Autosomal dominant tubulointerstitial kidney disease cosegregating with COL4A4:p.G545A in Turkish Cypriot families with kidney failure

doi:10.21203/rs.3.rs-2844330/v1

Download PDF

Article

Autosomal dominant tubulointerstitial kidney disease cosegregating with COL4A4:p.G545A in Turkish Cypriot families with kidney failure

https://doi.org/10.21203/rs.3.rs-2844330/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Chronic kidney disease (CKD) is a global health priority with over 850 million people affected. The starting point for improving outcome must be to diagnose the primary renal disease and in low and middle income countries ‘unknown aetiology’ accounts for the majority of diagnoses. In Cyprus, familial kidney disease is very common. Using next-generation sequencing, we found that a common polymorphism (COL4A4:p.G545A), hitherto considered to be benign or hypomorphic, was present in 5 of 53 Turkish Cypriot families with kidney disease and a glomerular phenotype (at least one person with haematuria and/or proteinuria). Therefore, we tested 49 further families with kidney disease using a restriction fragment length polymorphism assay. From this total of 102 families, we showed that this variant was present in 12 of 85 families (14%) with some evidence of glomerular disease and none of 17 with chronic kidney disease lacking these features. Co-segregation analyses indicated that the variant co-segregated with disease more than would be expected by chance. These families have an autosomal dominantly inherited susceptibility to kidney disease associated with variable and intermittent microscopic haematuria, proteinuria < 1 g/day until the eGFR falls below 30 ml/min. End-stage kidney disease occurred in 17% of those affected at a median of 66 years. The presentation is more characteristic of a tubulointerstitial kidney disease and represents a tubular phenotype of Alport spectrum nephropathy.

Chronic kidney disease (CKD) is a global health priority affecting over 850 million individuals worldwide. The global prevalence of CKD is 10.6% for stages 3–5 ^1,2,3 but shows wide regional variation. Multiple factors may contribute including, differing definitions of CKD, methods of measuring creatinine, demographics of each region, as well as prevalence of risk factors such as hypertension and obesity^4,5,6. CKD is strongly associated with premature death from cardiovascular disease^7,3; and an increasing financial burden for all health systems, with a poor quality of life for those affected ^8,9.

In Europe it is now clear that CKD becomes increasingly common as one travels south-east from northwest Europe ^10,11. But it is less well known that the aetiology of CKD also varies with geography; aetiology becomes increasingly ‘unknown’ as one moves into low and middle income countries; and family history of renal disease is common and a major risk factor for developing end-stage renal failure (ESRD). A positive family history is reported by 24–34% of patients with CKD^12,13,14.

The Eastern Mediterranean has the highest incidence of kidney failure, as reported to the European Renal Association (ERA-EDTA) by Greece, Israel and Greek Cypriots¹⁰. We have ourselves previously reported a high incidence of renal failure in north Cyprus amongst Turkish Cypriots; the rate was 2–3 times higher than that reported in north-western Europe by UK, Norway, Finland, Denmark ¹⁵. We also reported a high incidence of familial renal disease as a contributing factor ¹⁵.

Long-term investigation amongst Greek Cypriots with familial kidney disease has shown that the majority of patients with renal failure have either a haematuric nephropathy, often with significant proteinuria (termed here ‘glomerular phenotype’) caused by heterozygous mutations of the CFHR5, COL4A3 or COL4A4 genes^16,17,18,19, or a tubulointerstitial phenotype (that is CKD in the absence of haematuria or glomerular proteinuria) typically associated with mutations in the PKD1/2, MUC1 or UMOD genes²⁰ in which haematuria is typically absent and proteinuria is seldom > 1 g/day even when renal impairment is advanced (a pattern termed here ‘tubulointerstitial phenotype’).

Our review of renal diseases leading to ESRD in the Middle East and North Africa has indicated that in all countries the sum of those with ‘unknown aetiology’ and ‘hypertensive nephropathy’ is around 50%²¹. This implies that the cause of renal failure is unknown in at least half of all patients. This contrasts with the standard view that approximately 17% of patients with ESRD do not have a known renal diagnosis, and are labelled as CKD with unknown origin¹⁰.

We investigated over 100 Turkish Cypriot families with evidence of CKD in two generations. The majority of families have an autosomal dominant (AD) inheritance. Our work has been helped by the number of large families with 6–10 siblings in each of four generations.

During our initial investigations of a number of large Turkish Cypriot families with renal failure in north Cyprus, we often found the family tree minimally informative. Many first-generation members had reached end-stage or were dying with renal failure but no other clinical details were available. Usually, however, when proteinuria had been measured it was less than 1 g/day suggestive of a tubulointerstitial pathology.

Investigation of these families using whole exome or targeted gene panel sequencing yielded diagnostic findings in only 13 of the 57 families studied (genes were UMOD (4 cases), COL4A1 (1), COL4A3 (4), COL4A4 (2), COL4A5 (2)), leaving 44 unsolved families. Among these we observed that a common missense variant (COL4A4:p.G545A), which was hitherto considered to be benign or hypomorphic, was present in four of the 44 unsolved (and one of the solved) families. Further investigation with PCR analysis of DNA from the families, revealed that the mutation co-segregates with clinical evidence of glomerular disease in some affected members. This DNA variant has its highest reported frequency in the Middle Eastern population, of 10%. https://gnomad.broadinstitute.org/variant/2-227082177-C-G?dataset=gnomad_r3.

We propose that this missense variant is an autosomal dominantly inherited risk factor for renal disease, which is associated with variable and intermittent microscopic haematuria, late onset CKD with proteinuria less than 1.0 g/d until the eGFR falls below 30 ml/min.

Study population

Cyprus is the third biggest island in the Mediterranean inhabited by a Greek Cypriot majority and Turkish Cypriot minority, along with much smaller groups such as Maronites, Latins and Armenians.

Genetic studies indicate that Greek and Turkish Cypriots have a similar origin with close affinities to South-eastern Anatolia and Near East, and genetic continuity with the earliest inhabitants that first colonised the island around 10,000 years ago^{22,23,24,25,26}.

Since the 1950s there has been a diaspora of Cypriots not only to the UK but to countries such as Australia and Canada, and there may be as many people with recent Cypriot ancestry outside Cyprus as there are on the island. There has also been a large immigration of Turks from the mainland over the past 50 years with some intermarriage with Cypriot population.

Turkish Cypriots form a distinct ethno-linguistic community centered on north Cyprus in so called Turkish administered Northern Cyprus (TRNC). The census of the TRNC population in 2006 showed that of 178,031 de jure citizens, 120,007 were born to parents who were both themselves born in Cyprus, providing an effective measure of the size of the ethnic Turkish-Cypriot population at that time²⁷.

The study was conducted at Nicosia State Hospital in north Cyprus, a multi-specialty tertiary care hospital that provides renal services to the whole of north Cyprus.

All citizens of TRNC are entitled to free renal replacement therapy (RRT), regardless of ethnicity. All patients with signs or symptoms of CKD from within this population present either through the village practitioners, private hospitals or directly to Nicosia State Hospital.

Ethics statement

All samples were collected along with informed consent and in accordance with the ethical principles for medical research involving human subjects as per the Declaration of Helsinki by the World Medical Association. This study has been approved by the TRNC Ministry of Health Ethics Committee [Decision Number YTK.1.01 (Ek 002/19)].

All research involving human participants was performed with written informed consent and was approved by the ethics committee of Dr. Burhan Nalbantoğlu State Hospital, Nicosia. All participants provided informed consent for their involvement in the research in accordance with the Declaration of Helsinki and for the publication of the study results.

Patients

All patients had been referred to the Nephrology Department of the Nicosia State Hospital for investigation of kidney disease.

Family trees were created for kindreds with 2 or more members with evidence of CKD ²⁸ [see Figs. 1 (a)- 1 (e)].

Families were contacted and were either visited in their villages or attended the hospital. After obtaining written informed consent all volunteer family members underwent urinalysis and renal function evaluation, and donated DNA.

The strict requirement for the use of family names (surnames) in north Cyprus was introduced only in 1974, which makes tracking back families before that date more difficult. On the other hand, families of 10 children were common until the 1970s.

Clinical investigations

The majority of investigations were carried out in the State Hospital. Chronic renal failure (eGFR < 60 ml/min) was defined as a creatinine above the upper limit of normal: for men > 1.1 mg/dl, and for women > 0.9 mg/dl. And blood urea nitrogen (BUN) > 20 mg/dl.

Proteinuria was initially measured from a 24 hr urine collection and normal defined as protein < 140 mg/day, albumin < 30 mg/day. More recently proteinuria has also been measured as a protein and albumin/creatinine ratio (Uacr < 30 mg/mg and Upcr < 200 mg/mg).

Haematuria was investigated historically by urine microscopy, and more recently by urine dipstick as well. Haematuria was deemed positive, and equivalent to ‘a trace’ on a dipstick, if there were 3 or more red cells per high power field.

Kidney biopsy was not performed on all families, and biopsy specimens were routinely examined by light microscopy and immunofluorescence. Patients from 2 families were biopsied and in one case electron microscopy was available.

Affected members were assigned to CKD Stages 1–5 (see Table 1).

Table 1

Estimated glomerular filtration rate (eGFR) stages for chronic kidney disease (CKD).
GFR stage	eGFR	Description
1	> 90	Normal or high
2	60–89	Mildly decreased
3a	45–59	Mildly to moderately decreased
3b	30–44	Moderately to severely decreased
4	15–29	Severely decreased
5	< 15	Kidney failure
Legend : CKD staging as shown on the family tree figures: Stage 0 – no evidence of kidney disease; stage 1 – microscopic haematuria only; stage 2 – microscopic haematuria and or proteinuria; stage 3 – eGFR in range 59 − 30 ml/min; stage 4 – eGFR 29 − 15; stage 5 – end-stage renal failure. Based on KDIGO guidelines (KDIGO, 2013)²⁸.

Methods

All genomic DNA extractions were carried out using the PureLink^™ Genomic DNA Mini Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s procedure. Prior to genetic analyses, all DNA samples were quantified using the Qubit 2.0 fluorometer (Invitrogen, Thermo Fisher Scientific) and the Qubit dsDNA HS Assay Kit (Invitrogen, Carlsbad, CA, USA).

The index patient from a total of 53 families underwent NGS that included the parallel analysis of a 5-gene panel, COL4A3, COL4A4, COL4A5, CFHR5, FN1 (Ion Torrent, PGM, Life Sciences), as previously described¹⁹.

24 cases had previously undergone whole exome sequencing (WES) of whom 20 also underwent NGS. WES analysis was performed as previously described with minor allele frequency (MAF) > 0.005 in the 1000 genome project database excluded²⁹.

The sequence data of rs1800516, G545A polymorphism in human COL4A4 gene region was obtained from NCBI database. The novel primers were designed using the Primer-Blast software tool (NCBI). The primer sequences were as follows: forward primer: 5’- GAGACCAAGAATGCCAAGCT − 3’, and reverse primer: 5’- AATAAACACCAGCCAAGCCA − 3’. The PCR reaction was carried out in a volume of 25 µl, which was containing 1x Standard Buffer (Amplicon, Denmark; containing 15mM MgCl₂), 12.5 mM MgCl₂, 16 mM dNTPs, 7.5 pmol from each primer, 0.75 U of Taq DNA polymerase (Amplicon, Denmark), approximately 25 ng of genomic DNA and distilled water. The primers were used to amplify 491 bp fragments of COL4A4 gene by using the following PCR cycling conditions; the initial denaturation at 95^oC for 2 min, followed by 30 cycles of denaturation at 95^oC for 30 sec, annealing for 30 sec at 52^oC and elongation at 72^oC for 3 sec. In the end, a final extension for 5 min at 72^oC was carried out. The amplification products (491 bp) were visualized and photographed with a Bio-Doc-It Imaging System (Cole-Parmer™, Hanwell, London), an ultraviolet transilluminator, on a 1% agarose gel which was stained with ethidium bromide.

Restriction fragment length polymorphism (RFLP) analysis was performed in a 20 µl total reaction volume containing 1x restriction enzyme tango buffer (33mM Tris-acetate (pH 7.9 at 37°C), 10mM Mg-acetate, 66mM K-acetate and 0.1mg/mL BSA), 10 U XceI (NspI) (Thermo Fisher Scientific, USA), 10 µl PCR product and nuclease free water at 37^oC for six hours. The digested products were electrophoresed for 45 min at 100 V on 2.5% agarose gel and visualized under ultraviolet light after staining with ethidium bromide. The G allele was identified as an undigested product of 491 bp, as opposed to 349 and 142 bp products of XceI (Nsp I) digestion yielded by the C allele.

PCR products of heterozygous and mutant genotypes were verified by direct sequencing using the same set of primers (Applied Biosystems 3500xl DNA analyzer, USA) to assess the reliability of the presented assay.

Datasets and mutation predictions

gnomAD (version 2.1.1; www.gnomAD.broadinstitute.org ) is a large dataset that includes COL4A3–5 alleles from unrelated adults, with equal numbers of males and females, who have undergone exomic (in about 90%) or genomic sequencing (version 3.1.2) in disease and population studies. gnomAD indicates variants that are homozygous Ancestries are available, but the clinical phenotypes are not recorded.

Mutation predictions for COL4A4:p.G545A were obtained from gnomAD browser for exome data (GRCh37)

https://gnomad.broadinstitute.org/variant/2-227946893-C-G?dataset=gnomad_r2_1

and for genomic data (GRCh38)

https://gnomad.broadinstitute.org/variant/2-227082177-C-G?dataset=gnomad_r3

Information regarding previous reports of clinical significance were obtained form ClinVar

https://www.ncbi.nlm.nih.gov/clinvar/variation/255015/?new_evidence=false

and from the Leiden Open variation Database (LOVD3)

https://databases.lovd.nl/shared/genes/COL4A4

The mutation was also reviewed in Mutation Taster

https://www.genecascade.org/MutationTaster2021/#example1

Statistical Analysis

Eighty five families with evidence of familial kidney disease most likely with a glomerular phenotype (at least one person with haematuria or proteinuria) were investigated by PCR for the G545A mutation.

As controls, we also tested,

225 patients who had started RRT whose primary renal diagnosis was either unknown, or recorded as having diabetes, or hypertension.
17 individuals from different families with unexplained kidney disease considered to have a tubulointerstitial phenotype (CKD without haematuria or proteinuria).
67 patients with clinical evidence of a haematuric nephropathy or a renal biopsy showing secondary FSGS.
94 adult volunteers, mean age 53 years.

The 85 families were compared with the 403 controls by Chi-squared test (2-tailed test).

Binomial probability of observed co-segregation under the null hypothesis of random transmission of COL4A4:p.G545A at each informative meiosis was calculated using the binomial cumulative distribution function and assumed a single affected founder in each pedigree.

Genetics

Schematic illustration of COL4A4 p.G545A PCR-Restriction Fragment Length Polymorphism (RFLP) assay is given in Fig. 2. A 491 bp PCR product of COL4A4 gene was digested with XceI (NspI) to determine the presence of the G to C transition (Fig. 2).

The individuals with CC genotype (variant type) produced digested product (349 bp and 142 bp) while the individuals with GG genotype (wild-type) seen as 491 bp fragment on the 2.5% agarose gel.) The genotyping results of individuals with CC and heterozygous genotypes were confirmed by sequencing and the data obtained were consistent with the RFLP findings and precisely verified the reliability of the PCR-restriction digest assay.

Families with COL4A4:p.G545A variant

COL4A4:p.G545A was initially found in 5 families investigated by NGS. Subsequently we have examined 85 families with evidence of familial kidney disease most likely with a glomerular phenotype (at least one person with haematuria or proteinuria) and found 12 families (14%) with the G545A variant. We have investigated the 4 largest families and shown that the variant G545A co-segregates with kidney disease. Analysis of observed co-segregation under null hypothesis that penetrance for haematuria is complete and there are no phenocopies indicated strong evidence of cosegregation (Combined p = 3.5 x10^-6; LOD score ) [Table 2].

Table 2

Observed cosegregation
Family (Fig)	Informative meioses	Concordant	Discordant	Probability of N or more concordant under null
1 (a)	16	15	1	0.0002594
1 (b)	15	9	6	0.30361938
1 (c)	15	12	3	0.01757813
1 (d)	18	14	4	0.01544189
1 (e)	4	3	1	0.3125
Legend: Analysis of observed cosegregation under null hypothesis of no association of phenotype with the variant (i.e. assuming 50% chance of transmission of the allele in each informative meiosis). Combined p = 3.5 x10^-6.

A 5th smaller family in which COL4A4:p.G545A was detected is also included as a member had a renal biopsy, which included electron microscopy confirming thin glomerular basement membrane (See Renal biopsy below). The demographic data from these 5 families are summarised in Table 3 and by family trees [See Figs. 1 (a) – (e)].

Table 3

Family Demographics
Family	Number (N) of family on FT	^aAll clinically affected (CKD stages 1–5)	Clinically affected (CKD stages 3–5)	Clinically unaffected (CKD stage 0)	^cNo clinical Info	^dAge at first CRF/RRT	^eAffected and age > 50 year RRT %
	N	^bN (variant present)	N (variant present)	N (variant present)	N
1 (a)	32	19 (12/12)	8 (4/5)	8 (1/5)	5	60/65	1/11 (9%)
1 (b)	24	11 (8/9)	8 (7/7)	8 (6/6)	5	63/0	0/7
1 (c)	33	17 (7/8)	8 (5/5)	6 (2/3)	10	67/67	4/14 (29%)
1 (d)	43	21 (5/8)	10 (4/5)	7 (1/5)	15	61/60	3/15 (20%)
1 (e)	20	5 (2/3)	3 (2/2)	9 (0)	6	57/61	1/4 (25%)
Legend to Table 3.
a) Clinically affected: evidence of renal disease (Stages 1–5).
b) Variant present (x/y): y is number of family members tested and x is number showing the heterozygous mutation.
c) No clinic info: no information available because of death or diaspora.
d) Median age at CRF/ ESKD: chronic renal failure (CRF) defined as raised urea and creatinine and indicative of eGFR < 60 ml/min.
e) Affected and age > 50 year ESKD %: percentage reaching ESKD after the age of 50 years.

Onset CKD Stage 3 and end-stage kidney disease (ESKD)

Table 3 shows age of onset of CKD and RRT in the 5 families. The majority of families so far have been reviewed retrospectively and late presentation of an asymptomatic condition might be expected. The median age of 38 patients with GFR < 60 ml/min, when first detected, was 61 years (range 34–84) and for 10 patients with ESKD, the median age of RRT initiation was 63 years (range 48–80).

In family members with clinical evidence of renal disease, and age over 50 years, 19.6% have progressed to ESKD.

Microscopic haematuria

We found that haematuria can be intermittent or absent. Of 72 patients with clinical evidence of renal disease, 53 had had their urine tested on one or more occasions and a positive sample was identified, at least once, in 40 people (75%).

Proteinuria

We found that proteinuria is dipstick negative until the eGFR is less than 30 ml/min. Figure 3 shows proteinuria versus eGFR and it can be seen that proteinuria was not greater than 1g/d until eGFR was less than 20 ml/min, in this series.

We noted that for proteinuria in patients with GFR > 50 ml/min, approximately 50% was albumin, and this rises to 80–90% when proteinuria exceeds 2.0 g/d.

Renal biopsy

Histology was performed in 2 families and showed tubulointerstitial disease with interstitial fibrosis and tubular atrophy and extensive global glomerular sclerosis with some glomeruli showing segmental sclerosis (FSGS). From one of the biopsies, electron microscopy was performed and showed patchy thinning of the GBM measured at 159 nm.

In one family (see Fig. 1. C), a 52 year old female developed a nephrotic syndrome and a renal biopsy showed membranous nephropathy. She is now in remission following a course of immunosuppression.

Other clinical features

In Cyprus, diabetes mellitus is very common and we have not specifically evaluated that in these families. The data recorded shows that of the 65 family members over the age of 50 years with clinical information, 40% of those with no renal disease (stage 0) were diabetic, and 40% of those with stage 1–5.

Mild raised blood pressure was universal and has not been specifically evaluated but was easily controlled with 1–2 drugs. In no case was accelerated hypertension considered as relevant.

No specific routine investigation of hearing loss or eye problems was performed but we are not aware of any issue with these features of Alport’s syndrome.

COL4A4:p.G545A in normal population

85 families with evidence of familial kidney disease most likely with a glomerular phenotype (at least one person with haematuria or proteinuria) were investigated and 12 of 85 individuals (14%) were heterozygous for the p.G545A variant.

As controls, we also tested,

225 patients who had started RRT whose primary renal diagnosis was either unknown, or recorded as having diabetes, or hypertension. 18 had the p.G545A variant (8%).

17 individuals from 17 different families with kidney disease considered to have a tubulointerstitial phenotype, none had the p.G545A variant (0%).

67 unrelated patients with clinical evidence of a haematuric nephropathy or a renal biopsy showing secondary FSGS, of whom 2 showed p.G545A (3%).

94 adult volunteers, mean age 53 years, of whom 3 had the p.G545 variant (3.2%). Although healthy and chosen at random, 38% had evidence of CKD stage 1–3.

This gave us 403 control samples tested of which 23 were heterozygous for the p.G545A variant (5.7%). Comparing this proportion with the12/85 (14%) affected probands the difference was significant at p = 0.0063 (2-tailed Chi-squared test).

Digenic family

In one of the five families [see Fig. 1 (a)], NGS had identified a second variant COL4A3:p.G877R (c.2629G > A) that is classified as likely pathogenic by Franklin and Varsome. It has not been reported before in large genomic databases such as gnomAD.

CKD stages 3–4 was present in 4 members with both variants and CKD stage 3 once in a member with only p.G545A variant. In the latter case, there was no proteinuria despite eGFR of 50 ml/min. In the former, all had proteinuria but the maximum was 1.2 g/day with eGFR of 20 ml/min.

The large number of affected people in our five kindreds has allowed us to make a detailed analysis of the natural history of this kidney disease, which is indolent, asymptomatic until disease is advanced, and constitutes an important cause of ESRD, usually in the seventh decade of life, in Cyprus.

From our 5 families, with 73 members with clinical evidence of renal disease, we observed that:

ESRD has occurred in 19.6% of those affected who were aged greater than 50, and occurred at a median age of 63 years.
Proteinuria does not exceed 1 g/d until eGFR is less than 30 ml/min (see Fig. 3).
Haematuria is variable, not always present, and was found at least once in 75% of those tested.
But most importantly, until CKD Stage 4 is reached, patients can present with a tubulointerstitial phenotype (i.e. renal impairment with minimal or no proteinuria).

Histology shows tubulointerstitial disease with interstitial fibrosis and tubular atrophy and extensive global glomerular sclerosis with some glomeruli showing segmental sclerosis. Probably more important than focal and segmental glomerular sclerosis (FSGS) is the large percentage of global glomerular sclerosis evident at an early stage when the eGFR is still in excess of 50 ml/min³⁰.

In the past 20 years there have been an increasing number of reports of AD kidney failure associated with heterozygous pathogenic variants of COL4A3 or COL4A4^{17,31,32,33,34}. These pathogenic variants were initially reported as a cause of autosomal dominant benign familial haematuria in 1996³⁵. The condition is characterised by normal glomerular morphology by light microscopy but diffuse thinning of the GBM by electron microscopy³⁶, hence its name of ‘thin basement membrane disease’ or ‘thin basement membrane nephropathy³⁷.

Although it was initially considered to be a benign condition, in 1985 familial haematuria was reported to result in chronic kidney disease and end-stage renal failure in some elderly patients ³⁸. There is now a large body of data on this condition^{32,33,34,39,40}. Many of these papers, however, are written from a genetic perspective and clinical details are often vague, and terms like proteinuria and chronic kidney disease are undefined. From these series the risk of kidney failure was estimated to be 15–20% of those affected although it was acknowledged that cases were chosen for publication on the grounds that there is obvious pathology and deterioration, the worst cases are likely to be reported first⁴¹ but a consensus has emerged of the natural history. In summary: ^{18,32,33,34,39,40}

ESRD occurs at a median age of 65 years.
CKD at a median age of 60 years.
Proteinuria first evident by age 40.
Microscopic haematuria documented in 80–90% of subjects, but as many as 5% documented as not having haematuria.
Hypertension is common.
Renal cysts may be found

Recently, an analysis of the frequency of likely pathogenic heterozygous CO4A3 or COL4A4 variants in populations not ascertained by the presence of kidney disease strongly suggests that the absolute risk of CKD is far lower than initial estimates, with a combined frequency in gnomAD of haematuria-associated variants as high as 0.94%⁴². Our own data is similar and highlights a group with more indolent disease that lack even a typical glomerular phenotype.

We observed significant enrichment in the frequency of COL4A4:p.G545A among the 85 families studied here compared with controls, and renal disease in the 5 families reported here co-segregates substantially more than would be expected by chance with this variant. This single nucleotide variant 2-227946893-C-G (GRCh37), or 2-227082177-C-G (GRCh38), is relatively common and gnomAD (v2) has an allele count of 7694 and allele frequency of 0.02739. In gnomAD (v3), which is a register of whole genome sequencing, the variant is most commonly found in people from the ‘Middle East’ with a higher allele frequency 0.1013, although the allele count for this group is still very small (n = 316).

In silico variant predictions suggest that COL4A4:p.G545A is pathogenic based on Polyphen as probably damaging, SIFT as deleterious and Grantham score 60. Evolutionary model of variant effect gave a high EVE score of 0.966⁴³. Other predictor scores are REVEL: 0.776; CADD: 23.5; PrimateAI: 0.575. There are other reports that it is a variant of unknown significance (VUS) ⁴². Other more comprehensive in silico tools, Franklin and Varsome, classify the variant as “Benign” with the use of the ACMG criteria⁴⁴.

There are 8 citations in ClinVar all reporting this variant as benign, but in the LOVD3 register, the variant is reported 9 times as benign and 5 times as a VUS. Mutation Taster calls it benign. For such variants the term hypomorphic has been used where change in gene leads to only partial change of the normal (wild-type) gene function⁴⁵.

Because the variant p.G545A is so common, it cannot be regarded as a monogenic cause of the renal disease. The evidence of enrichment among individuals with kidney disease, suggests that it is better considered a predisposing, or risk factor rather than a pathogenic (in the clinical sense) variant. The absence of other genetic causes of kidney disease identified in all but one of the families studied here argues against the p.G545A variant acting only as a genetic modifier of disease, although this possibility cannot be formally excluded empirically.

In the Greek Cypriot population, the p.G545A variant is significantly more frequently found in patients referred for testing because of haematuria (n = 468), than in controls of the general population (n = 368), p = 0.037. On the other hand, COL4A4:p.G545A, demonstrates incomplete penetrance. Previous work in the laboratory of one of us (C. Deltas and colleagues), found this variant in cohorts as follows: in people of the general population, with no known evidence for microscopic haematuria, in patients referred to for microscopic haematuria but no clearcut family segregation when it was possible to test, and in patients who had the COL4A4:p.G545A co-inherited with another pathogenic variant¹⁹ (and unpublished results).

In one of our five families, NGS had identified a second variant COL4A3:p.G877R (c.2629G > A) that is classified as likely pathogenic by Franklin and Varsome. It is likely that this family has digenic disease as shown in the family tree but the clinical phenotype among those individuals harbouring both variants was not appreciably different from other families [see Fig. 1 (a)].

Similar to our findings, is the observation that several pathogenic variants in the COL4A5 gene lead to a much-attenuated form of Alport syndrome. These variants have been described as hypomorphic. Pierides and colleagues have described two in detail (G624D, P628L) and reviewed other examples ⁴⁵.

The COL4A5:p.G624D variant, in particular, is common in central Europe with its origin in 12th-13th century. Polish experience of children from 44 families, with adult follow up, describes a childhood phase of low-grade and/or intermittent haematuria, late onset mild proteinuria with end-stage renal failure at age 50–60 years, rather than 20–30 years⁴⁶.

Members of our five families fulfilled the clinical KDIGO criteria for ADTKD, which are CKD with bland urinary sediment, none to moderate proteinuria, and normal or decreased size kidneys, with their pedigree consisting of at least 2 affected family members in 2 successive generations⁴⁷.

AD and X-linked Alport syndrome have recently been reported as a cause of autosomal dominant tubulo-interstitial disease (ADTKD)^48,49, which supports our finding that the disease can behave as much like a tubulointerstitial disease as it does a glomerular one.

When patients reach end-stage it is common for the primary cause of kidney failure to be unknown (aetiology unknown)⁵⁰. Our review of the published literature from the Eastern Mediterranean shows that the cause is unknown in the majority, when ‘diagnoses’ like hypertension or diabetes are excluded ²¹. Genetic testing will give us much more information but it is our opinion that AD Alport spectrum nephropathy will be the most common inherited form⁵¹.

In conclusion, we suggest that variant COL4A4:p.G545A is a genetic factor conferring a lifelong predisposition to a tubular rather than a glomerular disease that one would expect, as a collagen IV glycine residue substitution. It is apparent, based on the data, that it is associated with incomplete penetrance and a milder course of disease. Also, we suggest that together with MUC1 and UMOD pathogenic variants causing ADTKD, this variant is also associated with a predominantly ‘tubulointerstitial’ disease that will explain at least some cases labelled as ‘hypertensive nephropathy’.

It will be interesting to speculate on the potential genetic advantage of this variant. Epidemics such as plague, cholera, TB that have plagued the area might be relevant.

Acknowledgements

We would like to thank the families included in the study. We also thank Professor David St Clair and Dr Michael Prendergast for their comments on the paper, and Dr. Huseyin Sevay for his help with the pedigree drawings.

Author contributions

Research idea and study design: DDO, GHN; clinical care, data and sample collection: DDO, AB, SA, SB, MY, FO; laboratory studies: FO, CG; data analysis/interpretation: FO, GHN, DPG, CG; statistical analysis: AM, DPG, CD.; manuscript writing: GHN, CD, DPG, CG, FO.

All authors have read and agreed to the published version of the manuscript.

Funding

Funding for FO was provided by the Eastern Mediterranean University. This work was partly funded by EMU. DPG is supported by St. Peter’s Trust for Kidney, Bladder, & Prostate Research. This work was partly funded by the Cyprus Research and Innovation Foundation, programme RESTART 2016-2020/INTEGRATED/0918/0043, to CD. Also, CD is funded by the CY-Biobank, an EU Horizon 2020 Research and Innovation Programme, under Grant Agreement No. 857122, the Republic of Cyprus, and the University of Cyprus.

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The following authors declare no competing interests: FO, DDO, AB, SA, SB, MY, GP, AM, CD, DPG, CG, GHN

Jager, K. J. et al. A single number for advocacy and communication—worldwide more than 850 million individuals have kidney diseases. Kidney Int. 96, 1048–1050 (2019).
Mills, K. T. et al. A systematic analysis of worldwide population-based data on the global burden of chronic kidney disease in 2010. Kidney Int. 88, 950–957 (2015).
Hill, N. R. et al. Global Prevalence of Chronic Kidney Disease - A Systematic Review and Meta-Analysis. PLoS One 11, e0158765 (2016).
Stanifer, J. W., Muiru, A., Jafar, T. H. & Patel, U. D. Chronic kidney disease in low- and middle-income countries. Nephrol. Dial. Transplant. 31, 868–874 (2016).
Glassock, R. J., Warnock, D. G. & Delanaye, P. The global burden of chronic kidney disease: estimates, variability and pitfalls. Nat. Rev. Nephrol. 13, 104–114 (2017).
Webster, A. C., Nagler, E. V, Morton, R. L. & Masson, P. Chronic Kidney Disease. Lancet (London, England) 389, 1238–1252 (2017).
Gansevoort, R. T. et al. Chronic kidney disease and cardiovascular risk: epidemiology, mechanisms, and prevention. Lancet (London, England) 382, 339–352 (2013).
Nguyen, N. T. Q. et al. Chronic kidney disease, health-related quality of life and their associated economic burden among a nationally representative sample of community dwelling adults in England. PLoS One 13, e0207960 (2018).
Smith, D. H., Gullion, C. M., Nichols, G., Keith, D. S. & Brown, J. B. Cost of Medical Care for Chronic Kidney Disease and Comorbidity among Enrollees in a Large HMO Population. J. Am. Soc. Nephrol. 15, 1300–1306 (2004).
ERA-EDTA Registry Annual Report 2019. Amsterdam UMC, Department of Medical Informatics, Amsterdam, the Netherlands, 2021.
Bikbov, B. et al. Global, regional, and national burden of chronic kidney disease, 1990–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 395, 709–733 (2020).
Akrawi, D. S., Li, X., Sundquist, J., Sundquist, K. & Zöller, B. Familial risks of kidney failure in Sweden: a nationwide family study. PLoS One 9, e113353 (2014).
Skrunes, R., Svarstad, E., Reisaeter, A. V & Vikse, B. E. Familial clustering of ESRD in the Norwegian population. Clin.J.Am.Soc.Nephrol. vol. 9 1692–1700 (2014).
Connaughton, D. M. et al. The Irish Kidney Gene Project - Prevalence of Family History in Patients with Kidney Disease in Ireland. Nephron 130, 293–301 (2015).
Connor, T. M. F. et al. Incidence of End-Stage Renal Disease in the Turkish-Cypriot Population of Northern Cyprus: A Population Based Study. PLoS One 8, e54394 (2013).
Athanasiou, Y. et al. Familial C3 Glomerulopathy Associated with CFHR5 Mutations: Clinical Characteristics of 91 Patients in 16 Pedigrees. Clin. J. Am. Soc. Nephrol. 6, 1436–1446 (2011).
Voskarides, K. et al. COL4A3/COL4A4 mutations producing focal segmental glomerulosclerosis and renal failure in thin basement membrane nephropathy. J. Am. Soc. Nephrol. 18, 3004–3016 (2007).
Pierides, A. et al. Clinico-pathological correlations in 127 patients in 11 large pedigrees, segregating one of three heterozygous mutations in the COL4A3 COL4A4 genes associated with familial haematuria and significant late progression to proteinuria and chronic kidney dise. Nephrol. Dial. Transplant. 24, 2721–2729 (2009).
Papazachariou, L. et al. Frequency of COL4A3/COL4A4 Mutations amongst families segregating glomerular microscopic hematuria and evidence for activation of the unfolded protein response. Focal and segmental glomerulosclerosis is a frequent development during ageing. PLoS One 9, 1–25 (2014).
Stavrou, C. et al. Autosomal-dominant medullary cystic kidney disease type 1: Clinical and molecular findings in six large Cypriot families. Kidney Int. 62, 1385–1394 (2002).
Neild, G. H., Oygar, D. D. & Hmida, M. B. Can we improve diagnosis of renal failure? A revised coding system for Middle East and North Africa. Saudi J. Kidney Dis. Transpl. 22, 651–661 (2011).
Irwin, J. et al. Mitochondrial control region sequences from northern Greece and Greek Cypriots. Int. J. Legal Med. 122, 87–89 (2008).
Voskarides, K. et al. Y-chromosome phylogeographic analysis of the Greek-Cypriot population reveals elements consistent with Neolithic and Bronze Age settlements. Investig. Genet. 7, 1 (2016).
Gurkan, C. et al. Turkish Cypriot paternal lineages bear an autochthonous character and closest resemblance to those from neighbouring Near Eastern populations. Ann. Hum. Biol. 44, 164–174 (2017).
Pakstis, A. J. et al. Genetic relationships of European, Mediterranean, and SW Asian populations using a panel of 55 AISNPs. Eur. J. Hum. Genet. 27, 1885–1893 (2019).
Kidd, K. K. et al. Genetic relationships of Southwest Asian and Mediterranean populations. Forensic Sci. Int. Genet. 53, (2021).
Census. The Final results of TRNC General Population and 2006, Census. http://nufussayimi.devplan.org/Kesin-sonuc-index_en.html.
Levey, A. S. et al. National Kidney Foundation Practice Guidelines for Chronic Kidney Disease: Evaluation, Classification, and Stratification. Ann Intern Med vol. 139 www.annals.org (2003).
Lin, F. et al. Whole exome sequencing reveals novel COL4A3 and COL4A4 mutations and resolves diagnosis in Chinese families with kidney disease. BMC Nephrol. 15, 1–8 (2014).
Nieuwhof, C. M. G., De Heer, F., De Leeuw, P. & Van Breda Viriesman, P. J. C. Thin GBM nephropathy: Premature glomerular obsolescence is associated with hypertension and late onset renal failure. Kidney Int. 51, 1596–1601 (1997).
Jefferson, J. A. et al. Nephrology Dialysis Transplantation Autosomal dominant Alport syndrome linked to the type IV collage a3 and a4 genes ( COL4A3 and COL4A4 ). Nephrol. Dial. Transplant. 12, 1595–1599 (1997).
Pescucci, C. et al. Autosomal-dominant Alport syndrome: Natural history of a disease due to COL4A3 or COL4A4 gene. Kidney Int. 65, 1598–1603 (2004).
Furlano, M. et al. Clinical and Genetic Features of Autosomal Dominant Alport Syndrome: A Cohort Study. Am. J. Kidney Dis. 78, 560-570.e1 (2021).
Savige, J. Heterozygous Pathogenic COL4A3 or COL4A4 Variants (Autosomal Dominant Alport Syndrome) Is Common, and Not Typically Associated With End-Stage Kidney Failure, Hearing Loss, or Ocular Abnormalities. Kidney Int. Reports 7, 1933–1938 (2022).
Lemmink, H. H. et al. Benign familial hematuria due to mutation of the type IV collagen alpha4 gene. J. Clin. Invest. 98, 1114–1118 (1996).
Rumpelt, H. J., Langer, K. H., Schärer, K., Straub, E. & Thoenes, W. Split and extremely thin glomerular basement membranes in hereditary nephropathy (Alport’s syndrome). Virchows Arch. A. Pathol. Anat. Histol. 364, 225–233 (1974).
Gauthier, B., Trachtman, H., Frank, R. & Valderrama, E. Familial thin basement membrane nephropathy in children with asymptomatic microhematuria. Nephron 51, 502–508 (1989).
Dische, F. E., Weston, M. J. & Parsons, V. Abnormally thin glomerular basement membranes associated with hematuria, proteinuria or renal failure in adults. Am. J. Nephrol. 5, 103–109 (1985).
Matthaiou, A., Poulli, T. & Deltas, C. Prevalence of clinical, pathological and molecular features of glomerular basement membrane nephropathy caused by COL4A3 or COL4A4 mutations: a systematic review. Clin. Kidney J. 13, 1025–1036 (2020).
García-Aznar, J. M. et al. New Insights into Renal Failure in a Cohort of 317 Patients with Autosomal Dominant Forms of Alport Syndrome: Report of Two Novel Heterozygous Mutations in COL4A3. J. Clin. Med. 11, 4883 (2022).
Van der Loop, F. T. L. et al. Autosomal dominant alport syndrome caused by a COL4A3 splice site mutation. Kidney Int. 58, 1870–1875 (2000).
Gibson, J. et al. Prevalence estimates of predicted pathogenic COL4A3-COL4A5 variants in a population sequencing database and their implications for Alport syndrome. J. Am. Soc. Nephrol. 32, 2273–2290 (2021).
Frazer, J. et al. Disease variant prediction with deep generative models of evolutionary data. Nature 599, 91–95 (2021).
Richards, S. et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 17, 405–424 (2015).
Pierides, A., Voskarides, K., Kkolou, M., Hadjigavriel, M. & Deltas, C. X-linked, COL4A5 hypomorphic Alport mutations such as G624D and P628L may only exhibit thin basement membrane nephropathy with microhematuria and late onset kidney failure. Hippokratia 17, 207–213 (2013).
Żurowska, A. M. et al. Mild X-linked Alport syndrome due to the COL4A5 G624D variant originating in the Middle Ages is predominant in Central/East Europe and causes kidney failure in midlife. Kidney Int. 99, 1451–1458 (2021).
Eckardt, K. U. et al. Autosomal dominant tubulointerstitial kidney disease: Diagnosis, classification, and management - A KDIGO consensus report. Kidney Int. 88, 676–683 (2015).
Wopperer, F. J. et al. Diverse molecular causes of unsolved autosomal dominant tubulointerstitial kidney diseases. Kidney Int. 102, 405–420 (2022).
Popp, B. et al. Prevalence of hereditary tubulointerstitial kidney diseases in the German Chronic Kidney Disease study. Eur. J. Hum. Genet. 30, 1413–1422 (2022).
Neild, G. H. Primary renal disease in young adults with renal failure. Nephrol. Dial. Transplant. 25, 1025–1032 (2010).
Deltas, C., Savva, I., Voskarides, K., Papazachariou, L. & Pierides, A. Carriers of Autosomal Recessive Alport Syndrome with Thin Basement Membrane Nephropathy Presenting as Focal Segmental Glomerulosclerosis in Later Life. Nephron 130, 271–280 (2015).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Autosomal dominant tubulointerstitial kidney disease cosegregating with COL4A4:p.G545A in Turkish Cypriot families with kidney failure

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Study population

Ethics statement

Patients

Clinical investigations

Methods

Datasets and mutation predictions

Statistical Analysis

Results

Genetics

Families with COL4A4:p.G545A variant

Onset CKD Stage 3 and end-stage kidney disease (ESKD)

Microscopic haematuria

Proteinuria

Renal biopsy

Other clinical features

COL4A4:p.G545A in normal population

Digenic family

Discussion

Declarations

Acknowledgements

Author contributions

Funding

Competing interests

References

Additional Declarations

Status:

Version 1