Strains and plasmids
The E. coli strains and plasmids used in this study are listed in Table 1. The PHB-producing C. necator strain A-04 [49] was used to isolate the phaCABA−04 gene operon. All bacterial strains were grown at 37 °C in Luria-Bertani (LB) medium supplemented with 100 µg/L ampicillin. The LB medium contained (per liter) 10 g of tryptone (Himedia, Mumbai, India), 5 g of yeast extract (Himedia, Mumbai, India) and 10 g of NaCl (Merck KGaA, Darmstadt, Germany). Stock cultures were maintained at -80 °C in a 15% glycerol solution. The experiments were performed in a biosafety level 1 laboratory and by researchers and investigators who had undergone biosafety training.
Table 1
Bacterial strains and plasmids used in this study
Strains/plasmids | Relevant description | Reference/source |
Strain Cupriavidus necator strain A-04 | Wild Type | [30] |
Escherichia coli JM109 | F´traD36 proA + B + lacIq(lacZ)ΔM15/Δ(lac-proAB) glnV44 e14- gyrA96 recA1 relA1 endA1 thi hsdR17 | Promega Corporation, Madison, WI |
Plasmid | | |
pUC19 | Ampr | Thermo Scientific, MA, USA |
pColdI | Ampr, lacI, cold-shock cspA promoter | Takara Bio Inc., Shiga, Japan |
pColdIF | Ampr, lacI, cold-shock cspA promoter and trigger factor | Takara Bio Inc., Shiga, Japan |
pGEX-6P-1 | Ampr, lacI, tac promoter and glutathione S-transferase (GST) | Novagen, WI, USA |
pBAD/Thio-TOPO | Ampr, araBAD promoter and thioredoxin | Invitrogen, CA, USA |
pUC19-nativeP- phaCABA−04 | pUC19 derivative, carrying phaCAB with native promoter from C. necator strain A-04 | This study |
pColdI-phaCABA−04 | pColdI derivative, carrying N-terminal 6His-fused phaCAB from C. necator strain A-04 | This study |
pColdTF-phaCABA−04 | pColdTF derivative, carrying N-terminal 6His-fused phaCAB from C. necator strain A-04 | This study |
pGEX-6P-1- phaCABA−04 | pGEX-6P-1 derivative, carrying N-terminal GST and 6His-fused phaCAB from C. necator strain A-04 | This study |
pBAD/Thio-TOPO- phaCABA−04 | pBAD/Thio-TOPO® derivative, carrying C-terminal 6HIS- and N-terminal thioredoxin fused phaCAB from C. necator strain A-04 | manuscript in preparation |
Primer | | |
pCold-F | 5′-ATGGATCCCTCGAGATGGCGACCGGCAAAG-3′ | This study |
pCold-R | 5′-GTGAATTCAAGCTTTCAGCCCATATGCAGGCC-3′ | This study |
pGEX-F | 5′-GGCCCCTGGGATCCCCGGAAATGGCGACCGGCAA-3′ | This study |
pGEX-R | 5′- GCACTCGACTCGAGTCAGCCCATATGCAGG − 3′ | This study |
nativeP-phaCABA−04-F | 5′- TGGTCCCTGACTGGC-3′ | This study |
nativeP-phaCABA−04-R | 5′- CGTCGACGACCTTGAAT-3′ | This study |
Table 5
Comparison of PHB production by recombinant E. coli reported previously
Strain | Gene source | Plasmid | Promoter | Time (h) | Operation | Carbon | DCM (g/L) | PHB (g/L) | % PHB (w/w) | | Reference |
JM109 | C. necator strain A-04 | pColdI-phaCABA−04 | PcspA | 36 | Batch | 2% (w/v) glucose | 7.2 ± 0.3 | 5.8 ± 0.1 | 78.0 ± 2.1 | 0.32 | This study |
JM109 | C. necator strain A-04 | pColdTF-phaCABA−04 | PcspA | 18 | Batch | 2% (w/v) glucose | 8.6 ± 0.3 | 7.0 ± 0.3 | 82.9 ± 0.3 | 0.29 | This study |
JM109 | C. necator strain A-04 | pColdTF-phaCABA−04 | PcspA | 30 | Batch | 2% (w/v) glucose | 8.8 ± 0.5 | 7.9 ± 0.7 | 90.0 ± 2.3 | 0.38 | This study |
DH5α | C. necator H16 | pQKZ103 | PrpoS | 48 | Flask | 1.5% (w/v) glucose | 4.1 | 3.52 | 85.8 | - | [54] |
JW2294 | C. necator H16 | pWYC09 | PadhE | 24 | Batch w/o air supply | 3% (w/v) glucose | 7.8 ± 1.8 | 5.0 ± 1.5 | 64.3 ± 7.4 | - | [55] |
BW25113 | C. necator H16 | pWYC09 | PadhE | 24 | Batch w/o air supply | 3% (w/v) glucose | 6.7 ± 1.6 | 3.0 ± 1.3 | 45.5 ± 3.9 | - | [55] |
JM109 | C. necator H16 | pBHR68 | nativeP | 48 | Flask | 1% (w/v) glucose | 1.7 ± 0.1 | 0.5 | 29.7 ± 3.4 | - | [55] |
JM109 | C. necator H16 | pWYC09 | PadhE | 48 | Flask | 1% (w/v) glucose | 1.7 ± 0.2 | 0.8 | 48.2 ± 4.5 | - | [55] |
XL1-Blue | C. necator H16 | pBAD24 + vgb gene | PBAD | 48 | Flask | 1% (w/v) glycerol | 4.1 ± 0.1 | 2.0 ± 0.1 | 49.2 ± 0.19 | - | [56] |
JM109 | C. necator strain A-04 | pBAD/Thio-TOPO | PBAD | 30 | Flask | 2% (w/v) glucose | 1.2 ± 0.2 | 0.8 ± 0.2 | 67.2 ± 1.8 | 0.10 | This study |
DH5α | C. necator H16 | pGEM-GSTphaCABRe | nativeP | 72 | Flask | 2% (w/v) glucose | 2.8 ± 0.2 | 0.9 ± 0.2 | 31 ± 1 | - | [29] |
JM109 | C. necator strain A-04 | pGEX-6P-1 | Ptac | 48 | Flask | 2% (w/v) glucose | 1.3 ± 0.1 | 0.9 ± 0.2 | 74.6 ± 2.6 | - | This study |
XL-1 blue | C. necator H16 | pJRDTrcphaCABRe | Ptrc | 48 | Fed-batch | > 2% (w/v) glucose | 178 | 128 | 72 | - | [28] |
Construction of recombinant plasmids
The phaCAB A− 04 operon PHB biosynthetic genes from C. necator A-04 were PCR-amplified using the following pair of primers: forward primer 5′-ATGGATCCCTCGAGATGGCGACCGGCAAAG-3′ (the XhoI site is underlined) and reverse primer 5′-GTGAATTCAAGCTTTCAGCCCATATGCAGGCC-3′ (the HindIII site is underlined). Primers were designed based on accession numbers FJ897463, FJ897461 and FJ897462. The blunted PCR product was purified and subcloned into pBluescript SK− (Stratagene, La Jolla, CA, USA) linearized by SmaI. The recombinant plasmid digested with XhoI and HindIII was cloned into cold-shock-inducible pColdI and pColdTF vectors (Takara Bio Inc., Shiga, Japan) at the XhoI and HindIII restriction sites, yielding pColdI-phaCABA− 04 and pColdTF-phaCABA− 04, respectively. For the plasmid pGEX-6P-1-phaCABA− 04, the phaCABA− 04 operon was amplified by the primers pGEX-F and pGEX-R (Table 1). The 3885-bp DNA fragment was digested by BamHI and XhoI and cloned into BamHI-XhoI-digested pGEX-6P-1 to obtain pGEX-6P-1-phaCABA04. To construct the constitutive expression vector pUC19-nativeP-phaCABA− 04, the primers nativeP-phaCABA− 04-F and nativeP-phaCABA− 04-R were used to amplify the phaCABA− 04 operon, including its native promoter. The blunted PCR product was purified and cloned into SmaI-linearized pUC19 (Thermo Fisher Scientific, Inc., Waltham, MA, USA), yielding pUC19-nativeP-phaCABA− 04. PCRs were performed using Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA). E. coli JM109 was used as a host for cloning and PHB production. The accuracy of the constructed plasmid was verified by the corresponding restriction enzyme and sequencing.
Optimization of culture conditions for PHB production in shake flask cultivation
Expression vectors named pColdI-phaCABA−04 and pColdTF-phaCABA−04 with the entire phaCABA−04 operon were transformed into E. coli JM109 by the heat shock method [50]. Shake flask experiments were performed in 250-mL Erlenmeyer flasks containing 50 mL of medium. E. coli JM109 cells transformed with pColdI-phaCABA−04 or pColdTF-phaCABA−04 were grown in LB medium containing ampicillin (100 µg/mL) on a rotary incubator shaker (Innova 4300, New Brunswick Scientific Co., Inc., Edison, NJ, USA) at 37 °C and 200 rpm for 24 h. The overnight seed culture was inoculated into fresh LB medium (5% v/v inoculum) containing 100 µg/L ampicillin and 20 g/L glucose prior to induction with temperature and IPTG, separately using three different induction methods (Fig. 1).
For the synthesis of PHB using the conventional induction method, the procedure was performed according to the user manual (Takara Bio Inc., Otsu, Shiga, Japan). The culture was incubated at 37 °C and 200 rpm until the optical density at 600 nm (OD600) reached 0.5, 1.3, 2.1 and 2.4. Next, the cultivation temperature was reduced from 37 °C to 15 °C for 30 min. The expression of the phaCAB operon was induced by the addition of 0.5 mM IPTG, and cultivation was continued at 15 °C for an additional 24 h.
For the synthesis of PHB using the short-induction method developed in this study, the culture was incubated at 37 °C and 200 rpm until the OD600 reached 0.5, 1.3, 2.1 and 2.4. Then, the temperatures were varied at 15, 25, 30 and 37 °C for 30 min. Next, the expression of the phaCAB operon was induced by adding various concentrations (0.01, 0.05, 0.1, 0.5 and 1.0 mM) of IPTG, and the cultivation was maintained at 37 °C for 24 h.
For the synthesis of PHB using the preinduction method developed in this study, the culture was incubated at 37 °C and 200 rpm until the OD600 reached 0.5. Then, 0.5 mM IPTG was added to the culture and the temperature was reduced from 37 °C to 15 °C for 24 h. The induced cells were harvested by centrifugation, the medium was discarded, and the cells were resuspended in an equal volume of fresh LB medium. Then, the induced cells at 1, 5 or 10% (v/v) were transferred into fresh LB medium supplemented with 100 µg/L ampicillin and 20 g/L glucose and incubated at 37 °C and 200 rpm for 24 h.
For comparison of the effect of phaC expression on PHB production under various types of promoters, fusion proteins and chaperones, shake flask experiments were performed in 250-mL Erlenmeyer flasks containing 50 mL of LB medium containing ampicillin (100 µg/mL) on a rotary incubator shaker at 37 °C and 200 rpm for 24 h. For PHB production, overnight cultures in LB medium (1 mL) were transferred into fresh LB medium supplemented with glucose (20 g/L) and ampicillin (100 µg/mL). Recombinant E. coli JM109 (pColdI-phaCABA−04) and E. coli JM109 (pColdTF-phaCABA−04) were induced to produce PHB using the conventional induction method and short-induction method. The effect of GST (the hydrophilic fusion protein) and the tac promoter on PHB production was investigated using E. coli JM109 (pGEX-6P-1-phaCABA−04), which was induced by the addition of IPTG (0.5 mM). The effect of the araBAD promoter and N-terminal thioredoxin fusion protein together with the C-terminal 6His-fusion protein on phaC and PHB production was examined by inducing E. coli JM109 (pBAD/Thio-TOPO-phaCABA−04) with arabinose (1% w/v). E. coli JM109 (pUC19-nativeP-phaCABA−04), which exhibits constitutive expression, was used as a control strain. All these comparison experiments were performed at 15 °C or 37 °C for 48 h.
Conditions for PHB production in a 5-L fermenter
A preculture was prepared in 500-mL Erlenmeyer flasks containing 100 mL of LB medium and grown on a rotary shaker at 37 °C at 200 rpm for 24 h. The preculture was inoculated into a 5-L bioreactor (MDL500, B.E. Marubishi Co., Ltd., Tokyo, Japan) containing 2 L of LB medium supplemented with 100 µg/L ampicillin and 20 g/L glucose at an inoculation volume of 5% (v/v). The agitation speed and the air flow rate were 500 rpm and 1 mL/min, respectively. After an OD600 of 0.5 was obtained, the cultivation temperature was reduced from 37 °C to 15 °C for 30 min. Next, IPTG was added to the culture at a final concentration of 0.5 mM. After IPTG addition, the cultivation temperature was shifted from 15 °C to 37 °C and maintained at 37 °C for 48 h. Culture samples were collected at 6 h intervals for 48 h.
Analytical methods
Cell growth was monitored by the DCM, which was determined by filtering 5 mL of the culture broth through preweighed cellulose nitrate membrane filters (pore size = 0.22 µm; Sartorius, Goettingen, Germany). The filters were dried at 80 °C for 2 days and stored in desiccators. The net biomass was defined as the residual cell mass (RCM), which was calculated by subtracting the amount of PHB from the DCM. The PHB in dried cells was methyl-esterified using a mixture of chloroform and 3% (v/v) methanol-sulfuric acid (1:1 v/v) [51]. The resulting monomeric methyl esters were quantified by a gas chromatograph (model CP3800, Varian Inc., Walnut Creek, CA, USA) using a Carbowax-PEG capillary column (0.25-µm df, 0.25-mm ID, 60-m length, Varian Inc.). The internal standard was benzoic acid, and the external standard was PHB (Sigma-Aldrich Corp.). The total reducing sugar concentration was determined using a 3,5-dinitrosalicylic acid (DNS) assay [52].
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis.
Recombinant E. coli cells were cultured with and without induction. Cells were collected by centrifugation at 17,000 × g and 4 °C for 30 min. Cell pellets were resuspended in 100 mM Tris-HCl (pH 8.0) and normalized to an OD600 of 2.0. Total proteins were extracted from cells by using a sonicator (Sonics Vibra Cell VCX 130, Sonics & Materials, Inc., Newtown, CT, USA). The lysis mixture was then centrifuged at 17,000 × g at 4 °C for 30 min. The protein concentration in the supernatant (soluble protein) was estimated by the Bradford method using a Bio-Rad protein assay kit (Bio-Rad Laboratories Inc., Hercules, CA, USA), and bovine serum albumin was used as a standard. Thirty micrograms of total protein from each sample was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 10% polyacrylamide gels under reducing conditions and electrophoresed at 80 V for 10 min followed by 140 V for 60 min. For the western blot analysis, the protein from SDS-PAGE was then transferred to a polyvinylidene difluoride (PVDF) membrane using a semidry blotting system (Trans-Blot SD Cell, Bio-Rad Laboratories Inc, Hercules, CA, USA) at 150 mA for 40 min. The 6His tag was detected by a mouse anti-His antibody (Aviva Systems Biology Corp., San Diego, CA, USA) and an HRP-conjugated goat anti-mouse IgG as the primary and secondary antibodies, respectively. Color development was performed using a Mouse IgG DAB Chromogenic Reagent Kit (Boster Biological Technology, Pleasanton CA, USA) according to the manufacturer's instructions.
Analysis of polymer molecular weight
The molecular weight was determined by gel permeation chromatography (GPC; Shimadzu 10A GPC system, Shimadzu Co., Ltd., Kyoto, Japan) with a 10A refractive index detector and two Shodex columns (GPC K-806M columns; 8.0 mm ID × 300 mm L, Showa Denko K.K., Tokyo, Japan). The polymer was dissolved in 0.1% (w/v) chloroform and filtered through a 0.45-µm Durapore® (PVDF) membrane filter with low protein binding capacity (Millex®-HV, Merck Millipore Ltd., Tullagreen, Carrigtwohill Co., Cork, Ireland). The temperature was 40°C, and the flow rate was 0.8 mL/min. A standard curve was determined for polystyrene with low polydispersity under the same conditions for molecular weights of 1.26 × 103, 3.39 × 103, 1.30 × 104, 5.22 × 104, 2.19 × 105, 7.29 × 105, 2.33 × 106 and 7.45 × 106. The MW and the number-average molecular weight (MN) were determined by GPC, and the polydispersity index (PDI) was calculated as the ratio .
Preparation of PHB films
PHB films were prepared according to the ASTM: D882-91 protocol. The PHB films were prepared from chloroform solutions of the polyesters using conventional solvent-casting techniques and a glass tray (Pyrex, Corning Incorporated, Corning NY, USA) as the casting surface (modified from [53]). The thickness of the thin polyester films was regulated by controlling the concentration of the polymer in chloroform (1% w/v) and the volume of the polymer solution. The thickness of the PHB films was 0.05 mm, which was confirmed using a caliper (Model 500 − 175: CD-12C, Mitutoyo Corporation, Kawasaki-shi, Kanagawa, Japan). Film samples were aged for 1 month in a desiccator at ambient temperature to allow them to reach crystallization equilibrium.
Analysis of the mechanical properties of PHB films
The mechanical tests were conducted at the Scientific and Technological Research Equipment Center, Chulalongkorn University, using a universal testing machine (H10KM, Wuhan Huatian Electric Power Automation Co., Ltd., Wuhan, China) with a crosshead speed of 10 mm/min. The variables measured included the elongation at the break point (%), the stress at maximal load (MPa), and the Young’s modulus (MPa). The data represent the mean values for ten samples tested under the same conditions.
Thermal analysis by differential scanning calorimetry (DSC)
A 10-mg sample of PHB was encapsulated in an aluminum sample vessel and placed in the sample holding chamber of the DSC apparatus (DSC7, PerkinElmer, Inc., Waltham, MA, USA). STARe software (version SW 10.00; Mettler-Toledo International Inc., Columbus, OH, USA) was used to operate the DSC apparatus at the Petroleum and Petrochemical College, Chulalongkorn University. The previous thermal history of the sample was removed before the thermal analysis by heating the sample from ambient temperature to 180°C at 10°C/min. Next, the sample was maintained at 180°C for 5 min before cooling at 10°C/min to − 50°C. The sample was then thermally cycled at 10°C/min to 180°C. The melting peak temperature, denoted by TM, was given by the intersection of the tangent to the furthest point of an endothermic peak and the extrapolated sample baseline. The glass transition temperature, denoted by TG, could be estimated by extrapolating the midpoint of the heat capacity difference between glassy and viscous states after heating of the quenched sample.
Data analysis
All the data presented in this manuscript are representative of the results of three independent experiments and are expressed as the mean values ± standard deviations (SDs). One-way analysis of variance (ANOVA) followed by Duncan’s test for testing differences among means was conducted using SPSS version 22 (IBM Corp., Armonk, NY, USA). Differences were considered significant at P < 0.05.