Hsp Children and Healthy Controls
Stool samples from 6 HSP children (3 females aged 4, 5 and 6 years old; 3 males aged 4, 5 and 6 years old) with severe abdominal pain and 6 healthy volunteers were collected and made into a solution of fecal bacteria[8]. The liquid was stored at -80℃ in a refrigerator. HSP was diagnosed in the patients using EULAR/PReS endorsed consensus criteria[9]. The exclusion criteria used for these volunteers were as follows: (1) a restricted western-style diet; (2) suffered from known metabolic or gastrointestinal diseases; (3) received an invasive medical intervention within the past 3 months; and (4) used antibiotics or other drugs that may alter fecal microbial composition up until three months before samples were taken.
First Affiliated Hospital of Anhui Medical University’s Clinical Research Ethics Committee provided approval for the protocol used in this clinical study (20200223). All participants/their guardians provided written informed consent.
Preparation of Rats For Experiments
20 male Sprague-Dawley rats (4 weeks old, 90–120 g bw) were obtained from Anhui Medical University’s Medical Animal Laboratory. The rats were housed under 12 h light/dark cycles at 21 °C in an environmentally controlled room and were placed on wood chips in polycarbonate cages with positive-pressure sterile isolators. The rats were granted free access to sterilized drinking water and were fed an irradiated standard rodent diet (UAR, France).
Oral administration of 200 mg·kg− 1 each of streptomycin, neomycin sulfate and bacitracin, following published methods[10], were used to create pseudo germ-free (GF) model rats. The pseudo GF rats were randomly assigned into either the healthy normal control (NC) group or the HSP group, using the random number table method. One milliliter of the settled suspension from HSP patients or normal health children, was administered daily to the pseudo GF rats for seven consecutive days.
The Ethics Committee of Anhui Medical University (LLSC20200283) approved all experimental procedures, which complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals (NIH Publication No. 80 − 23).
Colorectal distension and visceral sensitivity assessment of rats
A balloon was introduced into the colon of the rats and was inflated during colorectal distension (CRD) to induce a behavioral response. The intracolonic threshold necessary for a behavioral response was used as a measure of colonic hypersensitivity[11]. This response was observed through abdominal contraction and hind section elevation. The degree of colonic pain was evaluated using the abdominal withdrawal reflex (AWR) score. Flexible 2 cm latex balloons were ligated at the tip using a 2 mm catheter (Vygon, France) to create distention balloons. The rats were kept in the tunnel for 3 days before distention for acclimatization, to prevent the recording of artifacts due to movement and to keep the stress reaction at a minimum during distention. Deflated distention balloons were pushed into the descending colon of the rats so that its end was 1 cm proximal to the anus, after the rats were lightly anesthetized using isoflurane. In order to prevent displacement, the flexible catheter was fixed with tape to the base of the tail. After the procedure, 30 minutes of recovery time was provided before CRD initiation. An electronic barostat apparatus (Can Fu Mechanical and Electrical Co., Ltd, Shanghai, China) was used to conduct the CRD tests. The balloon was progressively inflated from 0 to 80 mmHg using 20 mmHg steps that lasted 5 minutes each.
Small Intestinal Transit Experiment
After 24 h of fasting, each rat was administered with 2 ml of charcoal (10% gum arabic, 5% activated carbon). The rats were sacrificed after 30 minutes and the intestine from the pylorus to the ileocecal region was removed. Then, the total length from the pylorus to the ileocecal and the length from the pylorus to terminal carbon was measured after the intestine was straightened. The formula, intestinal propulsion rate (%) = advanced length of charcoal/total length of the small intestine × 100%, was used to calculate the rate of intestinal propulsion of each rat.
Microarray Analysis
A QIAamp fast DNA stool Mini Kit (QIAGEN) was used to purify DNA extracted from the fecal samples[12]. Amplification of the variable regions, V3 and V4, of the bacterial 16S rRNA genes was performed using TransGen ap221-02 (TransGen) reagent. High-throughput sequencing was performed to analyze the structure and diversity of fecal flora, as previously described[13]. The original data were spliced and filtered using low quality processing, and effective sequences were detected and clustered. Sequences with similarities of ≥ 97% were classified as the same OTU (operational taxonomic unit). Five indices, Chao1, Observed species, Goods_coverage, Shannon and Simpson, which determined alpha diversity were used in QIIME (Version 1.8.0) to analyze species diversity.
RT-PCR
Isopropanol precipitation was performed on RNA isolated from the DRG using TRIzol reagent (Invitrogen, Australia). A Qiagen one-step RT-PCR kit was used for polymerase chain reaction (PCR) after reverse transcription (RT) using the following steps: 30 min of reverse transcription and 15 min of initial PCR activation at 50˚C and 95˚C, respectively, followed by 40 PCR cycles of 1 min each at 94˚C, 48˚C and 72˚C. Distilled water was used instead of the RNA template for the control PCRs. Ethidium bromide staining after 1.5–3% agarose gel electrophoresis was used to identify the products of amplification. The primers used were as follows: ASIC3 forward primer: 5'AGGTCGGTGTGAACGGATTTG3' and reverse primer: 5'AGGTCGGTGTGAACGGATTTG3'; β-actin forward primer: 5'AGGTCGGTGTGAACGGATTTG3' and reverse primer: 5'AGGTCGGTGTGAACGGATTTG3'. β-actin was used for ASIC3 mRNA expression level normalization.
Western Blotting Analysis
The Bradford method was used to ascertain the protein concentrations of the protein lysates from the DRG, which were prepared using a RIPA lysis buffer. After SDS-PAGE (8–12%) was performed on 50 µg of each protein sample, the sample was transferred onto a PVDF membrane and blocked with 5% non-fat milk in TBST for 1 h. Then, ASIC3 was used as the primary antibody to incubate the membranes at 4 °C, overnight. Finally, an HRP-conjugated secondary antibody was used to incubate the membranes for 60 min at 37 °C. An ECL luminescent detection system was used to detect luminescent signals and Image J software was used to analyze the intensity of the protein bands and β-actin expression was used for normalization.
Statistical Analysis
The results are presented as mean ± SD. GraphPad InStat (USA) and SPSS 17.0 (SPSS, USA) software were used to conduct all statistical analyses. Means were compared using the unpaired t-test and statistical significance was considered to be shown by P values of < 0.05.