The Improvement of Fertility by Switching to Normal Diet and Restoring BTB Integrity in HFD-Induced Obese Male Mice

doi:10.21203/rs.3.rs-2817044/v1

Download PDF

Article

The Improvement of Fertility by Switching to Normal Diet and Restoring BTB Integrity in HFD-Induced Obese Male Mice

https://doi.org/10.21203/rs.3.rs-2817044/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Aug, 2023

Read the published version in Scientific Reports →

You are reading this latest preprint version

Obesity is a prominent risk factor for male infertility, and a high-fat diet is an important cause of obesity. Therefore, diet control can reduce body weight and regulate blood glucose and lipids, but it remains unclear whether it can improve male fertility and its mechanism. This study explores the effects of switching from a high-fat diet (HFD) to a normal diet (ND) on the fertility of obese male mice and its related mechanisms.

The mice in the high-fat diet group indicated elevated lipids and blood glucose, decreased serum FSH, and disrupted testicular BTB integrity, reducing fertility. After the fat intake was controlled by switching to a normal diet, body weight and epididymal fat weight were significantly reduced, and the deposition of interstitial lipids in the testicles also decreased. Following further analysis, the testicular oxidative stress levels were reduced to normal, and BTB integrity was restored, ultimately leading to increased fertility.

Our study confirms diet control by switching from a high-fat diet to a normal diet can effectively reduce body weight, improve BTB integrity in male mice, and enhance fertility, providing an effective treatment option for obese male infertility.

Obesity and overweight are caused by abnormal or excessive fat accumulation, possibly impairing health. They are metabolic disorders influenced by lifestyle factors like physical activity, the environment (food type and intake), and genetics [1, 2]. In recent years, the number of overweight people has rapidly grown, culminating in a global obesity pandemic [3]. A decline in male fertility has accompanied this rise in obesity rates [4]. Numerous studies have indicated that obesity and being overweight are linked with low fertility [5–8], impairing the male reproductive system and fertility by affecting erectile function and semen parameters [8]. The previous study has proven that animal models of diet-induced obesity had lowered testosterone levels [9] and abnormal sperm parameters [10–12], including reduced sperm viability, decreased sperm count and growing sperm malformations, leading to decreased fertility.

Dietary modification is considered the cornerstone of weight control. The international consensus advocates that the most effective way of losing weight is through reducing calories by controlling the source of fat. In contrast to high-calorie diet regimens, the intake of low-calorie diets leads to short-term weight loss in obese individuals, as well as improved glucose control and lipid metabolism [13, 14]. Additionally, some evidence suggests that weight loss through exercise, lifestyle changes, or surgery can improve serum testosterone levels and sperm counts, aiding male fertility [15, 16]. In several prospective studies and randomised controlled trials, weight loss through low-calorie or low-fat diets increased erectile function and testosterone levels in men [17–19]. Nevertheless, it remains unclear whether switching from a high-fat diet (HFD) to a normal diet (ND) alone can improve obesity and fertility in male specimens.

A specialised junction between adjacent Sertoli cells close to the basement membrane of the seminiferous epithelium forms the blood-testis barrier (BTB), deemed one of the tightest epithelial barriers in the entire body [20, 21]. Damage to the BTB can cause germ cell loss, decreased sperm counts, and male infertility [22]. The body experiences oxidative stress when reactive oxygen species (ROS) are produced at a higher rate than antioxidant defenses. Moreover, obesity is a major contributor to systemic oxidative stress. [23]. Substantial evidence suggests ROS-mediated injury to the spermatozoa is the primary contributing factor in 30–80% of infertility cases [24, 25]. The previous work has indicated that HFD mice cause damage to the BTB following increased systemic oxidative stress, thereby diminishing fertility in male mice [26]. However, it remains unclear whether switching from a high-fat to a normal diet can alleviate BTB damage by improving oxidative stress and thus benefitting male fertility.

In this study, to elucidate the effect of diet control by switching from HFD to ND regarding the fertility of obese male mice, an obese mouse model was created by feeding it HFD, while a lowered-fat mouse model was established by withdrawing the HFD and feeding it ND. Additionally, the alterations in testicular ultra-microstructure, testicular oxidative stress levels, BTB integrity, and related proteins were further evaluated to investigate the effects and mechanisms of controlled fat intake on male fertility.

2.1 Animals and Diets

The study was carried out in compliance with the ARRIVE guidelines(Animal Research: Reporting of In Vivo Experiments). All animal experiments were approved by the Animal Ethics Committee of Shandong Provincial Hospital and conducted per the requirements of the Shandong Provincial Hospital Animal Protection and Utilization Committee. Vital River Corporation (Beijing, China) provided 7-week-old male and 9-week-old female C57BL/6 mice for this experiment, which were housed in rooms controlled in terms of temperature and 12-hour light/dark cycle. In a randomization procedure, male mice were randomly placed into two groups and given either of these two diets for eight weeks: the ND group (N, n = 20) was fed a standard diet (D12450B, Research Diet) in which 10% of the calories were from fat, while the high-fat diet group (H, n = 30) was given HFD (D12492, Research Diet) in which 60% of the calories came from fat. The energy availability of the two diets is shown in Table S1.

For further mechanistic analysis, 10 mice in each group were executed to test the corresponding indexes after the 8th week of feeding. Mice in the regular diet group (NN, n = 10)continued to be fed with ND for 8 weeks. Mice in the H group were randomly divided into two subgroups and continued to be fed with different diets for 8 weeks: (a) maintain feeding with the HFD group (HH = 10) or (b) restore to the ND group (HN = 10). The body weight of the mice was monitored weekly at 5 p.m. throughout the rearing period (acclimation weeks and the following 8 or 16 weeks). At the end of the experiment, mice were sacrificed at 16 weeks. The design of the animal models is illustrated in Figure S1.

After being fasted for 8 h, all mice were anesthetized by intraperitoneal injection of Avertin(280mg/kg). After anesthesia, the blood of mice was collected from the eyeballs and centrifuged twice at 3500 rpm for 15 minutes. The serum supernatant was stored at -80°C. Testis and epididymal fat were immediately separated and weighed. One testis was fixed in Modified Davidson’sfluid for morphological analysis and immunofluorescence, fixed in 2.5% glutaraldehyde and 1% osmium tetroxide for ultrastructure analysis, and the other testis was rapidly stored in liquid nitrogen for oil red staining, mRNA and protein analysis, and oxidative stress-related testing. Eventually, all mice were euthanized by CO2 inhalation.

2.2 Reproductive Ability Assay

Female mice were randomly grouped based on their body weight at the 7th and 15th week, and the male mice were mated with two females randomly for five consecutive days between 5 pm and 8 am for the comparison of the reproductive capabilities of male mice fed differently. Every morning, female mice's vaginal plugs were examined to see if sexual intercourse had taken place. They were moved to another cage to be observed until the pups were born. Fertility was assessed by the number of pregnant females and by determining the number and size of litter delivered.

2.3 Lipid Parameter and sex hormone analysis

Routine enzyme measurements were performed on serum glucose and lipid profiles. A lipid metabolism analysis was conducted by measuring low-density lipoprotein cholesterol (LDL-cholesterol), high-density lipoprotein cholesterol (HDL-cholesterol), triglyceride (TG), and total cholesterol (TC) levels. Besides, We evaluated serum levels of follicle-stimulating hormone (FSH) using a commercially available ELISA kit supplied by Abnova.

2.4 Oil Red O Staining

Oil Red O staining was carried out using an oil red dye from Changsha Guge Biotechnology according to the manufacturer's directions. Briefly, frozen sections (10 µm) of testis were fixed in Slides with 95% ethanol for 10 s. Next, the samples were rinsed in distilled water for 10 s, washed in tap water for 2 min, and finally incubated in oil red dye for 15 min in the dark. The slides were then washed again with distilled water, and counter corroded with hematoxylin for 30 seconds.

2.5 Haematoxylin and Eosin (H&E) Staining

A series of graded ethanol solutions was consumed to dehydrate and embed paraffin-embedded testicular tissue samples to verify the histopathological changes. A microtome (Leica, USA) was used to section paraffin to a thickness of 4 µm, and the sections were then stained with H&E under a Carl Zeiss microscope.

2.6 Malondialdehyde (MDA), Superoxide Dismutase (SOD), and ROS Measurements.

The ELISA kits for SOD and MDA were all obtained from the Beyotime Institute of Biotechnology, as well as a ROS assay kit provided by Nanjing Jiancheng Bioengineering Institut. As directed by the manufacturer, MDA content, SOD activity, and ROS levels were measured using the ELISA kits, and these measurements were normalized to total protein content.

2.7 Testicular Transmission Electron Microscopy (TEM) Analysis.

Testis were dehydrated in increments of ethanol and acetone solutions, embedded in EPON 812, and sectioned with an LKB ultramicrotome to determine how they changed at the ultrastructural level. In the following steps, the testis were stained with uranyl acetate and dyed with lead citrate before being observed with a JEM-1200EX transmission electron microscope (JEOL, Japan).

2.8 BTB Integrity Assay.

The integrity of Sertoli cell BTB was in vitro assessed using a biotin tracer according to previously described procedures, and analyzed with a fluorescence microscope. Briefly, the gaps below the testicular tunica albuginea were injected with 50 µl of Biotin (10 mg/ml). After 30 min, we euthanized the animals, then sectioned, fixed, and blocked the testicular tissue, before incubating at room temperature with Alexa Fluor® 568-conjugated streptavidin and DAPI for 2 hours.

2.9 Real-time quantitative PCR (qPCR) analyses.

Based on the instructions of the manufacturer, RNA was isolated from 20mg of frozen testicular tissue using an RNA prep kit( LS1040, Super Total RNA Extraction Kit, Promega) and reverse-transcribed into cDNA (TaKaRaBio Inc., Japan). Our experiments were performed using SYBR premix Ex Taq II (Takara Bio) in a TP850 Thermal Cycler Dice Real Time System Single (Takara, Japan). The primer sequences are listed in Table 1. Thermal cycling conditions were as follows: 5 min at 95°C; 40 cycles of 10 s at 95°C, 10 s at 60°C, 10 s at 72°C; melting curve from 95 to 60°C; and 37°C for 10 s.

Table 1

Primer sequences were used for the analysis of mRNA expression levels.
Gene	Forward primer	Reverse primer
ZO-1	GCCGCTAAGAGCACAGCAA	TCCCCACTCTGAAAATGAGGA
Occludin	TTGAAAGTCCACCTCCTTACAGA	CCGGATAAAAAGAGTACGCTGG
N-cadherin	AGCGCAGTCTTACCGAAGG	TCGCTGCTTTCATACTGAACTTT
beta-Catenin	CCCAGTCCTTCACGCAAGAG	CATCTAGCGTCTCAGGGAACA
Nectin2	GCATCATTGGAGGTATTATCGCT	GAGGGAGGTCCTTCCAGTTC
beta-Actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

2.10 Immunoblot analysis.

We determined total protein concentration using the BCA method from 20 mg of frozen testicular tissue extracted by RIPA lysate as previously described. Then 60 mg of protein samples were separated by 7.5% SDS-PAGE( Millipore, America) and electrophoretically transferred to PVDF membranes. Following blocking, the membranes were incubated overnight with specific primary antibodies( ZO-1, occludin, N-cadherin, beta-catenin, nectin2, JAM), washed, and then conjugated with secondary antibodies peroxidase-conjugated. The antibodies are shown in Table 2. Our analysis was performed using ImageJ Lab software, and protein levels were normalized to beta-Actin levels.

Table 2

Antibodies used in immunoblot analysis.
Antibody	Species	Corporation	Catalog Number
ZO-1	rabbit	ThermoFisher	40-2200
Occludin	rabbit	ThermoFisher	71-1500
N-cadherin	rabbit	ProteinTech Group, Inc	13769-1-AP
Beta-Catenin	rabbit	ProteinTech Group, Inc	51067-2-AP
Nectin2	rabbit	Abcam	Ab135246
JAM	rabbit	ThermoFisher	36-1700
beta-Actin	mouse	Proteintech	60008-1

2.11 Immunofluorescence

As previously described, immunofluorescence was performed with some modifications. At 4°C overnight, sections of tissue were coated with rabbit anti-ZO-1 (1: 25, ThermoFisher 40-2200), followed by incubation with secondary antibodies and DAPI staining for 1h.

2.12 Statistical analysis

All data were presented as the Mean ± SEM. One-way ANOVA was used to analyze the difference between the three groups. The data were considered significant when the p-value was < 0.05 (*^、#) or < 0.01 (**^、##). GraphPad Prism 8 was used for statistical analysis.

3.1 The Reduction of Body Weight and Improvement of Abnormalities in Glucolipid Metabolism Through Diet Control by Switching from HFD to ND and Fertility Loss Caused by HFD

To establish whether diet control by switching from HFD to ND could effectively improve male reproductive dysfunction in light of obesity, we found an 8-week HFD-fed obese mouse model. As in previous studies, these mice suffered from significant abnormalities in glucolipid metabolism, accompanying the subfertility of the mice. Ten mice were randomly withdrawn from the HFD group in the 9th week to be continued feeding an ND, and the expression of relevant parameters was measured in the 16th week. Figures 1A and 1B demonstrate that mice in the HN group lost significant body weight compared to the HH group, considering normal levels reached in the 16th week (P < 0.01). By the 16th week, no difference was observed in testicular weight between the three groups of mice (Fig. 1C). However, the epididymal fat weight was significantly lower in mice switching from HFD to ND (Fig. 1D, 1E, P < 0.01). These results indicate that diet control by changing from HFD to ND can lower body weight and improve epididymal fat accumulation in obese mice. In addition, Figs. 1F and G illustrate that TC, HDL-c, LDL-c, and Glu were remarkably decreased to normal levels in the HN group (P < 0.01), as opposed to the HH group, suggesting that diet control by switching from HFD to ND could benefit the abnormal glucolipid metabolism caused by HFD.

FSH is an essential regulator of Sertoli cell proliferation, quantitatively supporting rodent spermatogenesis [27]. Thus, we measured serum FSH levels. The results highlight the elevation of serum FSH levels in the HN group compared with mice in the HH group (Fig. 1H, P < 0.05). Moreover, in experiments linked with fertility testing, although there was no significant difference in fertility (Fig. 1I) and mean pup weight (Fig. 1K) in the three groups, the number of pups per litter in the HN group was significantly higher compared to the HH group (Fig. 1J). According to these results, diet control by switching from HFD to ND can lower body weight and epididymal fat deposition in obese mice and improve obesity-induced abnormalities in glucolipid metabolism and fertility decline.

3.2 Diet Control by Switching from HFD to ND Can Improve Testicular Lipid Deposition and Morphological Abnormalities Caused by HFD

We performed oil-red O staining on testicular tissue during further investigations on the effect of diet control executed by switching from HFD to ND on the testis. HFD greatly enhanced lipid accumulation in the testicular interstitium and seminiferous tubules, and lipid deposition in the interstitium of the testis was considerably reduced after switching from HFD to ND (Fig. 2A, 2B, P < 0.05). Notably, the histomorphological changes in the testis were observed with H&E staining. As seen in Fig. 2C, compared with the mice in the NN group, the germinal epithelial organisation of the HFD group was severely disorganised, the epithelium was thinned, and the cell adhesion between SCs and germinal cells was disrupted and only loosely arranged. On the contrary, switching to the ND allowed for improvement of the morphology of the germinal epithelium, and the germinal cells were organised in an orderly manner, resembling the morphological structure of the mice in the NN group. Based on the initial results, the HFD disrupts the general morphology of the testis and induces testicular lipid deposition. Therefore, switching to ND can improve testicular lipid deposition and morphological abnormalities of the spermatogenic epithelium.

3.3 Diet Control by Switching from HFD to ND Repairs BTB Integrity

BTB is guaranteed in cases of normal spermatogenesis. To verify the improvement of BTB integrity by switching to ND, we analysed BTB integrity utilising biotin tracers. As seen in Figs. 3A and B, biotin crossed the BTB and accumulated significantly into the lumens of the majority of seminiferous tubules in the HH group, whereas, in the HN group, biotin was situated solely in the interstitial portion of the testis. The above results illustrate that BTB integrity is disrupted in the testis of mice fed HFD and that switching to ND can fix the integrity disruption.

A testicular TEM analysis was performed to verify further the effect of switching to ND on testicular BTB structure at the ultra-microstructural level. As in Fig. 3C, the testicular Sertoli cells of NN mice were properly arranged with an integrated endoplasmic reticulum (ER) structure and had a typical BTB structure. Nevertheless, in the testis of the HH group, the cell junctions adjoining SCs appeared discontinuous. In addition, they dehisced in the seminiferous tubules, indicating that the integrity of the BTB was impaired. Meanwhile, ER dilation and increased proteins were present on both sides of BTB in the HH group, highlighting abnormal expression of BTB-related proteins and ER stress in mice fed HFD. In contrast, BTB integrity was partially restored in mice switching to ND.

3.4 Diet Control by Switching from HFD to ND Alleviates HFD-induced Elevated Levels of Oxidative Stress in the Testis

Testicular oxidative stress is a prominent trigger of reproductive abnormalities in obese males. Therefore, a range of oxidative stress indicators was examined to assess the effect of diet control by switching from HFD to ND on testicular oxidative stress levels. As seen in Fig. 4, even though no increase in SOD levels was observed in the HH group compared with the NN group (Fig. 4C), ROS levels were remarkably increased in the HH group (Fig. 4B, P < 0.05). On the other hand, the testicular ROS and MDA levels were lowered to normal levels in the mice after switching to ND (Fig. 4A and B, P < 0.05).

3.5 Diet Control by Switching from HFD to ND Improves the Abnormal Expression of BTB-related Proteins Induced by the High-fat Diet

To further assert the mechanism of BTB integrity disruption caused by HFD and the protective effect of switching to ND, the changes in BTB-related molecules at the mRNA and protein levels were considered. The mRNA levels of BTB-related molecules were not significantly altered in the three mice groups (Fig. 5A). However, ZO-1 and occludin proteins were increased drastically in the HH group, and their abnormal expression was reduced when ND was switched on (Fig. 5B, 5C). The above results suggest that a high fat diet induces abnormal BTB protein expression, which could be improved by switching to ND.

Due to abnormal expression of BTB proteins, the localisation of junction proteins on BTB may affect its function. Therefore, we observed ZO-1 immunofluorescence on BTB to confirm the localization of junction proteins. As seen in Fig. 5D, the localisation of ZO-1 did not differ in the testis of the three groups. Still, consistent with the immunoblotting results, ZO-1 protein accumulated significantly on the BTB in the HH group, and the abnormal accumulation of ZO-1 was diminished after switching to ND.

Obesity and being overweight are associated with low fertility [4, 28, 29]. Additionally, a convincing association exists between dietary patterns and male fertility, with a low-fat diet benefitting erectile dysfunction and increasing testosterone levels in obese men [15, 16]. Calorie and fat restriction is an effective and popular way to reduce obesity [30–33]. Nonetheless, it is uncertain whether diet control by merely switching from HFD to ND can restore fertility in obese males. The objective of this study was to examine the effects of switching to ND on obese male fertility, as well as the mechanisms involved. According to the results, the high-fat diet mice suffered from reduced fertility and had abnormal glucolipid metabolism, impaired BTB integrity, and elevated levels of oxidative stress. Switching to a normal diet increased fertility and normalised the glycolipid metabolism of the mice, while oxidative stress levels were lowered and BTB integrity was restored.

High dietary fat content is broadly considered a significant factor in obesity [34]. Furthermore, dietary modification is the cornerstone of weight control, and numerous human studies have reaffirmed that casual consumption of diets with low-fat content can reduce weight in obese individuals [35, 36]. This research utilised high-fat and normal diets to feed mice. Both feeds have the same formulation ingredients and total calorie (kcal) content. Only individual formulation ingredients, such as maise starch, maltodextrin, sucrose, and lard, differ regarding calorie contents. The high-fat diets are characterised by fat providing 60% of total calories and protein at normal levels (20% of total calories) to resemble the unreasonably high-fat diet of humans. Simultaneously, normal diets provide only 10% of total calories from fat, 20% from protein, and 60% from carbohydrates.

Consistent with the previous experimental results, sustained HFD-fed mice suffered from weight gain and abnormal glucolipid metabolism, serving as proof of the effective construction of the HFD-induced obesity mouse model. In addition, HFD mice had lower fertility, and the number of pups per litter was significantly lower than those found in ND mice. Furthermore, obese mice switching from HFD to ND lost significant weight from week two and returned to normal levels at week 16. The fertility of mice switching to ND was greatly improved, as proven by a distinct increase in the number of pups per litter, restored to normal amounts. These results confirmed the claim that retrieving the high-fat content of the diet to a normal level improves male obesity status and reproductive abilities.

A high-fat diet can induce free fatty acid overload and deposition in ectopic tissue, causing structural damage and functional abnormalities [37–39]. To assess the lipotoxicity in the testis, Oil red O and H&E staining were carried out to observe lipid deposition and morphologic changes in the testis of mice. Following dyslipidemia, epididymal fat was remarkably increased in mice fed with an HFD. Testicular lipids are deposited ectopically at the bases of the germinal tubules through the penetration of the basement membrane in the interstitium, which also accumulates a large number of lipids. There was a lack of organisation in the germinal epithelium, and there was a loose arrangement of cell adhesions between SCs and germinal cells. According to these results, the testis and germinal tubules of mice on HFD are in a lipotoxic microenvironment, and the testicular structure was destroyed.

In contrast, after switching from HFD to ND, the mice reduced epididymal fat to normal, followed by significantly improved dyslipidemia. Additionally, lipid deposition in the testicular interstitium was lowered considerably. Testicular spermatogenic epithelial morphology was enhanced, with cell adhesion between SCs and spermatogenic cells returning to normal. These results indicate that returning the high-fat diet to a normal diet significantly benefited the testicular lipotoxic microenvironment and testicular morphology. These can contribute to rest oring male reproductive abilities.

Hormones of the hypothalamus-pituitary-gonadal (HPG) axis help control reproduction, and SCs in the basal compartment of seminiferous tubules play an essential role in testicular development and spermatogenesis, essential for maintaining male fertility [27]. FSH acts on SCs and influences their proliferation, maturity, and function [40–42]. In adult mice, FSH drives SCs to produce regulatory molecules and nutrients necessary for spermatogenesis [27, 43]. Furthermore, The FSH protein regulates structural genes that are critical to organising cell-cell junctions and metabolizing nutrition delivered by SCs to germ cells. [27, 44, 45]. Our research highlights that FSH levels were greatly reduced in mice on HFD.

Nevertheless, FSH levels were elevated back to normal in mice switching to ND. Alterations of FSH propose changes in the HPG axis, possibly affecting fertility in male mice through SCs. Thus, it is recommended that the improvement of fertility, testicular spermatogenic epithelial morphology, and adhesion between SCs is attributed, on the one hand, to the alleviation of the lipotoxic state with lowered testicular lipid deposition and, on the other hand, to the restoration of FSH circulating levels, improving the structure and function of SCs.

BTB primarily comprises vascular endothelial cells, germ cells, SCs, and stromal membranes, among which the role of SCs proves of utmost importance [46]. Various junctional structures formed between the SCs, like a tight junction, adherens junction, and gap junction, are the foundation for the maintenance of the structural integrity of the BTB [8, 47–49]. Deficiencies in BTB integrity harm the reproductive system and cause reproductive dysfunction[20, 22]. The previous study confirmed that HFD disrupts BTB integrity, thus impairing male reproductive function. Yet, it remains unclear whether diet control by merely switching from HFD to ND can alleviate BTB damage in obese males to restore their fertility.

As such, the integrity of BTB by transmission electron microscopy and immunofluorescence with biotin tracers was first assessed. The results of electron microscopy indicate that the structure of BTB in HFD mice became blurred, cellular connections adjacent to SCs in the germinal tubules were discontinuous, the ER expanded, and the BTB protein got higher, leading us to believe that mice fed HFD may have ER stress and abnormal expression of BTB-related proteins. Furthermore, biotin accumulated in the glandular compartment of the germinal tubules across the BTB, usually consistent with our previous findings. On the other hand, the mice switching to ND recovered a continuous and compact BTB structure. Furthermore, no biotin accumulation was noted in the glandular lumen of the germinal tubules of mice switching to ND, indicating the restoration of BTB integrity.

Human, as well as mouse experiments, have shown elevated levels of oxidative stress in obese patients[23]. Excessive intracellular mitochondrial ROS secretion is linked with testicular damage and male infertility[50, 51], and ROS-mediated sperm damage is an important cause of infertility in 30–80% of men[24, 25]. Previous studies have demonstrated that the activated ROS signalling pathway can add to HFD-induced BTB damage[26]. Other studies have reaffirmed that vitamins C and E reduce BTB damage by alleviating oxidative stress and benefitting male fertility[52, 53]. Accordingly, to assess if oxidative stress was involved in BTB damage, we examined the levels of testicular oxidative stress in mice. Prior studies indicated that protein restriction in dietary control, specifically methionine restriction, is a determinant of oxidative stress rather than calorie and fat restriction[54–57]. Nevertheless, our results confirm that ROS levels are significantly higher in HFD-fed mice and that weight loss by switching from HFD to ND to restrict fat intake can lower ROS levels back to normal. In MDA tests, oxygen radicals are detected as a result of attacks on active cells, which reflect the body's level of free radical metabolism and the severity of the attacks. Higher MDA triggers oxidative stress, contributing to cellular damage and even proving to be a cause of death [58, 59]. A significant decrease in testicular malondialdehyde levels in mice switching to ND was discovered. This highlights that weight loss by changing from HFD to ND can significantly reduce testicular oxidative stress levels in obese males, possibly contributing to the recovery of BTB integrity.

The BTB structure at the molecular level primarily comprises various associated and linked proteins. For example, tight Junction includes ZO-1, Occludin, and JAM protein; Basal Ectoplasmic Specialization has N-Cadherin, B-Catenin, and Nectin2 [60]. A junction between SCs is where these proteins are located on the membrane of the cell. They are part of forming various connexin complex structures in a dimer or hexamer pattern to keep the normal structure and function of BTB [20]. Yet, under the stimulation of external factors, the expression and localisation of these proteins may undergo abnormal alteration, causing structural damage to BTB [61, 62]. Hence, we further examined the changes in BTB-related molecules at the mRNA and protein levels.

Even though there was a lack of change observed in BTB-related molecules at the RNA level in the three groups of mice, TJ-related proteins like ZO-1 and occludin were significantly higher when mice were fed the HFD. Therefore, it is suggested that TJ-related proteins can be targets of lipotoxicity and oxidative stress. This compromises BTB integrity when germinal tubules are in a lipotoxic microenvironment and levels of oxidative stress are elevated. The increase in ZO-1 and occludin proteins is a compensatory response to BTB damage. SCs are synthesising a higher amount of TJ-related proteins to repair the dehiscent BTB, as claimed by the study of Morgan et al [63]. In mice switching from HFD to ND, BTB integrity was restored, and the compensatory response of ZO-1 and occludin proteins disappeared as testicular lipotoxicity and oxidative stress improved. The current study indicates that diet control by switching from HFD to ND improves the abnormal expression of BTB-related proteins and can be part of repairing the structural integrity of BTB.

Normal expression of BTB-related proteins is critical in maintaining BTB integrity and male fertility. Oxidative stress can affect the expression of related proteins. Nevertheless, our experiments did not probe how diet control restored the expression of BTB-associated proteins, keeping the BTB integrity by lowering oxidative stress levels. The relationship between oxidative stress and BTB-related protein and the possible mechanism will be further explored in coming studies. Additionally, the restoration of FSH levels, as well as the alleviation of pituitary lipotoxicity, can contribute to BTB repair. The effect of pituitary lipotoxicity on fertility in obese men and the potential mechanism of the impact on fertility deserve future research.

In sum, diet control by switching from HFD to ND can lead to effective weight loss in obese male mice. Furthermore, A reduction in fat intake can lower oxidative stress in obese male mice's testis, restoring the integrity of BTB and enhancing fertility. The experiment confirms the rationale for restoring a regular diet to reduce dietary fat content, reasserts the benefit of lowered fat intake in improving fertility in obese men, and suggests an effective treatment option for infertility in men suffering from obesity.

AUTHOR CONTRIBUTIONS

W. Z and Z. T performed the experiments and wrote the main manuscript. C. Y, J. Y and Q. G conducted research designed and performed the study. X. Q, P. C and Q.Y participated in parts of the experiments. All authors read and approved the final manuscript.

FUNDING

This work was supported by grants from the National Natural Science Foundation (82270839 and 81770860) and the Key Research and Development Plan of Shandong Province (2017CXGC1214).

ETHICS STATEMENT

The animal study was reviewed and approved by the Animal Ethics Committee of Shandong Provincial Hospital. The study was carried out in compliance with the ARRIVE guidelines.

ADDITIONAL INFORMATION

Figure S1: The flowchart of the animal experiments.

Table S1: Energy supply ratio of experimental diet.

CONFLICT OF INTEREST

Author disclosures: Wenjing Zhang, Zhenhua Tian, Xiangyu Q, Pengcheng Chen, Qian Yang, Qingbo Guan, Jifeng Ye, and Chunxiao Yu declare no conflicts of interest.

DATA AVAILABILITY STATEMENT

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.

Jeon J, Kim S, Kwon SM. The Effects of Urban Containment Policies on Public Health. Int J Environ Res Public Health. 2020;17(9):3275. doi:10.3390/ijerph17093275
Lang J, James C, Ashby S, et al. The provision of weight management advice: an investigation into occupational therapy practice. Aust Occup Ther J. 2013;60(6):387-394. doi:10.1111/1440-1630.12073
Diet, nutrition and the prevention of chronic diseases. World Health Organ Tech Rep Ser. 2003;916:i-viii, 1-149, backcover.
Swan SH, Elkin EP, Fenster L. The question of declining sperm density revisited: an analysis of 101 studies published 1934-1996. Environ Health Perspect. 2000;108(10):961-966. doi:10.1289/ehp.00108961
Reverchon M, Maillard V, Froment P, Ramé C, Dupont J. [Adiponectin and resistin: a role in the reproductive functions?]. Med Sci (Paris). 2013;29(4):417-424. doi:10.1051/medsci/2013294016
Sallmén M, Sandler DP, Hoppin JA, Blair A, Baird DD. Reduced fertility among overweight and obese men. Epidemiology. 2006;17(5):520-523. doi:10.1097/01.ede.0000229953.76862.e5
Lu JC, Jing J, Yao Q, et al. Relationship between Lipids Levels of Serum and Seminal Plasma and Semen Parameters in 631 Chinese Subfertile Men. PLoS One. 2016;11(1):e0146304. doi:10.1371/journal.pone.0146304
Cabler S, Agarwal A, Flint M, du Plessis SS. Obesity: modern man’s fertility nemesis. Asian J Androl. 2010;12(4):480-489. doi:10.1038/aja.2010.38
Erdemir F, Atilgan D, Markoc F, Boztepe O, Suha-Parlaktas B, Sahin S. [The effect of diet induced obesity on testicular tissue and serum oxidative stress parameters]. Actas Urol Esp. 2012;36(3):153-159. doi:10.1016/j.acuro.2011.06.019
Fariello RM, Pariz JR, Spaine DM, Cedenho AP, Bertolla RP, Fraietta R. Association between obesity and alteration of sperm DNA integrity and mitochondrial activity. BJU Int. 2012;110(6):863-867. doi:10.1111/j.1464-410X.2011.10813.x
Fan Y, Liu Y, Xue K, et al. Diet-induced obesity in male C57BL/6 mice decreases fertility as a consequence of disrupted blood-testis barrier. PLoS One. 2015;10(4):e0120775. doi:10.1371/journal.pone.0120775
Bakos HW, Mitchell M, Setchell BP, Lane M. The effect of paternal diet-induced obesity on sperm function and fertilization in a mouse model. Int J Androl. 2011;34(5 Pt 1):402-410. doi:10.1111/j.1365-2605.2010.01092.x
Chao AM, Quigley KM, Wadden TA. Dietary interventions for obesity: clinical and mechanistic findings. J Clin Invest. 2021;131(1):140065. doi:10.1172/JCI140065
Heilbronn LK, Noakes M, Clifton PM. Effect of energy restriction, weight loss, and diet composition on plasma lipids and glucose in patients with type 2 diabetes. Diabetes Care. 1999;22(6):889-895. doi:10.2337/diacare.22.6.889
Håkonsen LB, Thulstrup AM, Aggerholm AS, et al. Does weight loss improve semen quality and reproductive hormones? Results from a cohort of severely obese men. Reprod Health. 2011;8:24. doi:10.1186/1742-4755-8-24
Palmer NO, Bakos HW, Owens JA, Setchell BP, Lane M. Diet and exercise in an obese mouse fed a high-fat diet improve metabolic health and reverse perturbed sperm function. Am J Physiol Endocrinol Metab. 2012;302(7):E768-780. doi:10.1152/ajpendo.00401.2011
Schulte DM, Hahn M, Oberhäuser F, et al. Caloric restriction increases serum testosterone concentrations in obese male subjects by two distinct mechanisms. Horm Metab Res. 2014;46(4):283-286. doi:10.1055/s-0033-1358678
Khoo J, Piantadosi C, Worthley S, Wittert GA. Effects of a low-energy diet on sexual function and lower urinary tract symptoms in obese men. Int J Obes (Lond). 2010;34(9):1396-1403. doi:10.1038/ijo.2010.76
Moran LJ, Brinkworth GD, Martin S, et al. Long-Term Effects of a Randomised Controlled Trial Comparing High Protein or High Carbohydrate Weight Loss Diets on Testosterone, SHBG, Erectile and Urinary Function in Overweight and Obese Men. PLoS One. 2016;11(9):e0161297. doi:10.1371/journal.pone.0161297
Cheng CY, Mruk DD. The blood-testis barrier and its implications for male contraception. Pharmacol Rev. 2012;64(1):16-64. doi:10.1124/pr.110.002790
Mital P, Hinton BT, Dufour JM. The blood-testis and blood-epididymis barriers are more than just their tight junctions. Biol Reprod. 2011;84(5):851-858. doi:10.1095/biolreprod.110.087452
L Q, X Z, X Z, et al. Sertoli cell is a potential target for perfluorooctane sulfonate-induced reproductive dysfunction in male mice. Toxicological sciences : an official journal of the Society of Toxicology. 2013;135(1). doi:10.1093/toxsci/kft129
Furukawa S, Fujita T, Shimabukuro M, et al. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest. 2004;114(12):1752-1761. doi:10.1172/JCI21625
Aitken J, Fisher H. Reactive oxygen species generation and human spermatozoa: the balance of benefit and risk. Bioessays. 1994;16(4):259-267. doi:10.1002/bies.950160409
Agarwal A, Prabakaran S, Allamaneni S. What an andrologist/urologist should know about free radicals and why. Urology. 2006;67(1):2-8. doi:10.1016/j.urology.2005.07.012
Ye J, Luo D, Xu X, et al. Metformin Improves Fertility in Obese Males by Alleviating Oxidative Stress-Induced Blood-Testis Barrier Damage. Oxid Med Cell Longev. 2019;2019:9151067. doi:10.1155/2019/9151067
Oduwole OO, Peltoketo H, Huhtaniemi IT. Role of Follicle-Stimulating Hormone in Spermatogenesis. Front Endocrinol (Lausanne). 2018;9:763. doi:10.3389/fendo.2018.00763
Strain GW, Zumoff B, Kream J, et al. Mild Hypogonadotropic hypogonadism in obese men. Metabolism. 1982;31(9):871-875. doi:10.1016/0026-0495(82)90175-5
Pellitero S, Olaizola I, Alastrue A, et al. Hypogonadotropic hypogonadism in morbidly obese males is reversed after bariatric surgery. Obes Surg. 2012;22(12):1835-1842. doi:10.1007/s11695-012-0734-9
Koga F, Kitagami S, Izumi A, et al. Relationship between nutrition and reproduction. Reprod Med Biol. 2020;19(3):254-264. doi:10.1002/rmb2.12332
Huffman DM, Johnson MS, Watts A, Elgavish A, Eltoum IA, Nagy TR. Cancer progression in the transgenic adenocarcinoma of mouse prostate mouse is related to energy balance, body mass, and body composition, but not food intake. Cancer Res. 2007;67(1):417-424. doi:10.1158/0008-5472.CAN-06-1244
Hall KD, Bemis T, Brychta R, et al. Calorie for calorie, dietary fat restriction results in more body fat loss than carbohydrate restriction in people with obesity. Cell Metab. 2015;22(3):427-436. doi:10.1016/j.cmet.2015.07.021
Li SY, Liu Y, Sigmon VK, McCort A, Ren J. High-fat diet enhances visceral advanced glycation end products, nuclear O-Glc-Nac modification, p38 mitogen-activated protein kinase activation and apoptosis. Diabetes Obes Metab. 2005;7(4):448-454. doi:10.1111/j.1463-1326.2004.00387.x
Bastías-Pérez M, Serra D, Herrero L. Dietary Options for Rodents in the Study of Obesity. Nutrients. 2020;12(11):3234. doi:10.3390/nu12113234
A A, S T, A R, Ar S. The role of low-fat diets and fat substitutes in body weight management: what have we learned from clinical studies? Journal of the American Dietetic Association. 1997;97(7 Suppl). doi:10.1016/s0002-8223(97)00737-2
Astrup A, Grunwald GK, Melanson EL, Saris WH, Hill JO. The role of low-fat diets in body weight control: a meta-analysis of ad libitum dietary intervention studies. Int J Obes Relat Metab Disord. 2000;24(12):1545-1552. doi:10.1038/sj.ijo.0801453
Adhikary S, Kothari P, Choudhary D, Tripathi AK, Trivedi R. Glucocorticoid aggravates bone micro-architecture deterioration and skeletal muscle atrophy in mice fed on high-fat diet. Steroids. 2019;149:108416. doi:10.1016/j.steroids.2019.05.008
Trentzsch M, Nyamugenda E, Miles TK, et al. Delivery of phosphatidylethanolamine blunts stress in hepatoma cells exposed to elevated palmitate by targeting the endoplasmic reticulum. Cell Death Discov. 2020;6:8. doi:10.1038/s41420-020-0241-z
Dahdah N, Gonzalez-Franquesa A, Samino S, et al. Effects of Lifestyle Intervention in Tissue-Specific Lipidomic Profile of Formerly Obese Mice. Int J Mol Sci. 2021;22(7):3694. doi:10.3390/ijms22073694
Sharpe RM, McKinnell C, Kivlin C, Fisher JS. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction. 2003;125(6):769-784. doi:10.1530/rep.0.1250769
Santi D, Crépieux P, Reiter E, et al. Follicle-stimulating Hormone (FSH) Action on Spermatogenesis: A Focus on Physiological and Therapeutic Roles. J Clin Med. 2020;9(4):E1014. doi:10.3390/jcm9041014
Sharpe RM. Sperm counts and fertility in men: a rocky road ahead. Science & Society Series on Sex and Science. EMBO Rep. 2012;13(5):398-403. doi:10.1038/embor.2012.50
Cheng CY, Mruk DD. Cell junction dynamics in the testis: Sertoli-germ cell interactions and male contraceptive development. Physiol Rev. 2002;82(4):825-874. doi:10.1152/physrev.00009.2002
Research resource: the dynamic transcriptional profile of sertoli cells during the progression of spermatogenesis - PubMed. Accessed November 6, 2022. https://pubmed.ncbi.nlm.nih.gov/25710594/
Dierich A, Sairam MR, Monaco L, et al. Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci U S A. 1998;95(23):13612-13617. doi:10.1073/pnas.95.23.13612
Mok KW, Mruk DD, Cheng CY. Regulation of Blood–Testis Barrier (BTB) Dynamics during Spermatogenesis via the “Yin” and “Yang” Effects of Mammalian Target of Rapamycin Complex 1 (mTORC1) and mTORC2. Int Rev Cell Mol Biol. 2013;301:291-358. doi:10.1016/B978-0-12-407704-1.00006-3
Chi X, Luo W, Song J, et al. Kindlin-2 in Sertoli cells is essential for testis development and male fertility in mice. Cell Death Dis. 2021;12(6):604. doi:10.1038/s41419-021-03885-4
Umeda K, Ikenouchi J, Katahira-Tayama S, et al. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell. 2006;126(4):741-754. doi:10.1016/j.cell.2006.06.043
Li MWM, Mruk DD, Lee WM, Cheng CY. Connexin 43 and plakophilin-2 as a protein complex that regulates blood–testis barrier dynamics. Proc Natl Acad Sci U S A. 2009;106(25):10213-10218. doi:10.1073/pnas.0901700106
Iommiello VM, Albani E, Di Rosa A, et al. Ejaculate Oxidative Stress Is Related with Sperm DNA Fragmentation and Round Cells. Int J Endocrinol. 2015;2015:321901. doi:10.1155/2015/321901
Homa ST, Vessey W, Perez-Miranda A, Riyait T, Agarwal A. Reactive Oxygen Species (ROS) in human semen: determination of a reference range. J Assist Reprod Genet. 2015;32(5):757-764. doi:10.1007/s10815-015-0454-x
Yi WEI, Xiang-Liang T, Yu Z, et al. DEHP exposure destroys blood-testis barrier (BTB) integrity of immature testes through excessive ROS-mediated autophagy. Genes Dis. 2018;5(3):263-274. doi:10.1016/j.gendis.2018.06.004
Liu B, Wu SD, Shen LJ, et al. Spermatogenesis dysfunction induced by PM2.5 from automobile exhaust via the ROS-mediated MAPK signaling pathway. Ecotoxicol Environ Saf. 2019;167:161-168. doi:10.1016/j.ecoenv.2018.09.118
Sanz A, Caro P, Barja G. Protein restriction without strong caloric restriction decreases mitochondrial oxygen radical production and oxidative DNA damage in rat liver. J Bioenerg Biomembr. 2004;36(6):545-552. doi:10.1007/s10863-004-9001-7
Sanchez-Roman I, Barja G. Regulation of longevity and oxidative stress by nutritional interventions: role of methionine restriction. Exp Gerontol. 2013;48(10):1030-1042. doi:10.1016/j.exger.2013.02.021
Sanchez-Roman I, Gómez A, Pérez I, et al. Effects of aging and methionine restriction applied at old age on ROS generation and oxidative damage in rat liver mitochondria. Biogerontology. 2012;13(4):399-411. doi:10.1007/s10522-012-9384-5
López-Torres M, Barja G. [Calorie restriction, oxidative stress and longevity]. Rev Esp Geriatr Gerontol. 2008;43(4):252-260. doi:10.1016/s0211-139x(08)71190-9
Lian J, Zhao L, Wu J, et al. Foliar spray of TiO2 nanoparticles prevails over root application in reducing Cd accumulation and mitigating Cd-induced phytotoxicity in maize (Zea mays L.). Chemosphere. 2020;239:124794. doi:10.1016/j.chemosphere.2019.124794
Qiu JR, Xiang XY, Wang JT, et al. MfPIF1 of Resurrection Plant Myrothamnus flabellifolia Plays a Positive Regulatory Role in Responding to Drought and Salinity Stresses in Arabidopsis. Int J Mol Sci. 2020;21(8):3011. doi:10.3390/ijms21083011
Yan HHN, Mruk DD, Lee WM, Cheng CY. Ectoplasmic specialization: a friend or a foe of spermatogenesis? Bioessays. 2007;29(1):36-48. doi:10.1002/bies.20513
Salian S, Doshi T, Vanage G. Neonatal exposure of male rats to Bisphenol A impairs fertility and expression of sertoli cell junctional proteins in the testis. Toxicology. 2009;265(1-2):56-67. doi:10.1016/j.tox.2009.09.012
Carette D, Perrard MH, Prisant N, et al. Hexavalent chromium at low concentration alters Sertoli cell barrier and connexin 43 gap junction but not claudin-11 and N-cadherin in the rat seminiferous tubule culture model. Toxicol Appl Pharmacol. 2013;268(1):27-36. doi:10.1016/j.taap.2013.01.016
Morgan DH, Ghribi O, Hui L, Geiger JD, Chen X. Cholesterol-enriched diet disrupts the blood-testis barrier in rabbits. Am J Physiol Endocrinol Metab. 2014;307(12):E1125-1130. doi:10.1152/ajpendo.00416.2014

No competing interests reported.

Download PDF

Journal Publication

published 29 Aug, 2023

Read the published version in Scientific Reports →

Editorial decision: Major revision
10 Jul, 2023
Reviews received at journal
04 Jul, 2023
Reviewers agreed at journal
04 Jul, 2023
Reviewers agreed at journal
07 Jun, 2023
Reviewers agreed at journal
31 May, 2023
Reviewers invited by journal
27 May, 2023
Editor assigned by journal
27 May, 2023
Editor invited by journal
09 May, 2023
Submission checks completed at journal
09 May, 2023
First submitted to journal
14 Apr, 2023

You are reading this latest preprint version

The Improvement of Fertility by Switching to Normal Diet and Restoring BTB Integrity in HFD-Induced Obese Male Mice

Status:

Journal Publication

Version 1

Abstract

Figures

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1 Animals and Diets

2.2 Reproductive Ability Assay

2.3 Lipid Parameter and sex hormone analysis

2.4 Oil Red O Staining

2.5 Haematoxylin and Eosin (H&E) Staining

2.6 Malondialdehyde (MDA), Superoxide Dismutase (SOD), and ROS Measurements.

2.7 Testicular Transmission Electron Microscopy (TEM) Analysis.

2.8 BTB Integrity Assay.

2.9 Real-time quantitative PCR (qPCR) analyses.

2.10 Immunoblot analysis.

2.11 Immunofluorescence

2.12 Statistical analysis

3. RESULTS

3.3 Diet Control by Switching from HFD to ND Repairs BTB Integrity

4. DISCUSSION

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1