Subjects
All human studies were approved by the Ethics Committee of Beijing Chaoyang Hospital, Capital Medical University (Certificate No. 2018-KE-324) and the informed consents were signed by all subjects or their representatives. The cohort study enrolled adult ARDS subjects (aged from 18-85 years old) secondary to sepsis with the requirement of invasive mechanical ventilation (IMV) and without metabolic disorders including diabetes and hyperlipidemia from the medical ICU and paired adult healthy subjects (volunteers) without chronic and acute diseases from the health screening center at the Beijing Chaoyang Hospital, Capital Medical University. Septic-ARDS was defined in accordance with the Berlin definition and 2016 Sepsis 3.0 definition and the blood samples were collected within 24 hours after ARDS confirmation. In total, the blood samples from 40 ARDS patients and 40 age and sex-matched healthy controls were collected (Table 1 for the clinical characteristics). We collected 12ml of blood from ARDS patients and 6ml of blood from control subjects, respectively. Blood was drawn into a 6-ml EDTA vacutainer and centrifuged at 3000 rpm for 10 min and the plasma was frozen at –80°C for further studies.
Isolation of HDL subfractions.
HDL (1.063<density<1.21 g/ml) was isolated from plasma by discontinuous density-gradient ultracentrifugation [17]. Plasma from 5 individuals with similar age and clinical situations (including etiology, APACHE II score and inflammatory condition) were pooled to improve the quality of isolated HDL. Mixed plasma samples were adjusted to a density of 1.3 g/ml with KBr and the plasma was carefully overlaid with normal saline after loaded to centrifuge tube. The samples were centrifuged at 350000 g for 5 h at 4°C and HDLs in the middle of the tubes were carefully collected by penetrating with a syringe. The lipoprotein fractions were then dialyzed against endotoxin-free phosphatebuffered saline (10 mM, PH7.4) at 4 °C for 24 hours. HDLs were sterilized with 0.22 μm filter. The purity of HDLs were confirmed by the 10% SDS-PAGE electrophoresis. The concentration of HDLs were quantified through the measurement of apoA-I content by nephelometry.
Cecal ligation and puncture (CLP) septic mouse model:
The animals were bred at the animal facility of Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. All animal procedures were approved by the Animal Care and Ethics Committee of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences and were performed in accordance with the Guide for the Care and Use of Laboratory Animals of the Chinese Academy of Sciences.
ApoA-I knockout (KO) mice on C57BL/6 background were obtained from The Jackson Laboratory. CLP was performed on 10-week-old mice. Briefly, mice were anesthetized by 2% sodium pentobarbital (110 mg/kg) and a 1.0-2.0 cm of midline incision was made below the diaphragm on shaved and sterilized abdomen (scrubbed with hair cream and povidone-iodine) to expose the cecum. Following a 30% ligation (light CLP) or a 50% ligation (moderate CLP), cecum was punctured twice with a 18-gauge needle and gently compressed to extrude a small amount of cecal material. The cecum was returned to the abdomen, and the muscle and skin incisions were closed with 4-0 silk suture. Sham group was similarly treated without ligation and puncture of the cecum. After the surgery, mice were resuscitated with 1 ml pre-warmed (37 ℃) phosphate-buffered saline subcutaneously. 24 hours post CLP, the lung tissues were collected and subjected into further analyses.
Cell experiments
Mouse lung microvascular endothelial cells (MLECs) were isolated from C57BL/6 mice. Briefly, the lung was perfused, lavaged and cut into small pieces which were in turn digested with the enzymes dispase and collagenase A (Sigma) for 60 min at 37°C. Following digestion, single-cell suspensions were passed through a 70-μm filter to remove debris. Endothelial cells were isolated by positive selection using Microbeads binding to CD31. Flow cytometry confirmed that 90% of cells in the final suspension are CD31-positive. Primary MLECs were maintained in endothelium cell medium (Sciencell). For HDL treatment experiments, endothelial cells were cultured in endothelium cell medium (containing 1% FBS) with HDL (50μg/ml) or human albumins (sigma).
In vitro permeability assay
MLECs were cultured on transwell inserts (diameter: 6.5 mm, pore size: 0.4 μm, Corning). Until cells formed a monolayer, the culture medium in upper and lower compartments was changed to medium (1% FBS) with HDL (50 μg/ml) or human albumin and cells were cultured for 24 hours. The fluorescent tracer, fluorescein isothiocyanate (FITC)-dextran (500 ug/ml, Sigma-Aldrich) was then added to the upper compartment. The permeability was determined by the diffused amount of FITC-dextran into the lower compartment measured by fluorescence intensity of the medium at 518 nm with excitation at 492nm.
Oxidative modification of apoA-I
The protein bands were digested according to an in-gel digestion procedure and were subjected into liquid chromatography–mass spectrometry (LC–MS/MS) analysis performed on an LTQ linear ion trap mass spectrometer. Modification analysis was carried out by LC–MS/MS searching the data specifically against the sequence of apoA-I using the program Sequest bundled into Proteome Discoverer 1.3 (Thermo Scientific, San Jose, CA, USA). The native reference peptide (NRP) method was used for the quantification of modified peptides present in a tryptic digest by utilizing an unmodified peptide from the protein of interest that is also formed in the tryptic digestion as the internal standard. The peak areas for interesting peptides were determined and normalized to the peak areas of the reference peptides as an index of the relative amounts of these peptides[18].
Lung lavage analyses
The bronchoalveolar lavage fluid (BALF) was collected as described previously [19, 20]. Briefly, 1ml saline was instilled into lung through a 20-gauge blunt-tipped needle inserted into the trachea and aspirated three times. The supernatant of BALF (400g x 10 min) was used for the measurements of total BALF protein (Bradford) and inflammatory cytokines by Elisa kits.
Histological analyses
Lung dissected out from mice subjected into designed procedure were fixed in 4% PFA and embedded in paraffin. These paraffin embedded tissues were sliced into 5 μm-thick sections for Hematoxylin and eosin (HE) (ScyTek Laboratories). Immnunohistochemistry (IHC) was performed as a standing protocol and the antibody used was VCAM1 (CST, 39036) .
The histopathologic degree of lung injury was evaluated through a double-blind examination and scored semi-quantitatively by a scale of 0 to 4 (0, appears normal; 1, light; 2, moderate; 3, strong; 4, intense) for edema, inflammation, hemorrhage and area of structural impairment, based on 10 fields of lung parenchyma (200 × magnification) . A mean score for each of the parameters was then calculated. The final lung injury score was obtained by averaging the score from the animals within each group.
Wet-to-dry lung weight ratio and Evans Blue dye leakage
The right up lobe of lung was collected to assess the lung wet-to-dry weight ratio by the gravimetric method. After the wet lung weight was measured, the lung was incubated at 60 °C for 72h. Then, the dry lung weight was measured and the ratio of wet-to-dry weight was calculated.
To examine the alveolar microvascular leakage after CLP, mice were injected via the tail vein with Evans Blue dye (50 mg/kg). Three hours after dye injection, BALF was collected and the supernatant of remaining BALF (400g x 10min) was used for the measurements of absorbance at 620 nm.
The Levels of Cytokines and apolipoproteins
The HDL components including apolipoproteins, serum amyloid A (SAA), paraoxonase-1 (PON1) and myeloperoxidase (MPO) were quantified by Quantitative Competitive Elisa kits from Hermes Criterion Biotechnology. The plasma levels of human apolipoproteins, PON1, MPO and mouse HDL were measured by Elisa kits from Cloud-clone. The levels of all cytokines were measured by Elisa kits from R&D Systems.
Quantitative Real-time PCR
Total RNA was extracted from mouse lungs and MLECs using TRIzol® Reagent (Invitrogen) according to the manufacturer’s manual. RNA was transcribed into cDNA using random oligonucleotide hexamers in First Strand cDNA Synthesis Kit (Invitrogen). The data were normalized to the RPL19 content and analyzed by the 2-△△Ct method relative to control groups. The primers used in qPCR: TNF-α: CAGGCGGTGCCTATGTCTC, CGATCACCCCGAAGTTCAGTAG; IL-1β: GAAATGCCACCTTTTGACAGTG, TGGATGCTCTCATCAGGACAG; MCP-1: TAAAAACCTGGATCGGAACCAAA, GCATTAGCTTCAGATTTACGGGT; IL-6: CTGCAAGAGACTTCCATCCAG, AGTGGTATAGACAGGTCTGTTGG.
Immunoblot Analyses
Protein extracts prepared from tissues and cells were subjected to immunoblot analyses with antibodies against: VE-Cadherin from Thermo Fisher, VCAM1 and P-p65 from CST, ICAM1 form Abcam, P65 and GAPDH form Santa Cruz.
Statistical analysis
Data are presented as n for categorical variables, mean ± SEM (stand error of the mean) for normally distributed continuous variables, medians (25th–75th percentiles) for no-normally distributed continuous variables. To compare continuous variables, the Shapiro-Wilk test was used to test the normality of the data. Statistical comparisons between 2 groups were performed using χ2 test for categorical variables, the Mann-Whitney U test for non-normally distributed continuous variables and the two-tailed Student’s t-test for normally distributed continuous variables. Comparisons among groups were performed using 1-way or 2-way ANOVA followed by post hoc multiple comparison tests where appropriate. A p value of <0.05 indicated significant difference between groups .