Potential functions of circular RNAs in the osteogenic differentiation of human adipose- derived stem cells

doi:10.21203/rs.3.rs-2818046/v1

Download PDF

Research Article

Potential functions of circular RNAs in the osteogenic differentiation of human adipose- derived stem cells

https://doi.org/10.21203/rs.3.rs-2818046/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The differential expression of circular RNAs (circRNAs) with potential functions during the osteogenic differentiation of human adipose-derived stem cells (hADSCs) was investigated.

Methods

Three groups of hADSCs and cells after 14 d of osteogenic differentiation were studied. Differentially expressed circRNAs before and after the osteogenic differentiation of hADSCs were screened using circRNA high-throughput sequencing technology. The potential functions and targets of the differentially expressed circRNAs were analysed using bioinformatics (Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and prediction of circRNA–miRNA–mRNA relationships).

Results

A total of 8732 differentially expressed circRNAs with 2-fold changes in expression between before and after the osteogenic differentiation of hADSCs, including 2905 upregulated circRNAs and 5827 downregulated circRNAs, were identified. GO and KEGG analyses showed that some target genes of the differentially expressed circRNAs were associated with biological functions and biological pathways involved in osteogenic differentiation. Construction of the circRNA–miRNA–mRNA regulatory network showed that many miRNAs and mRNAs could be regulated by the same circRNA through different signalling pathways.

Conclusions

The circRNA expression profile changed significantly during the osteogenic differentiation of hADSCs. Some differentially expressed circRNAs might competitively bind to miRNAs to inhibit their binding to mRNAs and thus regulate the osteogenic differentiation of hADSCs.

human adipose stem cell

osteogenic differentiation

circular RNA

high-throughput sequencing

The oral and maxillofacial bone tissue structure is an important foundation for the facial shape. Trauma, tumours, and congenital malformations that occur in the maxillofacial region often cause bone tissue defects in the maxillofacial region and further result in facial deformity and dysfunction. How to better restore the facial shape and bone tissue defects of patients is an important but difficult problem to be solved in oral and maxillofacial surgery [1]. There are many methods for repairing jaw defects, including autologous bone transplantation, allogeneic bone transplantation, and xenogeneic bone transplantation [2], but they all have their limitations.

With the advancement of bone tissue engineering, repairing bone defects by combining biomaterials with the osteogenic differentiation potential of stem cells has become a hot research topic [3]. Adipose-derived stem cells (ADSCs) have stable osteogenic differentiation abilities, stable proliferation rates and lower death rates in in vitro culture, large reserves, and varied sources, and they are easy to isolate and culture. Therefore, they are considered by many scholars as ideal seed cells for bone tissue engineering. In-depth research into the molecular mechanisms underlying the osteogenic differentiation of seed cells is considered an important strategy for promoting repair of bone defects using bone tissue engineering.

Growing evidence confirms that noncoding RNAs such as long noncoding RNAs (lncRNAs) and microRNAs (miRNAs) are involved in the regulation of the osteogenic differentiation of stem cells [4, 5]. Circular RNAs (circRNAs) are a group of important noncoding RNAs discovered after lncRNAs and miRNAs, further broadening our understanding of RNAs beyond the traditional ones. circRNAs are a group of noncoding RNAs with a closed circular structure that are extensively expressed in many organisms [6]. At first, it was thought that circRNAs were by-products of mRNA splicing and did not have biological functions. However, with the rapid development of biological detection technology, many circRNAs have been successively discovered, and their functions are continuously elucidated. circRNAs play an important role in the regulation of gene expression at the transcriptional and posttranscriptional levels and are involved in embryonic development, cell life activities, and the development and progression of many human diseases. circRNAs might participate in regulation of the osteogenic differentiation of bone marrow mesenchymal stem cells and periodontal ligament stem cells to influence bone metabolism [7, 8]. However, there are few literature reports on circRNAs associated with the osteogenic differentiation of human adipose-derived stem cells (hADSCs). The molecular mechanism of action of circRNAs during the osteogenic differentiation of hADSCs is still not clear.

Therefore, this study screened circRNAs associated with the osteogenic differentiation of hADSCs using high-throughput sequencing technology and analysed the target genes of circRNAs using bioinformatics methods to confirm the important functions and action mechanisms of circRNAs in the osteogenic differentiation of hADSCs. Our findings could provide a new theoretical basis for the better construction of tissue-engineered bone grafts.

2.1 hADSC recovery and subculture

Three lines of ADSCs from normal human bodies (purchased from Shanghai iCell Bioscience Inc.) were cultured in a 37°C/5% CO₂ incubator. When cells reached approximately 85% confluence, they could be passaged. The cap of the culture flask was opened in a biosafety cabinet to collect the culture medium in the flask. After adding 3 ml sterile 1× phosphate-buffered saline (PBS) into the culture flask, the culture flask was placed horizontally to allow the PBS to rinse all areas on the bottom of the culture flask. The PBS was discarded, and 1 ml digestion solution was added to the flask. After the bottom was rinsed, the flask was placed in a 37°C/5% CO₂ incubator for 1–2 min. The flask was placed under an inverted microscope to observe whether cells had become round and detached. If all cells were digested, 2 ml complete medium containing 10% foetal bovine serum was directly added into the culture flask, and the suspension was aspirated into a 15-ml centrifuge tube and centrifuged at 1000 rpm for 5 min. Two new T-25 culture flasks were prepared, and 4 ml complete culture medium was added. After centrifugation, the supernatant was discarded, and the centrifuged cells were resuspended in 2 ml complete medium. Resuspended cells were transferred into two T-25 culture flasks with 1 ml in each culture flask. The culture flasks were placed horizontally, vortexed thoroughly, and placed still in a 37°C/5% CO₂ incubator for culture. When cells had reached the passage 3 (P3) generation, experiments were performed.

2.2 Osteogenic differentiation of hADSCs

Cells at P3 were cultured in a 37°C/5% CO₂ incubator. When cells reached 80–90% confluence, the culture medium was discarded and the cells were washed with 1× PBS two times, then digested by 0.25% trypsin/0.02% EDTA. Digested P3 cells at the density of 1×10⁵ cells/cm² were inoculated onto six-well plates coated with Matrigel. The control group (Control1, Control2, and Control3) and the experimental group (Osteogenic1, Osteogenic2, and Osteogenic3) were set up. Two millilitres of iCell mesenchymal stem cell complete culture medium was added into each well, followed by culture at 37°C in 5% CO₂. When cells reached 60–70% confluence, the mesenchymal stem cell complete culture medium in the wells of the experimental group was carefully aspirated, and 2 mL iCell mesenchymal osteogenic differentiation induction complete culture medium was added to those wells. The control group was refreshed with the original medium, which was replaced every 3 d. After 1 week, half of the culture medium was replaced every 2.5 days (prewarmed to 37°C beforehand). After the control group and the experimental group were cultured for 14 d, cells were subject to alkaline phosphatase (ALP) staining, Alizarin red staining, and qPCR detection of osteogenic-specific transcription factors (ALP, osterix, Runt-related transcription factor 2 (Runx2), osteopontin (OPN), and osteocalcin (OCN)).

2.3 ALP staining

After 14 d of osteogenic differentiation, the osteogenic differentiation medium or control medium in the six-well plates was aspirated, and cells were washed with 1× PBS 1–2 times. Cells in each well were fixed with 1 mL 4% neutral formaldehyde solution for 15 min. The neutral formaldehyde solution was aspirated, and cells were washed with 1× PBS twice for 5 min. The NBT/BCIP stain working solution (using 10 ml ALP developing buffer solution and 0.2 ml NBT/BCIP stock solution to make 10.2 ml NBT/BCIP stain working solution). Each well was filled with 1 mL NBT/BCIP stain working solution and incubated at room temperature in the dark for 20 min. The NBT/BCIP stain working solution was then discarded, and the developing reaction was terminated by washing cells with distilled water twice.

2.4 Alizarin red stain

After 14 d of osteogenic differentiation, the osteogenic induction medium or control medium was aspirated, and cells were washed with 1× PBS 1–2 times. Cells in each well were fixed with 1 mL 4% neutral formaldehyde solution for 30 min. The neutral formaldehyde solution was aspirated, and cells were washed with 1× PBS twice. Each well was filled with 1 mL Alizarin red staining solution and stained for 3–5 min. The Alizarin red staining solution was aspirated, and cells were washed with 1× PBS 1–2 times. Culture plates were placed under a microscope to observe the staining results in the control group and the experimental group.

2.5 Detection of expression of osteogenic-specific transcription factors (ALP, osterix, Runx2, OPN, and OCN) by qPCR

Cells in both groups were cultured for 14 d and collected for extraction of total RNA. After the cells passed quality control, the reaction system was prepared according to the qPCR detection reagent kit. The experiment was done three times using GADPH as the internal control gene. After each qPCR run was completed, the Ct values of the target genes and the internal control gene were calculated from the real-time fluorescence curves. Differences in expression of osteogenic specific transcription factors (ALP, osterix, Runx2, OPN, and OCN) before and after the osteogenic differentiation of hADSCs were analysed using the 2^−△△CT method. Primer sequences are given in Table 1.

Table 1

Primer sequences for qPCR.
Primer	Primer sequence (5′–3′)
ALP-F	AACATCAGGGACATTGACGTG
ALP-R	GTATCTCGGTTTGAAGCTCTTCC
osterix-F	CCTCTGCGGGACTCAACAAC
osterix-R	AGCCCATTAGTGCTTGTAAAGG
Runx2-F	TCAACGATCTGAGATTTGTGGG
Runx2-R	GGGGAGGATTTGTGAAGACGG
OPN-F	GAAGTTTCGCAGACCTGACAT
OPN-R	GTATGCACCATTCAACTCCTCG
OCN-F	GGCGCTACCTGTATCAATGG
OCN-R	GTGGTCAGCCAACTCGTCA
GAPDH-F	GCACCGTCAAGGCTGAGAAC
GAPDH-R	TGGTGAAGACGCCAGTGGA

2.6 Analysis of the differential expression of circRNAs

After RNA samples in the experimental group and the control group passed quality control, circRNA sequencing of six samples was performed using the Paired-End method in the NovaSeq 6000 sequencing platform of Illumina. Raw reads obtained from the sequencing platform were passed through data quality control and filtered to obtain high-quality clean reads. Clean reads were compared against the reference genome, and circRNAs were screened and obtained based on the comparison results between the clean reads and the reference genome. Differentially expressed circRNAs were screened using NOISeq differential analysis software. The criteria for differential circRNA expression were an expression difference ≥ 2-fold, i.e., |log₂(fold change)| ≥ 1, and a probability (threshold of differential probability) ≥ 0.95.

2.7 Bioinformatic analysis

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed on the target genes (mRNAs) of the differentially expressed circRNAs. miRNAs that bind to these circRNAs and mRNAs were predicted using the miRanda software to obtain the regulatory relationship between circRNAs, miRNAs, and mRNAs.

2.8 Statistical methods

Statistical graphs were plotted using GraphPad Prism 8. Statistical analyses were performed with SPSS22.0 software. Measurement data are expressed as x ± s. Expression levels were compared between groups using the paired-sample t test. P < 0.05 indicated that the difference between groups had statistical significance.

3.1 Identification of the osteogenic differentiation of hADSCs

When primary hADSCs were cultured to the P3 generation, cells grew and distributed evenly and showed a long spindle shape. After osteogenic induction culture, cell volume increased, and the cell shape became irregular and polygonal.

After 14 d of osteogenic induction culture, ALP staining was performed. Compared to the control group, cells in the experimental group had a large amount of enzyme granule formation, so the staining result was positive (Fig. 1a). Alizarin red staining revealed a large amount of calcium salt deposition in the extracellular matrix in the experimental group, so this staining result was positive (Fig. 1b). After RNA samples were extracted from the experimental group and the control group, the expression of osteogenic-specific transcription factors (ALP, osterix, Runx2, OPN, and OCN) was detected by qPCR. The expression of ALP, osterix, Runx2, OPN, and OCN significantly increased after osteogenic induction differentiation compared to the control levels (P < 0.05, Fig. 1c).

3.2 circRNA high-throughput sequencing detection results

3.2.1 Differential expression of circRNAs before and after the osteogenic differentiation of hADSCs

circRNAs with differential expression before and after the osteogenic differentiation of hADSCs were screened through the circRNA high-throughput sequencing method. Compared to the control group, the experimental group had 8732 differentially expressed circRNAs (|log₂(fold change)| ≥ 1, probability ≥ 0.95). There were 2905 upregulated circRNAs and 5827 downregulated circRNAs. The distribution of differentially expressed circRNAs is displayed in a volcano plot (Fig. 2).

3.2.2 GO and KEGG enrichment analyses of target genes of differentially expressed circRNAs

GO enrichment analysis was performed on the target genes of the differentially expressed circRNAs to find the distribution of the target genes across the GO terms within the biological process (BP), cellular component (CC), and molecular function (MF) categories. The histogram in Fig. 3 shows the 30 GO terms with the most significant enrichment.

From each of the three GO categories BP, CC, and MF, the 10 most enriched GO terms were identified. The number of target genes of the differentially expressed circRNAs with upregulation and downregulation corresponding to each GO term was calculated (Fig. 4). The results reflected whether the function corresponding to the GO term was dominated by upregulated circRNA target genes or downregulated circRNA target genes.

KEGG pathway enrichment analysis was performed on the target genes of the differentially expressed circRNAs to obtain the expression profile of target genes of differentially expressed circRNAs in biological pathways (Fig. 5).

3.2.3 Prediction of the circRNA–miRNA–mRNA relationships

mRNAs and circRNAs were linked together through miRNAs in miRanda software to predict the regulation of the expression of the corresponding mRNAs by the circRNAs playing the role of competitive endogenous RNAs (ceRNAs). A total of 190,657 ceRNA regulatory analysis pairs were obtained. The top 50 ceRNAs were selected for analysis, and the results were visualized in Cytoscape software (Fig. 6).

circRNAs are a group of special endogenous noncoding RNAs. Unlike linear RNAs, their 3′ and 5′ ends link together to form a covalently closed circular structure. They are not easily degraded by exonucleases, so they are stable in the body [9]. With the development of high-throughput sequencing technology, many circRNAs have been effectively recognized in many cell lines and in different species [10, 11]. They not only play a key role in the development and progression of nervous system diseases and cancers but also play an important regulatory role in biological activities of mesenchymal stem cell development, stemness maintenance, and multidirectional differentiation regulation [12–15].

ADSCs, a type of mesenchymal stem cell, have the abilities of multidirectional differentiation and self-renewal. Compared to bone marrow mesenchymal stem cells, ADSCs have many sources, are abundant, and are easy to obtain from patients with less pain. Under appropriate stimulation, ADSCs can differentiate into adipocytes, osteoblasts, chondrogenic cells, or muscle cells. ADSCs are an ideal stem cell source in tissue engineering [16] and are considered seed cells that can promote bone formation and regeneration [17].

Therefore, studying circRNAs that play important roles in the process of osteogenic differentiation of hADSCs can be highly valuable. In our study, 8732 circRNAs with differential expression from before to after the osteogenic differentiation of hADSCs (2905 upregulated circRNAs and 5827 downregulated circRNAs) were screened with high-throughput circRNA-sequencing technology. These differentially expressed circRNAs might be closely associated with the osteogenic differentiation of hADSCs.

Next, to further understand potential regulatory functions of these differentially expressed circRNAs, their target genes were assessed using GO and KEGG analyses. GO analysis showed that the target genes of the differentially expressed circRNAs were associated with many important biological functions, including protein binding, transferase activity, protein transport, and phosphorylation. KEGG analysis showed that the target genes of these differentially expressed circRNAs were closely associated with biological processes including human disease, metabolism, genetic information processing, and environmental information processing. Under environmental information processing, signal transduction was the biological process with the most differentially expressed target genes. The major signalling pathways included the class O of forkhead box transcription factors (FOXO) signalling pathway, epidermal growth factor receptor (ErbB) signalling pathway, Hedgehog signalling pathway, sphingolipid signalling pathway, Hippo signalling pathway, mitogen-activated protein kinase (MAPK) signalling pathway, Wnt signalling pathway, and vascular endothelial growth factor (VEGF) signalling pathway.

There are miRNA-responsive elements on circRNAs that can competitively bind to miRNAs to inhibit their binding to mRNAs to regulate parental gene expression [18]. Therefore, we constructed a circRNA–miRNA–mRNA regulatory network. The network diagram showed that many miRNAs and mRNAs could be regulated by the same circRNA through different signalling pathways, indicating the complex interaction between circRNAs, miRNAs, and mRNAs.

In the future, we will screen for the key differentially expressed circRNAs to validate their molecular functions and confirm their important roles in the osteogenic differentiation of hADSCs, as well as verify their roles as regulatory ceRNAs.

circRNAs circular RNAs

hADSCs human adipose-derived stem cells

GO Gene Ontology

KEGG Kyoto Encyclopedia of Genes and Genomes

lncRNAs long noncoding RNAs

miRNAs microRNAs

PBS phosphate-buffered saline

ALP alkaline phosphatase

Runx2 Runt-related transcription factor 2

OPN osteopontin

OCN osteocalcin

BP biological process

CC cellular component

MF molecular function

ceRNAs competitive endogenous RNAs

FOXO forkhead box transcription factors

ErbB epidermal growth factor receptor

MAPK mitogen-activated protein kinase

VEGF vascular endothelial growth factor

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Competing interests

The authors declare that there is no conflict of interest regarding the publication of this paper.

Funding

The present study was supported by the Medical Science and Technology Research Foundation of Guangdong Province (grant no. A2019495) and the Research Foundation of the Stomatological Hospital of Southern Medical University (grant no. PY2017014).

Authors' contributions

XS and JH contributed equally to this article. XS and JH carried out experiment and analyzed data. XS, JH, JW and JL wrote the manuscript. XL and WA offered useful recommendations.

SL and HZ designed the study and revised the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors thank AJE for its linguistic assistance during the preparation of this manuscript.

Kinoshita Y, Maeda H. Recent developments of functional scaffolds for craniomaxillofacial bone tissue engineering applications. ScientificWorldJournal. 2013;2013:863157.
Gremare A, Guduric V, Bareille R, Heroguez V, Latour S, L'Heureux N, et al. Characterization of printed PLA scaffolds for bone tissue engineering. J Biomed Mater Res A. 2018;106:887-94.
Feng P, Niu M, Gao C, Peng S, Shuai C. A novel two-step sintering for nano-hydroxyapatite scaffolds for bone tissue engineering. Sci Rep. 2014;4:5599.
Sun X, Jia B, Qiu XL, Chu HX, Zhang ZQ, Wang ZP, et al. Potential functions of long non‑coding RNAs in the osteogenic differentiation of human bone marrow mesenchymal stem cells. Mol Med Rep. 2019;19:103-14.
Lindsay MA. microRNAs and the immune response. Trends Immunol. 2008;29:343-51.
Guo JU, Agarwal V, Guo H, Bartel DP. Expanded identification and characterization of mammalian circular RNAs. Genome Biol. 2014;15:409.
Zhang M, Jia L, Zheng Y. circRNA expression profiles in human bone marrow stem cells undergoing osteoblast differentiation. Stem Cell Rev Rep. 2019;15:126-38.
Zheng Y, Li X, Huang Y, Jia L, Li W. The circular RNA landscape of periodontal ligament stem cells during osteogenesis. J Periodontol. 2017;88:906-14.
Qu S, Yang X, Li X, Wang J, Gao Y, Shang R, et al. Circular RNA: a new star of noncoding RNAs. Cancer Lett. 2015;365:141-8.
Glazar P, Papavasileiou P, Rajewsky N. circBase: a database for circular RNAs. RNA. 2014;20:1666-70.
Rybak-Wolf A, Stottmeister C, Glazar P, Jens M, Pino N, Giusti S, et al. Circular RNAs in the mammalian brain are highly abundant, conserved, and dynamically expressed. Mol Cell. 2015;58:870-85.
Yu CY, Li TC, Wu YY, Yeh CH, Chiang W, Chuang CY, et al. The circular RNA circBIRC6 participates in the molecular circuitry controlling human pluripotency. Nat Commun. 2017;8:1149.
You X, Vlatkovic I, Babic A, Will T, Epstein I, Tushev G, et al. Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nat Neurosci. 2015;18:603-10.
Han D, Li J, Wang H, Su X, Hou J, Gu Y, et al. Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression. Hepatology. 2017;66:1151-64.
Kristensen LS, Okholm TLH, Veno MT, Kjems J. Circular RNAs are abundantly expressed and upregulated during human epidermal stem cell differentiation. RNA Biol. 2018;15:280-91.
Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell. 2002;13:4279-95.
Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001;7:211-28.
Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, et al. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384-8.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Potential functions of circular RNAs in the osteogenic differentiation of human adipose- derived stem cells

Status:

Version 1

Abstract

Figures

1 Background

2 Methods

2.1 hADSC recovery and subculture

2.2 Osteogenic differentiation of hADSCs

2.3 ALP staining

2.4 Alizarin red stain

2.5 Detection of expression of osteogenic-specific transcription factors (ALP, osterix, Runx2, OPN, and OCN) by qPCR

2.6 Analysis of the differential expression of circRNAs

2.7 Bioinformatic analysis

2.8 Statistical methods

3 Results

3.1 Identification of the osteogenic differentiation of hADSCs

3.2 circRNA high-throughput sequencing detection results

3.2.1 Differential expression of circRNAs before and after the osteogenic differentiation of hADSCs

3.2.2 GO and KEGG enrichment analyses of target genes of differentially expressed circRNAs

3.2.3 Prediction of the circRNA–miRNA–mRNA relationships

4 Discussion

List of abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1