statistics.

The OTU statistics were analysed at a 97% similarity level and the OTU numbers for the 16 samples ranged from 24–324, with the Ace and Chao indices used to estimate the total number of species at 34–329 and 29–329 respectively. Shannon Index and Simpson Index were used to estimate microbial diversity in the samples, ranging from 0.14–5.09 and 0.01–0.96 respectively.

The coverage of the samples was greater than 99%, proving that the sequencing results represent the true picture of the microorganisms in the samples. Despite distinct algorithms, the Ace and Chao Index were generally consistent and did not differ significantly from the measured OTU numbers.

Both the Shannon and Simpson Index indicated that WZS > WN > DZ > BS in terms of the alpha diversity of species in the four regions.

Pca Analysis And Nmds Analysis Of Phyllosphere Microbia In Samples From Different Regions

The study compares differences in the composition of phyllosphere bacterial communities of rubber trees from four regions in Hainan. The composition of the DZ and BS samples was similar, and these two areas were close together in the PCA diagram due to their geographical proximity to each other. The samples from WN and WZS were clearly distinguishable from each other, except for the WZS_3 sample, which was more dispersed but still mostly clustered together (Fig. 8). The results indicate that bacterial communities differed significantly between the four regions and that different geographical locations are influential in accounting for the variation of community composition and structure of phyllosphere bacteria in rubber trees.

Non-metric multidimensional scaling showed that, except for the WZS_3 samples, samples that had close geographical proximity or similar climates shared more similarities in composition, as analysis results were clustered together (Fig. 4). For example, DZ and BS has a short distance between one another with a dry climate, whereas WN and WZS are close with a wet climate. These results suggest that the different geographical locations or climate types can lead to the separation of different microbial communities, and that samples with geographical proximity or similar climate types illustrate large clustering results.

Analysis Of Phyllosphere Microbia Taxa Lefse In Samples From Different Regions

The results of the Plot cladogram analysis also reveal the communities or species that have a significant differential impact on division of sample by region (Fig. 10).

The communities with significant differential impact are Cyanobacteria in BS, Methylobacterium in DZ, are Firmicutes in WN and Proteobacteria and Acidobacteria in WZS.

Correlation Analysis Between Clustering Of Phyllosphere Microbia Otus And Environmental Factors

The correlations between the environmental factors (temperature, humidity, altitude) sampled at each location and the OTUs were calculated. The achieved R and P values were obtained to cluster the OTUs and environmental factors separately (Fig. 11). The results confirmed that OTU280, OTU257, OTU146, OTU27, OTU437, OTU196, OTU385, OTU30 and OTU510 were significantly correlated with temperature and clustered into one large branch, OTU430 was significantly correlated with temperature and humidity and was in this large branch; OTU144 was significantly correlated with temperature and humidity but was a separate branch. Altitude has no effect on OTUs. OTU144 is highly correlated with temperature and humidity, OTU196 and OTU30 are highly correlated with temperature and OTU 430 is moderately correlated with humidity.

Basic Composition And Structure Of The Phyllosphere Fungal Community Of Rubber Tree Powdery Mildew

A total of 593,237 high quality sequence fragments were obtained from 16 samples, with an average of 37, 077 sequences in the range of 30, 129–44, 619 and 1,406 OTUs detected in a single sample. 293.01 bp was the average sequence length, with 57.38% of the sequences concentrated between 301–320 bp and 26.99% between 241–260 bp.

The dilution curves show the differences in the diversity of the different sample species. The flattening of the dilution curves for each sample indicates that the amount of sequenced data is reasonable and the depth of sequencing has largely covered all species in the samples (Fig. 13).

The community composition of each sample was calculated at different taxonomic levels and a total of 6 phyla, 26 orders, 69 families, 157 families and 351 genus of fungi were identified in all samples. At the phylum level, the community composition of the samples from all four regions was similar, with Ascomycota, Fungi_unclassified and Basidiomycota dominating, with different relative abundances in the samples from different regions (Fig. 14). The relative abundance of Ascomycota ranged from 43.76–99.80%, Fungi_unclassified from 0.02–53.32% and Basidiomycota from 0.17–10.91% in the 16 samples.

Except for WZS_3, the community composition of the samples was genuslly consistent at the generic level, but varied in abundance, while the community composition and relative abundance differed significantly between regions (Fig. 15). The dominant genus in all four regions include Erysiphe, Cladosporium and Fungi_unclassified. In addition, the different regions have varied dominant genus. The dominant genus in the Baisha region (BS) are Alternaria, in the Danzhou region (DZ) are Sporidiobolales, in the Wanning region (WN) are Dothioraceae, and in the Wuzhishan region (WZS) are Uwebraunia, as shown in Fig. 16.

For infected leaves at Level 3, the dominant genus of BS were Erysiphe, Cladosporium, Fungi_unclassified and Alternaria with relative abundances (mean) of 71.81%, 17.75%, 1.19% and 1.8%, respectively. The dominant genus were Erysiphe, Cladosporium and Sporidiobolales in DZ.

In WN, the dominant genus were Erysiphe and Cladosporium, with relative abundances (mean) of 93.24% and 1.16%, respectively. In WZS, the dominant genus were Erysiphe and Cladosporium, Fungi_unclassified and Ascomycota, and the relative abundances (mean) were 63.97%, 1.66%, 14.99% and 5.66%, respectively (Table 7).

In addition, healthy leaves (Level 0) and infected leaves at Level 3 in the four regions also included a number of less abundant communities such as Epicoccum, Mycosphaerellaceae, Pseudocercospora, Pleosporales and Pseudozym, whose relative abundances ranged from 63.97%, 1.66%, 14.99% and 5.66%, respectively (Table 7). The relative abundances of Pseudocercospora, Pleosporales and Pseudozym range from 0.12–0.98%, 0.02–1.88%, 0.02–1.44%, 0.04–1.75% and 0.09–2.75%, respectively. The relative abundance of fungi (others) whose taxonomic status is unclear or not yet identified ranged from 1.04–10.58% (Table 7).

In summary, except for samples from WZS, the dominant genus in the remaining three regions for both Level 3 infected leaves and healthy leaves included Erysiphe, Cladosporium and Fungi_unclassified, with 1–3 different subdominant genus in different regions, but all with low relative abundance. Therefore, the genus-level community composition of the three levels of infected and healthy leaves in the same area did not vary much, but only in relative abundance, whereas the genus-level community composition varied between areas. Powdery mildew had little effect on the structure of the phyllosphere fungal community, but had an effect on the relative abundance of each community.

A total of 1398 OTUs were detected in the four regions after quality control, 420 OTUs in BS, 295 OTUs in DZ, 500 OTUs in WN and 875 OTUs in WZS (Fig. 17). the proportion of unique OTUs in the four regions was 11.09% in BS, 1.93% in DZ, 13.23% in WN and 44.49%, showing WZS > WN > BS > DZ. There were 90 overlapping OTUs in the four regions, accounting for 6.44% of the total number of OTUs in the samples. This indicates that although the samples were all sourced from rubber powdery mildew phyllosphere, there were significant differences in OTU levels between the four regions.

Diversity Index Analysis Of The Phyllosphere Fungal Flora Of Rubber Tree Powdery Mildew

The abundance and diversity of the microbial community can be studied by analysing the diversity of individual samples (Alpha diversity) using a range of statistical indices such as Chao1, Ace, Shannon index and Simpson index diversity (Table 8). The OTU statistics were analysed at 97% similarity level and the OTU numbers for the 16 samples ranged from 71–692, with Ace and Chao Index used to estimate the total number of species, 121–723 and 120–713, respectively. Both the Shannon Index and Simpson Index indicated that the alpha diversity of species in the four regions was WZS > BS > DZ > WN.

Table 8

Diversity indexes for fungal community in rubber phyllosphere
Sample ID	Reads	97% identity
Sample ID	Reads	OTU	ACE	Chao 1	Coverage	Shannon	Simpson
BS_1	29913	105	121	120	99.92%	0.53	0.82
BS_2	29913	193	204	204	99.92%	1.84	0.31
BS_3	29913	171	236	217	99.80%	0.79	0.73
BS_CK	29913	240	251	251	99.92%	2.65	0.15
DZ_1	29913	132	191	183	99.84%	1.53	0.34
DZ_2	29913	124	179	163	99.86%	1.61	0.28
DZ_3	29913	159	336	269	99.77%	0.93	0.65
DZ_CK	29913	147	215	204	99.81%	1.09	0.44
WN_1	29913	196	296	321	99.73%	0.47	0.88
WN_2	29913	243	316	291	99.76%	0.67	0.83
WN_3	29913	186	266	267	99.77%	0.52	0.86
WN_CK	29913	381	421	415	99.79%	2.82	0.17
WZS_1	29913	72	169	115	99.89%	0.33	0.89
WZS_2	29913	71	230	142	99.87%	0.24	0.92
WZS_3	29913	692	723	713	99.78%	4.64	0.02
WZS_CK	29913	182	225	215	99.84%	1.79	0.30

Lefse Analysis Of Phyllosphere Fungal Taxa In Samples From Different Regions

A Kruskal-Wallis (KW) sum-rank test was performed using the LEfSe ((Linear discriminant analysis effect size) algorithm to compare the distribution of OTUs between the leaves of rubber trees in different regions. The results showed that 11 OTUs were distributed in BS, 3 OTUs in DZ, 22 OTUs in WN and 3 OTUs in WZS. Trichosphaeriales is the most abundant taxon in the BS, Sporidiobolaceae is the most abundant taxon in the DZ, Dothideales and Dothioraceae are the most abundant taxa in the WN, and Chaetomiaceae is the most abundant taxon in the WZS (Fig. 18). The results of the Plot cladogram analysis also revealed the communities or species that significantly influenced the delimitation of the samples in different regions (Fig. 19).

The communities significantly differentially affected by BS are Trichosphaeriales, Botryosphaeriaceae, Capnodiales, Montagnulaceae, Pleosporales, Sclerotiniaceae and Cystofilobasidiaceae; the communities significantly differentially affected by DZ are Botryosphaeriales, Dothideomycetes and Cystofilobasidiaceae. DZ The significantly different communities are Botryosphaeriales, Dothideomycetes and Sporidiobolaceae; WZS The significantly different communities are Chaetomiaceae, Sordariales and Psathyrellaceae; The communities affected by significant differences in WN were Teratosphaeriaceae, Dothioraceae, Dothideomycetes, Diaporthales, Cyphellaceae, Schizophyllaceae, Schizophyllaceae, and WN. Schizophyllaceae, Auriculariales, Phanerochaetaceae, Polyporales, Peniophoraceae, Russulales, Basidiomycota, and Ustilaginomycetes.

Hierarchical Clustering Tree Of Phyllosphere Fungal Samples From Different Regions

Sample Hierarchical clustering tree was constructed by Hierarchical cluatering analysis based on beta diversity distance matrix, which can compare similarity and difference among multiple samples (Fig. 20). The results showed that the community composition of WN_1, WN_2 and WN_3 was similar to each other and clustered into a single branch. The similarity between WZS_1 and WZS_2 is high, and DZ_1 and DZ_2 are clustered together. The similarity of WZS_CK, WN_CK, BS_CK and DZ_CK community composition was not high, and the similarity between Wzs_CK and the other three samples in this area was low, and the difference was obvious.

Correlation Analysis Of Otus Clustering Of Interleaf Fungi With Environmental Factors

The correlations between the environmental factors (temperature, humidity, altitude) sampled at each location and the OTUs were calculated. The achieved R and P values were obtained to cluster the OTUs and environmental factors separately (Fig. 21). The results showed that OTU1391, OTU202, OTU953, OTU985, OTU1073 and OTU769 were significantly correlated with temperature and humidity and clustered into one group; OTU420, OTU419, OTU173 and OTU856 were significantly correlated with temperature and clustered into one branch; OTU652, OTU758, OTU1289 and OTU12 It was significantly correlated with altitude and clustered into one group, OTU223, OTU76, OTU1066 and OTU96 were significantly correlated with altitude and clustered into one cluster; OTU919 was significantly correlated with temperature. Among them, OTU76 and OTU1066 are highly correlated with altitude factor, OTU1391 is highly correlated with humidity, and OTU420, OTU856 and OTU1073 are highly correlated with temperature.

Sampling was based on the fact that geographical location and its relative environment are decisive factors in the community composition of interstitial microorganisms, so samples were collected from four representative areas in Hainan Province, China: Wanning in eastern Hainan, Wuzhishan and Baisha in central Hainan, and Danzhou in western Hainan. Wanning has a humid, subtropical monsoon climate with an average annual temperature of 24°C, wet winters and rainy weather. Wuzhishan and Baisha are located in the humid mountainous region, but Baisha has a tropical monsoon climate with an annual average temperature of 23.4°C. Wuzhishan has a tropical mountainous climate with an annual average temperature of 22.4°C. Compared to Baisha County, which is also a humid mountainous region, Wuzhishan has a special climate with large diurnal temperature differences and abundant rainfall. The climate in Wuzhishan is characterised by a large difference in temperature between day and night and abundant rainfall compared to the same humid mountainous region of Baisha.

Only infected leaves at Level 3 were selected for the collection of rubber tree powdery mildew leaves, because in field conditions, level 3 is the most common, level 4 (entire leaf covered with spots) mostly occurs in greenhouse conditions, while level 2 (scattered spots on the surface) normally occurs on older leaves or when the powdery mildew spots have faded and only form at the beginning or at the end of the powdery mildew period when the leaves age faster at higher temperatures. In addition, there were differences in the relative abundance of communities of Level 3 infected leaves in each region, which may be associated to the number of environmental influences in the field, so the mean values were taken for comparison with uninfected healthy leaves (level 0).

Technical Issue

Technical means: This study was performed using high-throughput sequencing technology. High-throughput sequencing technology can be a milestone in the development of sequencing technology. This technology can simultaneously sequence millions of DNA molecules, with low cost and perfect quantification, high sequencing efficiency, sensitivity and accuracy, etc. At present, this technology is widely employed in the search for candidate genes for diseases, research on plant endogenous and rhizosphere microorganisms, etc. Analytical species are relatively rare.

Discussion Of Results

The biomass of phyllosphere microorganisms is quite enormous and the biomes are extremely rich, but the scope of early studies was limited to isolated and cultured microbial populations, so the objects that could be studied and identified were very limited. With the application of molecular biotechnology to the study of microorganisms, more and more complex unclassified and unidentified fungi and bacteria have been discovered (Pan, J., et al., 2011).

There have been many studies on the relative macroscopic behavior of phyllosphere microorganisms and on the behavior of phyllosphere microorganisms when non-specific parasitic bacteria infest plants, but there are no reports on non-specific parasitic bacteria. According to the study of Liu R. et al. (2022) about the community composition of phyllosphere microorganisms of female and male plants of ash and found that the core phyllosphere microbiota was consistent, with the dominant phyla being Cyanobacteria and Aspergillus, but some differences were identified at the genus level, and the genus Androbacter was only present in female plants of ash. As in this study, Guo Xupeng (2009) collected samples from several sites, and found that the phyllosphere microorganisms of Populus tremula were mainly bacteria, followed by actinomycetes and fungi, but there were differences in the populations and numbers of phyllosphere bacteria among the five sites. Wang Xing et al. (2022) analyzed the structure of phyllosphere fungal communities of the dominant tree species in broadleaf red pine forests in Changbai Mountain and found that the dominant fungal phyla and orders were Cysticercales, Streptomycetes, and Ascomycetes, and Exocystis, respectively, and that the canopy phyllosphere fungal communities of the six dominant tree species differed significantly in composition. Some scholars have also explored the complexity in host-microbe interactions and suggested that the rational design and use of phyllosphere microbial tools, such as phyllosphere microbes, has broad potential for applications in productivity areas such as agriculture, viticulture, forestry, as well as biofuels and even human health (Laforest-Lapointe Isabelle, et al., 2018).

In this study, the current molecular biotechnology was used to analyze the phyllosphere microorganisms of rubber trees with powdery mildew, to identify their dominant populations at the phylum and genus levels, and to determine whether powdery mildew had an effect on the phyllospher microbial community structure and the relative abundance of the community.

Structure And Diversity Of Phyllosphere Bacterial Community Of Rubber Tree Powdery Mildew

To study the structure and diversity of phyllosphere bacterial communities of rubber trees with powdery mildew, healthy leaves and infected leaves at Level 3 were collected from four major areas in Hainan and analyzed for phyllosphere bacterial community structure and diversity using high-throughput techniques, and the effect of powdery mildew on phyllosphere bacteria was investigated against healthy leaves. The dominant community at the phylum level was Cyanobacteria (Cyanobacteria) with relative abundance from 71.24–98.29%, which was presumed to be related to the strong viability of Cyanobacteria and the strong symbiosis between Cyanobacteria and some eukaryotes. Because of its widespread presence on the leaf surface of rubber trees, we speculate that this genus of bacteria may have colonized the leaf surface with the wind and then multiplied rapidly, thereby fixing nitrogen to help replenish the leaf with nitrogen. In the long term, it has evolved in a mutually beneficial symbiosis with the leaves and has been able to occupy an overwhelmingly dominant position in the phyllosphere bacterial community. On the other hand, nitrogen makes the leaf luxuriant and nutritious, which provides a better parasitic environment for powdery mildew and allows the three to coexist peacefully. At the genus level, one genus (Cutobacterium) was added to the level 3 infected leaves in DZ compared with the healthy leaves, but its relative abundance was low, and it was assumed that they might have a symbiotic association with powdery mildew.

The rubber tree phyllosphere bacterial communities where powdery mildew occurred differed in the four regions in terms of subdominant genera. The Shannon index of diversity of phyllosphere bacteria of rubber trees was 0.14–1.28 for all samples except for WZS_3, which was higher (5.09).

The study showed that the genus-level community composition and relative abundance of healthy leaves and Level 3 infected leaves in the same area were not significantly different, while the genus-level community composition and relative abundance were significantly different among different areas, which could indicate that Bradyrhizobium had little effect on the phyllosphere bacterial community structure, but had an effect on the relative abundance of each community. The correlation between OTUs and environmental factors in the four regions showed that some OTUs were significantly correlated with ambient temperature and humidity, while altitude did not affect OTUs.

Structure And Diversity Of Phyllosphere Fungal Communities Of Rubber Tree Powdery Mildew

At the phylum level, the dominant phyla in all four regions were Ascomycota, Fungi_unclassified and Basidiomycota. At the genus level, the dominant genus in all four regions was Erysiphe, Cladosporium, and Fungi_unclassified, with different subdominant genera in different regions.

Erysiphe was still present in healthy leaves, and we speculate that there may be cases such as non-disease, while the relative abundance of Erysiphe on Level 3 infected leaves was significantly increased in all regions compared with healthy leaves. The relative abundance of Cladosporium increased significantly in Danzhou and decreased significantly in the other three regions, while the relative abundance of Fungi_unclassified increased significantly in Wuzhishan and decreased significantly in the other three regions, presumably because the local environment is more suitable for their growth. In Baisha and Wanning, most of the fungal communities decreased significantly with the increase of relative abundance of Bradyrhizobium, and it is assumed that they may have a competition between each other.

The fungal community composition and relative abundance varied significantly at the genus level in different regions, and the genus-level community composition was similar between the Level 3 infected and healthy leaves in the same region, but the relative abundance varied, which led to the conclusion that powdery mildew did not affect the structure of fungal communities, but only the relative abundance of each community. The correlation between the clustering of OTUs and environmental factors in the four regions showed that some OTUs were significantly correlated with ambient temperature, humidity and altitude.

Innovation

1.At present, the study on rubber tree powdery mildew infestation and its pathogenic bacteria is common, but the research using high-throughput detection techniques on determination of the dominant community of phyllosphere microorganisms on rubber trees with powdery mildew and the effect of powdery mildew on phyllosphere microorganisms have not been reported yet. In this study, we identified the dominant populations of phyllosphere fungi and bacteria at the genus level in rubber trees where powdery mildew occurs and the effect of powdery mildew on phyllosphere microorganisms, in order to better establish new mechanisms for the biocontrol of powdery mildew.

2.Most reports investigate the relationship between powdery mildew and hosts from a molecular perspective, while this project investigates the influence of the pathogenic bacteria on the phyllosphere microorganisms and hosts from a relatively macroscopic perspective. The results of this study showed that there was almost no difference between the phyllosphere microorganism populations of Level 3 diseased leaves and healthy diseased leaves in the same area, which can indicate that the phyllosphere microorganisms have a good symbiotic relationship with the host and the pathogenic bacteria. We can also confirm from a new perspective that C. albicans is a living, specialized parasite. In the hostile phyllosphere environment, phyllosphere microorganisms need to maintain good symbiotic association with hosts and pathogens to survive and evolve, thus showing a relatively stable evolutionary relationship between rubber trees, Bradyrhizobium and their attached phyllosphere microorganisms in tropical and subtropical regions. In the future, we will further investigate the interaction between the host, host pathogens and their phyllosphere microorganisms.

3.Few studies have been conducted to investigate the effects of foliar pathogens on the phyllosphere microbial community before and after plant infestation, and even fewer studies have been conducted to investigate the effects of specialized parasitic bacteria on phyllosphere microorganisms For example, Dai Yuan feng (2022) investigated the microbial diversity of tobacco leaves infested with Streptomyces and concluded that the relative abundance of Alternaria in healthy leaves increased from the first collection to the third collection, while the relative abundance of Pseudomonas, Sphingomonas and Methylobacterium from the same location increased during the gradual aging of the leaves. The relative abundance of Pseudomonas, Sphingomonas and Methylobacterium from the same location increased during the progressive senescence of the leaves; Huang Yu (2021) et al. reported that the phyllosphere microbial composition and diversity of tobacco leaves infested with subseptate strains of Phytophthora spp. The relative abundance of the fungus Didymella, Boeremia (Ascomycota) and the bacterium Pseudomonas, Pantoea (Ascomycota) was higher in the diseased group than in the healthy group, and the healthy tissue showed a relatively rich and diverse fungal community compared to the diseased group. The above-mentioned studies showed consistent changes in the abundance and species of microorganisms in the phyllosphere after pathogenic infection of the hosts. This study is the first to investigate the effect of the specialized parasitic bacterium Erysiphe on phyllosphere microorganisms of rubber trees in one of the representative rubber plantation areas in China.

The community composition of phyllosphere bacterial communities of rubber trees with powdery mildew in Danzhou, Baisha, Wanning and Wuzhishan areas of Hainan was similar at the phylum and genus levels, and the bacterial community composition varied significantly among the regions. Powdery mildew had little effect on the structure of phyllosphere bacterial communities, but had an impact on the abundance of each community, as did the community composition of phyllosphere fungi. The total aacount of OTUs in the four regions of the phyllosphere bacterial community accounted for 6.92% of all detected OTUs, and the proportion of unique OTUs was the highest in Wuzhishan (67.69%), while the Alpha diversity index was the highest in Wuzhishan, followed by Wanning and Danzhou, and the lowest in Baisha. The common OTUs in the four regions of the phyllosphere fungal community accounted for 6.44% of all detected OTUs, and the highest proportion of unique OTUs was 44.49% in the Wuzhishan region. The Alpha diversity index read the highest in Wuzhishan, followed by Baisha and Danzhou, and the lowest in Wanning.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and material

Data included in article/supp. material/referenced in article.

Competing interests

The authors declare no conflict of interest.

Funding

Prof.Weiguo Miao was supported by Hainan Province Science and Technology Special Fund [No.ZDYF2021XDNY142 & No.YSPTZX202018], National Natural Science Foundation of China [No.31660033], Hainan Yazhou Bay Seed Laboratory [No. B21HJ0905].

Authors' contributions

Weiguo Miao(Corresponding author):

1.Oversight and leadership responsibility for the research activity planning and execution, including mentorship external to the core team.

2.Writing - Review & Editing:critical review, commentary or revision.

Jiaxin Shan(First Author):

1.Conceptualization:Ideas; formulation or evolution of overarching research goals and aims.

2.Validation:Verification of the overall reproducibility of experiments and other research outputs.

3.Formal analysis:Application of statistical, mathematical, computational, or other formal techniques to analyze or synthesize study data.

4.Investigation:Conducting a research and investigation process, specifically performing the experiments, or data collection.

5.Writing - Original Draft:Preparation, creation and presentation of the published work, specifically writing the initial draft (including substantive translation).

Wu Hua(Second Author):

1.Conceptualization:Ideas; formulation or evolution of overarching research goals and aims.

2.Methodology:Development of methodology.

3.Investigation:Conducting a research and investigation process, specifically performing the experiments, or data collection.

4.Data Curation:Management activities to annotate (produce metadata), scrub data and maintain research data (including software code) for initial use and later reuse.

Xiao Li(Third Author):

1.Resources:Provision of study materials, reagents, materials, laboratory samples, instrumentation, computing resources, and other analysis tools.

2.Project administration:Management and coordination responsibility for the research activity planning and execution.

Chunhua Lin(Fourth Author):

1.Supervision:Oversight and leadership responsibility for the research activity planning and execution, including mentorship external to the core team.

2.Project administration:Management and coordination responsibility for the research activity planning and execution.

Acknowledgements

This study was fifinancially supported by Hainan Province Science and Technology Special Fund (No. ZDYF2021XDNY142 YSPTZX202018); National Natural Science Foundation of China (NSFC, No. 31660033); Hainan Provincial Natural Science Foundation of China (No. 321RC470); Hainan Yazhou Bay Seed Laboratory (No. B21HJ0905).

Lieberei Reinhard."South American leaf blight of the rubber tree (Hevea spp.): new steps in plant domestication using physiological features and molecular markers.." Annals of botany 100.6(2007).
K.K. Liyanage, et al."Taxonomic revision and phylogenetic analyses of rubber powdery mildew fungi." Microbial Pathogenesis 105.(2017). doi:10.1016/j.micpath.2017.01.054.
Cheng Du,Rong Wei,Mei Shuangshuang.Effector protein OhEF 2 enhances the susceptibility of Arabidopsis to Oidium heveae,Jounal of Tropical Biology,2021,12(1):75−82.DOI:10.15886/j.cnki.rdswxb.2021.01.011 doi:10.15886/j.cnki.rdswxb.2021.01.011.
Liu He, et al."Bacillus velezensis SYL-3 suppresses Alternaria alternata and tobacco mosaic virus infecting Nicotiana tabacum by regulating the phyllosphere microbial community."Frontiers in Microbiology 13.(2022). doi:10.3389/FMICB.2022.840318.
Jager E.S., et al."Microbial Ecology of the Mango Phylloplane.." Microbial ecology 42.2(2001).
Liu Tingting, Wang Hancheng, Sun Meili, Yin Guoying, Zhang Pan, Xiang Ligang, Cai Liuti, Meng Jianyu, ZhangChangqing. Effects of Bordeaux mixture on the community structure and metabolic function of tobacco phyllosphere microorganisms[J]. Chinese Journal of Pesticide Science, 2022, 24(6): 1446-1455. doi: 10.16801/j.issn.1008-7303.2022.0087.
Li Hui-juan, XU Ai-ling, QIAO Feng-lu, JIANG Min, SONG Qi. Micro-morphological Characteristics of Particles on Holly and Ligustrum Leaf Surfaces and Seasonal Changes in Bacterial Communities. Environmental Science, 2021, 42(6): 3063-3073.
Liu Rui, Liu Rui, Yu Wengeng, Hu Shunxin, Shang Shuai. Structural Analysis of Phyllosphere Microbial Communities of Male and Female Plants of Chinese Ash in the Yellow River Delta. Journal of Anhui University of Science and Technology.
Stone BW, Weingarten EA, Jackson CR. The role of the phyllosphere microbiome in plant health and function. Annual Plant Reviews Online 1(2018): 533-556.
Qin, Zheng, Zhang. Molecular cloning and characterization of a Mlo gene in rubber tree (Hevea brasiliensis) [J]. Journal of Plant Physiology, 2015, 175: 78-85.
Lee, Barbier, Bottos, et al. The Inter-Valley soil comparative survey: the ecology of Dry Valley edaphic microbial communities[J]. The ISME Journal, 2012, 6 (5) : 1046-1057.
Edgar. MUSCLE: multiple sequence alignment with high accuracy and high throughput[J]. Nucleic Acids Res, 2004, 32 (5): 1792-1797.
Pan Jian Gang, et al."Advances in interleaf microbial research." Journal of Ecology 31.02(2011):583-592.
Corinne Vacher, et al."The Phyllosphere: Microbial Jungle at the Plant–Climate Interface." Annual Review of Ecology, Evolution, and Systematics 47.1(2016). doi:10.1146/annurev-ecolsys-121415-032238.
Laforest-Lapointe Isabelle, ,and Whitaker Briana K."Decrypting the phyllosphere microbiota: progress and challenges.." American journal of botany 106.2(2019). doi:10.1002/ajb2.1229.
Dai Yuan feng, et al."Spatio-Temporal Variation in the Phyllospheric Microbial Biodiversity of Alternaria Alternata-Infected Tobacco Foliage ." Frontiers in Microbiology 13.(2022). doi:10.3389/FMICB.2022.920109.
Thapa Shobit, et al."Interactive effects of Magnaporthe inoculation and nitrogen doses on the plant enzyme machinery and phyllosphere microbiome of resistant and susceptible rice cultivars.." Archives of microbiology 200.9(2018). doi:10.1007/s00203-018-1540-0.
Huang Yu, et al."Phyllospheric Microbial Composition and Diversity of the Tobacco Leaves Infected by Didymella segeticola ." Frontiers in Microbiology 12.(2021). doi:10.3389/FMICB.2021.699699.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Determination of Dominant Phyllosphere Microbial Community in Rubber Trees with Powdery Mildew

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Rubber Tree Powdery Mildew

Materials And Methods

Test Material

Extraction Of Dna From Phyllosphere Microbia

Amplification And Sequencing Of 16s Rrna And Its Of Phyllosphere Microbia

Sequence Data Processing And Statistical Analysis

Results

Basic Composition and Structure of the Phyllosphere Microbia Community of Rubber Tree Powdery Mildew

Diversity Index Analysis Of Phyllosphere Microbia Of Rubber Tree Powdery Mildew

Pca Analysis And Nmds Analysis Of Phyllosphere Microbia In Samples From Different Regions

Analysis Of Phyllosphere Microbia Taxa Lefse In Samples From Different Regions

Correlation Analysis Between Clustering Of Phyllosphere Microbia Otus And Environmental Factors

Basic Composition And Structure Of The Phyllosphere Fungal Community Of Rubber Tree Powdery Mildew

Diversity Index Analysis Of The Phyllosphere Fungal Flora Of Rubber Tree Powdery Mildew

Lefse Analysis Of Phyllosphere Fungal Taxa In Samples From Different Regions

Hierarchical Clustering Tree Of Phyllosphere Fungal Samples From Different Regions

Correlation Analysis Of Otus Clustering Of Interleaf Fungi With Environmental Factors

Discussion

Technical Issue

Discussion Of Results

Structure And Diversity Of Phyllosphere Bacterial Community Of Rubber Tree Powdery Mildew

Structure And Diversity Of Phyllosphere Fungal Communities Of Rubber Tree Powdery Mildew

Innovation

Conclusion

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and material

Competing interests

Funding

Authors' contributions

Acknowledgements

References

Additional Declarations

Status:

Version 1