2.1 Animal and cell culture
All animal experiments were approved by the Animal Care Commission of the College of Veterinary Medicine Northwest A&F University (Permit Number: NWAFAC1019). Six tissue samples, i.e., heart, liver, spleen, lung, kidney, longissimus dorsi muscle were collected from sixty-day-old fetuses (n = 3) and two-year-old adults (n = 3) of the Chinese Qinchuan (QC) beef cattle breed. All the samples were provided by Shanxi Kingbull Livestock Co., Ltd., Baoji city, China. Primary bovine myoblasts (PBMs) were isolated from fetal longissimus dorsi muscle following established protocols [19]. Myoblasts were cultured in growth medium (GM) consisting of high‐glucose Dulbecco’s modified Eagle’s medium (DMEM, Gibco) with 1% penicillin-streptomycin (HyClone) and 20% fetal bovine serum (TransGen, Beijing, China). Myoblast differentiation was stimulated in DMEM containing 2% horse serum (HyClone) and 1% penicillin-streptomycin (differentiation medium, DM). Cells were incubated at 37 °C with 5% CO2.
2.2 Plasmid construction and transfection
A DNA fragment containing the precursor sequence of bta-miR-365-3p was obtained from QC cattle genomic DNA by PCR and inserted into the pcDNA-3.1(+) vector using T4 DNA ligase (Takara, Dalian, China). The resulting plasmid was named OPmiR-365-3p and used for overexpression of bta-miR-365-3p in PBMs.
Next, we used the inhibitor of bta-miR-365-3p and negative control (NC) as treatment and control groups, respectively. The sequence of bta-miR-365-3p inhibitor is AUAAGGAUUUUUAGGGGCAUUA. With a 21-23 nt 2’-methoxy modified RNA oligonucleotide design, bta-miR-365-3p inhibitor is a purified molecules that inhibit endogenous mature bta-miR-365-3p’s activities specifically and effectively. The sequence of the inhibitor’s negative control is CAGUACUUUUGUGUAGUACAA, which acted as the control group for the bta-miR-365-3p inhibitor treatment group (Table S1).
A DNA fragment containing the target site of bta-miR-365-3p of the 3'UTR of bovine AVCR1 was amplified by PCR and cloned into the XhoI and NotI sites of the psiCHECK-2 dual-luciferase reporter vector (Promega, Madison, WI, USA) and named ACVR1-wild. Mutagenic primers were used to mutagenize the bta-miR-365-3p target site, which was then cloned into psiCHECK-2 to create ACVR1-mutant. Three siRNAs of ACVR1 were used to inhibit the expression of ACVR1 in PBMs, including siACVR1-1, siACVR1-2 and siACVR1-3, the sequence of the siACVR1s were shown in Table S1.
Cells were transfected with OPmiR-365-3p, the inhibitor of bta-miR-365-3p, inhibitor N.C, ACVR1-wild, ACVR1-mutant and siACVR1s using Lipofectamine 2000 (Invitrogen, Grand Island, NY) and incubated at 37 °C with 5% CO2. The inhibitors and siRNAs were purchased from GenePharma (Shanghai, China). All experiments were done in triplicate. All the primers, inhibitor and the siRNAs sequences were listed in Table S1.
2.3 RNA extraction and qRT-PCR
Total RNA was extracted from six different tissues and from PBMs using TRIzol reagent (Takara, Japan). After assessing RNA purity and concentration by spectrophotometry using a NanoDrop 2000 (Wilmington, USA) and 0.8% agarose gel electrophoresis, 1000 ng RNAs were transcribed into complementary DNA (cDNA) with PrimeScript RT reagent kit for use in qRT-PCR with SYBR Green Master Mix Reagen kit (GenStar, Beijing). The specific stem-loop of bta-miR-365-3p was used for synthesizing the first cDNA. All the primers were listed in Table S1. The method of 2-ΔΔCt was used to calculate the relative expression levels.
2.4 Western blot analysis
All proteins were extracted from PBMs at 4 °C using the radioimmunoprecipitation assay lysis buffer (RIPA buffer) and phenylmethylsulfnoyl fluoride (PMSF) (Solarbio, Beijing, China). Proteins were measured and adjusted by using the BCA protein assay kit (MULTI SCIENCE, China) and denatured with 5 × SDS loading buffer (Beyotime) at 98 °C for 10 min. The prepared proteins were separated by SDS-polyacrylamide gel electrophoresis and then transferred to polyvinylidene fluoride membranes. After being blocked with 5% skim milk solution, we incubated membranes with the specific primary antibodies and the secondary antibody. We visualized the membranes using ChemiDocTM XRS+ system (Bio-Rad Laboratories) and ECL Plus reagents (Solarbio, Beijing, China). The primary antibodies including anti-CDK2 and anti-PCNA were obtained from Sangon Biotech (Shanghai, China), anti-ACVR1, anti-cyclinD1, anti-MyoD and anti-MyoG were purchased from Abcam (Cambrige, MA, USA). Anti-β-actin were purchased from SungenBio (Tianjin, China). HRP-conjugated Goat Anti-Rabbit IgG was obtained from BBI Life Science (Shanghai, China). All the primary antibodies were diluted with primary antibody dilution buffer that was obtained from Beyotime (Haimen, China). Image Lab TM Software 6.0.1 was used to calculate the grayscale value of the proteins.
2.5 EdU and flow cytometry assay
After the transfection of PBMs with the expression vectors, inhibitor and siRNAs, we employed the EdU proliferation assay to measure their influences on DNA synthesis using the Cell Light EdU DNA cell proliferation kit according to the instruction (RiboBio, Guangzhou, China). The stained cells were detected and calculated by fluorescence microscopy (DM5000B, Leica Microsystems). Cell cycle phases were assessed by a cell cycle testing kit (Multisciences, Hangzhou, China) on a flow cytometry instrument (FACS Canto II, BD Biosciences, USA). Briefly, the cells were seeded in 6-well plates and transfected for 24 h after the cells reached 60% confluence. Cold 70 % ethanol was used to fix the harvested cells. After staining with 100 μg/ml of the PI master mix at 37°C for 30 minutes, the cell suspension was subjected to flow cytometry.
2.6 Immunofluorescence Staining
After inducing PBMs differentiation for 4 days, 4% paraformaldehyde in PBS was used to fix differentiated myoblast in a plate for 20 min. 0.5% of Triton-X-100 was added to permeabilize the fixed myoblast for 10 min and the cells were blocked with 5% bovine serum albumin solution (BSA) at 4 °C for 2 h. Subsequently, we incubated primary antibody (anti-MyHC diluted 1:250; Abcam, Cambridge, MA) at 4 °C overnight and incubated the corresponding fluorescent secondary antibody at 4°C for 2.5 h. Finally, the cell nuclei were stained with DAPI and images were captured by fluorescence microscope (DM5000B, Leica Microsystems, Germany). The degree of differentiation was measured by the fusion index which was calculated as the number of nuclei in the myotube as a percentage of the total nuclei.
2.7 Dual-luciferase reporter assay
Dual-luciferase reporter assay was performed to test the interaction of bta-miR-365-3p with its predicted targets. HEK293T cells were co-transfected with OPmiR-365-3p vector (or the empty vector) and vectors containing ACVR1-wild or ACVR1-mutant. The dual-luciferase activity was analyzed on an MPPC luminescence analyzer (HAMAMATSU, Beijing, China) using the luciferase reporter assay kit (Promega, Madison, WI) according to the manufacturer’s instructions. The results were calculated as the ratio of firefly to Renilla luciferase activities in three independent replicates.
2.8 Bioinformatics analysis
The online databases TargetScan (http://www.targetscan.org/vert_72/) and miRmap (https://mirmap.ezlab.org/) were used to search for targets for bta-miR-365-3p [20,21]. VENNY (version 2.1) (https://bioinfogp.cnb.csic.es/tools/venny/index.html) was used to obtain the common targets from the two databases [22]. The R package clusterProfiler [23] was used to cluster the Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) for the common genes.
2.9 Statistical analysis
All the quantitative data are presented as the mean ± SD. Each group has three independent experiments. Student’ t-test procedure was used to analyze the statistical significance between groups were analyzed by SPSS v19.0. An asterisk indicated P < 0.05, two asterisks indicated P < 0.01 and three asterisks indicated P < 0.001 extremely significant between groups.