Experimental design
Young (3 months old, n = 24) and aged (22 months old, n = 24) male Wistar rats were acclimatized for one week, were group-housed in standard laboratory cages, and were kept at an ambient temperature of 23–25 °C. The rats were randomly assigned to 6 experimental groups (n=8): Young control (YNG), young rats received chronic stress paradigm daily for four weeks (YNG+CS), young rats received chronic stress paradigm daily for four weeks followed by a 6-week recovery period with standard conditions (YNG+CS+REC), Aged control (AGED), aged rats received chronic stress paradigm daily for four weeks (AGED+CS), and aged rats received chronic stress paradigm daily for four weeks followed by a 6-week recovery period with standard conditions (AGED+CS+REC). The experimental design and time scales of the study stages are presented in Figure 1.
Chronic stress procedure
To induction of depression-like behaviors, a chronic mild stress protocol was performed in stress-exposed groups as applied in previous studies (Ghaffari-Nasab et al. 2021; Javani et al. 2022). Animals in stressed groups were daily subjected to mild randomized stressors for four weeks, including intermittent white noise (85 dB), strobe lighting (300 flashes per minute), cage tilting (45◦), food and water deprivation, soil bedding (150 ml water in bedding), and Group housing. Young and aged control groups were kept in a separate room without any stressors.
Behavioral evaluation
To quantify chronic stress-induced depressive symptoms, the sucrose preference test (SPT) and forced swimming test (FST) were used in this study.
Anhedonic-like behavior was investigated by SPT based on the ratio of sucrose solution consumption (Ghaffari-Nasab et al. 2021). During the acclimatization session, animals were habituated with two bottles of a 1% (w/v) sucrose solution for 24 h, then one of the bottles was replaced with tap water for the next 24 h. After 24 h of water and food deprivation, the test session was performed with the same two bottles of sucrose solution and tap water, and consumption volumes of sucrose solution and tap water were recorded for 24 h to calculate sucrose preference percent as follows:
SP (%) = [sucrose solution intake (g) / sucrose solution intake (g) + water intake (g)] × 100
In addition, depressive-like behavior was assessed by FST following the previously described method (Javani et al. 2022). In the pre-test phase, the animals were placed into a cylinder filled with water at a temperature of 25 ± 2 °C and forced to swim for 15 min. After 24 hours, each rat was forced to swim, and immobility time was recorded for 5 min. Immobility time which indicates depressive behavior involves the duration of floating in the water without struggling motions.
Tissue sampling
The prefrontal cortex samples were rapidly taken following scarification under deep anesthesia with a mixture of xylazine (10 mg/kg) and ketamine (80 mg/kg) according to previously reported methods (Spijker 2011) and stereotaxic atlas (Paxinos and Watson 1982). PFC of the right hemisphere was isolated and kept at −80 °C until molecular analysis. PFC of the left hemisphere fixed in paraformaldehyde for immunocytochemistry analysis.
Real-time quantitative PCR
For the quantitative measure of prefrontal miR-101 transcription, total RNA from tissues was extracted by the RNX-Plus solution kit (Cinagen Co., Tehran, Iran). A NanoDrop-1000 spectrophotometer (Thermo Scientific, USA) was used to determine for purity and quantity of the extracted total RNA. For the cDNA synthesis, extracted RNA was reverse transcribed with a cDNA synthesis kit (SMOBiO Technology, Taiwan, including Reverse transcriptase, RNase inhibitor, dNTP Mix, Oligo (dT), Random Hexamers, and DEPC-Ttrated H2O). Finally, 1 μL cDNA was amplificated in a real-time PCR machine (Rotor-Gene 6000, Corbett, Life science, Sydney, Australia) by a SYBR Green Master Mix (Thermo Fisher, USA). The housekeeping gene, including miR-191, was used to normalize the expression levels of miR-101. Finally, the relative quantitative of miR-101 expression was calculated by the 2−ΔΔCt method (Ghaffari-Nasab et al. 2018). The primer sequences of miR-101 and miR-191 are listed in Table 1.
Table 1. The primer sequences for each of the genes.
|
Gene name
|
Accession number
|
Target sequence a
|
|
rno-miR-101
|
MIMAT0004513
|
CAGUUAUCACAGUGCUGAUGCU
|
|
rno-miR-191
|
MIMAT0000440
|
CAACGGAAUCCCAAAAGCAGCUG
|
a Sequences were derived from miRBase (www.mirbase.org).
Immunocytochemistry
Immunohistochemical detection of GluR1 was performed on formaldehyde-fixed paraffin-embedded PFC tissues. Briefly, the sections were incubated in blocking solution (1% BSA for 10 mins) and then incubated with primary antibody (Abcam, ab31232) at 1/200 for 2 hours. The sections were subsequently incubated with anti-rabbit IgG conjugated to biotin (1/200). Five coronal sections were chosen from equal levels of consecutive sections and viewed at 400× magnification. The sections were observed with fluorescence microscopy (BM-600 LED Epi-fluorescent), and the images were taken by a camera (Mshot). Positive cells were counted and quantified using digital image analysis as described previously (Xi et al. 2020).
Immunoblotting
The protein levels of Rac1, RhoA, and PSD-95 in the PFC tissue of animals were detected by the western blotting method. For this purpose, tissue samples were homogenized on ice in lysis buffer (500µL, Tris-HCL, pH=8, 0.003gr EDTA, 0.08gr NaCl, 0.025gr Sodium Deoxycholate, 0.01gr SDS, 1tablet Protease inhibitor cocktail, 10µl Triton NP40 (1%)) and were kept for 20 min at 4 °C. The supernatant was collected following centrifugation at 12,000×g for 10 min at 4 °C. Sample lysate was separated by SDS-PAGE and transferred onto PVDF membranes following electrophoresis. After blocking by 2 hr incubation of in 5% (w/v) nonfat dry milk in Tris-buffered saline, the membranes were incubated for 2 hr at 37 °C. °C) with primary antibodies against Rac1, (1:500, Santa Cruz, sc-514583), RhoA (1:500, Abcam, sc-418), PSD-95 (1:500, Santa Cruz, sc-32290), and β-Actin (1:500, Santa Cruz, sc-47778) in the antibody buffer containing 1% (w/v) nonfat dry milk in TBS-T (0.05% (v/v) Tween-20 in Tris-buffered saline). incubation with a secondary antibody (mouse anti-rabbit IgG-HRP, Santa Cruz, sc-2357) was performed in the antibody buffer for 1 hr 37 °C. Enhanced chemiluminescence (ECL) detection kit was used to visualize blots, and quantification was done using Image J software, then normalized against β-actin (Ghaffari-Nasab et al. 2022).
Statistical analysis
Data were analyzed using GraphPad Prism 9 (GraphPad Software, Inc. San Diego, CA, USA) and expressed as means ± standard errors of the mean (SEMs). Two-way analysis of variance (ANOVA) with a post hoc Tukey's test was used to detect the significant difference between groups. Statistical significance was set at p<0.05. Data collectors and analyzers were blinded to the experimental groups of the study.