CircDock6 promotes NAFLD by regulating IGF1R through targeting mmu-let-7 g-5p

doi:10.21203/rs.3.rs-2857513/v1

Download PDF

Research Article

CircDock6 promotes NAFLD by regulating IGF1R through targeting mmu-let-7 g-5p

https://doi.org/10.21203/rs.3.rs-2857513/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Circular RNAs (circRNAs) are a novel kind of noncoding RNA with a closed ring structure. An increasing number of studies have shown that it plays an important role in NAFLD. In this study, we used circDock6 to explore its role and molecular mechanism in the progression of NAFLD. qRT‒PCR was used to detect the circDock6 expression level in SD liver tissues and HFD tissues. The regulatory effects of circDock6 in NAFLD were evaluated by Oil Red “O” staining, triglyceride detection, and western blot (WB) analysis. CircDock6 was significantly upregulated in HFD liver tissues compared to SD tissues. Additionally, Oil Red “O” staining and triglyceride detection revealed that decreased expression levels of circDock6 inhibited lipid droplet formation and reduced triglyceride content. CircDock6 acts as a mmu-let-7 g-5p sponge to promote the progression of NAFLD by regulating IGF1R. Our data demonstrated that circDock6 was expressed at high levels in HFD tissues. Knockdown of circDock6 expression inhibited NAFLD progression by regulating IGF1R through targeting mmu-let-7 g-5p.

NAFLD

circDock6

IGF1R

mmu-let-7 g-5p

steatosis

Nonalcoholic fatty liver disease (NAFLD) is a clinical pathological syndrome characterized by intrahepatic lipid storage that is closely related to various factors, such as insulin resistance, metabolic disorders, genetics, and the environment [1]. In recent years, with the improvement of living standards and changes in dietary structure, the prevalence of NAFLD has been increasing year by year, with adults in China reaching as high as 29.2% [2]. The prevalence of NAFLD worldwide has also rapidly risen to 27.4% [3]. NAFLD includes multiple chronic liver diseases, such as simple fatty liver and nonalcoholic steatohepatitis (NASH). NASH can further develop into end-stage liver diseases, such as cirrhosis and even liver cancer [4]. Some studies have shown that the probability of NAFLD patients ultimately developing liver cancer can be as high as 13% [5]. NAFLD can also significantly increase the risk of extrahepatic diseases such as coronary heart disease and diabetes, which seriously endangers human health [1, 6].

Circular RNAs (circRNAs) are a kind of noncoding RNA with a closed ring structure, without a 5' cap structure and a 3' poly (A) structure. It is mainly located in the cytoplasm or stored in exosomes and is not affected by RNA exonuclease. Its expression is more stable and not easy to degrade. It has been confirmed that it widely exists in many eukaryotes [7]. Specific expression within cells and tissues, exercise various regulatory functions. Recent studies have shown that circRNAs are rich in microRNA (miRNA) binding sites, acting as miRNA sponges in cells, thereby relieving the inhibitory effect of miRNA on its target genes and increasing the expression level of target genes. CircRNAs play an important regulatory role in diseases by interacting with miRNAs.

Bioinformatics analysis has found that the interrelationships between circRNA, miRNA, and miRNA targets can participate in the occurrence of NAFLD and are expected to become potential biomarkers for future NAFLD [8]. There have been research reporting that circ_ 021412 affects liver steatosis through the miR-1972/LPIN1 pathway and is an important factor regulating liver steatosis [9]. circ_0016367 can prevent hepatotoxicity of lipid peroxidation and inhibit steatosis of the liver [10]. CircScd1 affects the occurrence of NAFLD through the JAK2/STAT5 signalling pathway [11]. Recently, studies have found that circRNA0001805 can alleviate NAFLD occurrence through the miR-106a-5p/miR-320a and ABCA1/CPT1 axes [12]. The above studies suggest that abnormal expression of circRNA may affect liver steatosis, leading to the occurrence of NAFLD.

In our study, we focused on circDock6, which has aberrant expression, as the research object by using a NAFLD circRNA gene chip, which is located on chromosome 9 and has a spliced sequence length of 521 nucleotides. The following study also indicates that circDock6 is significantly expressed in high-fat diet (HFD) tissues than in standard diet (SD) tissues. However, the role and specific mechanism of aberrant expression of circDock6 in NAFLD are unclear.

Further study found that by downregulating the expression of circDock6 in AML-12 cells, lipid metabolism, and triglyceride levels were significantly reduced. The gene chip of circRNA indicated that circDock6 possesses 4 miRNA binding sites: mmu-let-7 g-3p, mmu-let-7 g-5p, mmu-miR-138-5p, and mmu-let-7i-5p. Previous studies found that the expression level of circDock6 was downregulated in AML-12 cells, with the most significant increase in the mmu-let-7 g-5p expression level. Moreover, as the target of mmu-let-7 g-5p, IGF1R has been reported to be involved in metabolic homeostasis [13] and severe steatosis-associated injury [14].

The aim of this research was to reveal that the impact of circDock6 on NAFLD is achieved by indirectly regulating the mmu-let-7 g-5p target gene IGF1R by binding to mmu-let-7 g-5p.

Mouse samples

Ten SD liver tissues that were fed a standard diet and 10 HFD liver tissues that were fed a high-fat diet were obtained from eight-week-old male C57BL6J mice. All C57BL6J mice were purchased from the Slac Laboratory Animal Center (Shanghai, China) and bred in the Ningbo University Laboratory Animal Center. The mice were randomly divided into a normal group (SD group) and an experimental group (HFD group) according to different feeding methods. The liver tissues were harvested by the tenth week of feeding.

Cell culture

The mouse normal hepatocyte AML-12 cell line was purchased from ATCC. The cells were incubated at 37°C in a humidified atmosphere with 5% CO2 and grown in DMEM/F-12 (1:1) (Gibco, USA) supplemented with 10% foetal bovine serum (FBS), dexamethasone and ITS Liquid Media Supplement (Sigma, Japan).

Cell esterification modelling

In this study, we used palmitic acid (PA), oleic acid (OA) and free fatty acids (FFAs) to create cell esterification models. The PA concentration configuration followed the method we previously reported [11]. OA was added to 10 ml of 25% BSA solution to prepare 20 mM of mother liquor, and FFA was OA:PA = 2:1.

qRT-PCR Analysis

Total RNA from mouse liver tissues and AML-12 cells was extracted using TRIzol reagent (Invitrogen, Karlsruhe, Germany). Then, reverse transcription of RNA into cDNA was performed using a Reverse Transcription Kit with random primers (Promega, Madison, WI, USA). Finally, we used real-time quantitative reverse transcription-polymerase chain reaction (qRT‒PCR) to amplify DNA according to the manufacturer’s instructions with SYBR Green master mix (Promega, Madison, WI, SUA), which was performed in an Mx3005PQPCR System (Stratagene, La Jolla, CA, USA). We used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous reference for circDock6.

The 2^−ΔΔCt value represents the relative quantification of circRNA expression level[15, 16]. The primers for GAPDH and circDock6 used for qRT‒PCR are shown in Table 1.

Table 1

The sequences of circDock6
Gene	Sequences
circDock6 GAPDH SiRNA1- circDock6	F: GGCCTAACTTTGTAGCCAAGGC R: GGCCAGAGGGTCTTGGACAT F: TCGACAGTCAGCCGCATCTTCTTT R: ACCAAATCCGTTGACTCCGACCTT F: UGCCCCUGCAAGUUUCUCUTT R: AACUUGCAGGGGCAGGAGATT
SiRNA2- circDock6 SiRNA3- circDock6	F: UCUCCUGCCCCUGCAAGUUTT R: UCUUCACCUUCUCUCGUUCTT F: UCCUGCCCCUGCAAGUUUCTT R: GAAACUUGCAGGGGCAGGATT

Cell transfection

We designed and synthesized three small interfering RNAs (siRNAs) to knockdown the expression level of circDock6 by Tsingke Biotechnology (Nanjing, China). The sequences of siRNA-circDock6 are shown in Table 1. Next, we followed the manufacturer’s protocol for AML-12 cell transfection with Lipofectamine 2000 (Invitrogen). Finally, we determined that 100 nM siRNA-circDock6-2 was the optimal interference concentration for AML 12 cells.

Oil red “O” staining

First, the oil red was dissolved in isopropanol to prepare a 0.5% stock solution. Then, the stock solution was mixed with PBS in a 3:2 ratio and allowed to stand for half an hour. Then, it was filtered with a 0.45 µm filter. After 20 minutes of sedimentation, it was filtered with a 0.22 µm filter. Finally, the cells were incubated for 20 minutes to observe the formation of lipid droplets.

Triglyceride detection

The cells were lysed with lysate for 10 minutes, heated at 70°C for 10 minutes, and centrifuged at room temperature at 2000 rpm for 5 minutes. Afterwards, the triglyceride content was detected according to the reagent kit instructions.

Western blot analysis

Protein was collected from cells lysed in lysis buffer, and moderate centrifugation was performed. Approximately 20 µg of protein per lane was separated on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred onto PVDF membranes (Millipore, Billerica, MA, USA). Anti-IGF1R (Abcam) and anti-β-actin (Biotech) were used as the controls for the primary antibodies to perform immunoblotting of the membrane. After incubation with the recommended rabbit or mouse secondary antibody, we used an Odyssey Infrared Imaging System (LI-COR, Lincoln, NE, USA) to quantify the intensity of each protein band.

Statistical analysis

All experimental data were presented at least in triplicate. The data are presented as the mean ± standard deviation. SPSS 22 (SPSS Inc., Chicago, IL) was used to evaluate the differences between groups with two-tailed Student’s t tests.

Successful modelling using OA-esterified AML-12 cells

In this study, we used two concentrations, 100 µM and 200 µM, of OA, PA, and FFA to esterify AML 12 cells. The results showed that 200 µM OA esterified cells were the most successful (Fig. 1).

CircDock6 was significantly upregulated in HFD tissues compared to SD tissues

To verify the expression level of circDock6 predicted by the chip in NAFLD [11], we detected SD liver tissues (n = 10) and HFD liver tissues (n = 10) using PCR technology. The results demonstrated that circDock6 was significantly overexpressed in HFD liver tissues, consistent with the chip results (Fig. 2A).

Since SD and HFD are not paired tissues, we performed standardized data processing on 10 SD liver tissues to intuitively observe the expression levels of each HFD liver tissue. The results clearly showed that compared to the standardized SD liver tissue, each HFD was significantly overexpressed (Fig. 2b). Similarly, we conducted standardized data processing on 10 HFD liver tissues and observed the expression levels of each SD, but the results were opposite (Fig. 2c).

Knockdown of the expression level of circDock6 can inhibit the degree of steatosis and reduce the triglyceride content in NAFLD

Based on the unique structure of circRNA, we designed and synthesized three siRNAs for circDock6, as shown in Table 1, and then transfected them with lipidized AML-12 at concentrations of 80 nM, 100 nM, and 120 nM. The inhibitory effect on the expression level of circDock6 was observed, and the experimental results showed that the interference effect of siRNA2-circDock6 at a concentration of 100 nM was the best (Fig. 3a).

To further investigate the regulatory role of circDock6 in lipidized AML-12 of NAFLD, we observed the degree of changes in oil red staining and detection of triglyceride content by knocking down the expression level of circDock6, and the results revealed that downregulating the expression level of circDock6 could significantly inhibit the formation of lipid droplets (Fig. 3b), and the content of triglycerides also significantly decreased (Fig. 3c).

The regulation of NAFLD by circDock6 is achieved by binding to mmu-let-7 g-5p and indirectly regulating the target gene IGF1R of mmu-let-7 g-5p

The above results suggest that downregulating the expression level of circDock6 can effectively inhibit the formation of lipid droplets and reduce the content of triglycerides, but the molecules involved in its regulation are unknown. Next, we explored the expression levels of mmu-let-7 g-3p, mmu-let-7 g-5p, mmu-miR-138-5p, and mmu-let-7i-5p, which interact with circDock6 as a sponge predicted by the chip. PCR results showed that after inhibiting the expression level of circDock6, the expression level of mmu-let-7 g-5p increased most significantly (Fig. 4a). Moreover, circDock6 and mmu-let-7 g-5p indeed have binding sites (Fig. 4b), while the mRNA and protein expression levels of the mmu-let-7 g-5p target gene IGF1R decreased correspondingly (Fig. 4c, d).

Knockdown of circDock6 expression is synchronized with knockdown of mmu-let-7 g-5p expression, and NAFLD steatosis remains unchanged

To further demonstrate that circDock6 regulates NAFLD by binding to mmu-let-7 g-5p and indirectly regulating the target gene IGF1R of mmu-let-7 g-5p, we conducted a cell salvage experiment, which knocked down the expression level of circDock6 while also knocking down the expression level of mmu-let-7 g-5p to observe changes in lipid droplets and triglycerides. The rescue experiment suggested that there was no significant change in lipid droplets and triglycerides (Fig. 5a, 5b), and the mRNA and protein expression levels of IGF1R were not significantly changed (Fig. 5c, d).

NAFLD is a liver metabolic disease characterized by the accumulation of triglyceride-based lipids in hepatocytes as pathological changes and has become one of the most common liver diseases in the world [17–19, DDS]. Its incidence rate continues to increase and may further progress to cirrhosis, liver failure and hepatocellular carcinoma, threatening human health [4, 1, 6].

With the deepening of research on NAFLD, an increasing number of studies have found that circRNAs play an important regulatory role in the occurrence and development of NAFLD in recent years. CircRNA SCAR, which is located in mitochondria, can drive post in flammation, emphasizing that circRNAs have enormous potential in the early diagnosis of NAFLD [20]. Circ_0057558 promotes NAFLD by regulating ROCK1/AMPK signalling, which acts as a miR-206 sponge [21]. There are review reports that circRNAs have potential roles in the development of NAFLD and can become potential therapeutic strategies for NAFLD [22].

In this study, we investigated the role and mechanism of circDock6 in NAFLD. First, we found aberrant expression of circDock6 in NAFLD through microarray analysis. Subsequently, tissue experiments confirmed that circDock6 was significantly overexpressed in HFD compared to SD liver tissue, consistent with the microarray results. Further cellular research has found that downregulating the expression level of circDock6 in lipidized AML-12 cells can significantly inhibit the steatosis of NAFLD.

To further investigate the mechanism by which circDock6 regulates NAFLD, we detected and validated the expression level of mmu-let-7 g-5p, which interacts with circDock6 as a sponge predicted by the chip. We found that by knocking down the expression level of circDock6, the expression level of mmu-let-7 g-5p was increased, while the expression level of IGF1R of the mmu-let-7 g-5p target gene decreased accordingly. Finally, through cell rescue experiments, we found that knocking down the circDock6 expression level and downregulating the mmu-let-7 g-5p expression level simultaneously did not significantly change the steatosis of NAFLD, and the protein expression level of IGF1R was also not significantly changed.

Our study revealed that circDock6 was significantly upregulated in HFD and acted as a mmu-let-7 g-5p sponge to regulate IGF1R to promote the progression of NAFLD.

Ethics approval and consent to participate

The animal experimental study is approved by the Experimental Animal Ethics Committee of Ningbo University (NBU20210020), all animal methods were carried out in accordance with relevant guidelines and regulations, and accordance with ARRIVE guidelines for the reporting of animal experiments.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by National Natural Science Foundation of China [No. 82270602], Ningbo Science and Technology Bureau | Natural Science Foundation of Ningbo [No. 2022J222] and Natural Science Foundation of Zhejiang Provincial [No. LQ18H160015].

Authors' contributions

Lei Xu and Xiaoyun Ding designed the study. Peifei Li and Siyi Yu participated the study concept, drafted the manuscript and statistical analysis.

Acknowledgements

Not applicable.

Fan JG, Wei L, Zhuang H. Guidelines of prevention and treatment of nonalcoholic fatty liver disease (2018, China). J Dig Dis. 2019; 20(4):163-173.
Gregersen N, Hansen J, Palmfeldt J. Mitochondrial proteomics--a tool for the study of metabolic disorders. Journal of inherited metabolic disease. 2012; 35(4): 715-726.
Singh S, Osna N A, Kharbanda K K. Treatment options for alcoholic and nonalcoholic fatty liver disease: A review. World J Gastroenterol. 2017;23(36): 6549-6570.
Younossi Z, Anstee QM, Marietti M, Hardy T, Henry L, Eslam M, George J, Bugianesi E. Global burden of NAFLD AND NASH: trends, predictions, risk factors and prevention. NAT Rev Gastroenterol Hepatol. 2018; 15(1):11-20.
Ertle J, Dechêne A, Sowa JP, Penndorf V, Herzer K, Kaiser G, Schlaak JF, Gerken G, Syn WK, Canbay A. Non-alcoholic fatty liver disease progresses to hepatocellular carcinoma in the absence of apparent cirrhosis. Int J Cancer. 2011;128(10): 2436-2443.
Fazel Y, Koenig AB, Sayiner M, Goodman ZD, Younossi ZM. Epidemiology and natural history of non-alcoholic fatty liver disease. Metabolism. 2016; 65(8):1017-1025.
Li Y, Zheng QP, Bao CY, Li SY, Guo WJ, Zhao J, Chen d, Gu JR, He XH, Huang SL. Circular RNA is enriched and stable in exosomes:a promising biomarker for cancer diagnosis. Cell res. 2015;25(8):981-984.
Du C, Shen L, Ma ZQ, Du J, Jin S. Bioinformatic Analysis of Crosstalk Between circRNA, miRNA, and Target Gene Network in NAFLD. Front Genet. 2021; 12:671523.
Guo XY, He CX, Wang YQ, Sun C, Li GM, Su Q, Pan Q, Fan JG. Circular RNA Profiling and Bioinformatic Modeling Identify Its Regulatory Role in Hepatic Steatosis. Biomed RES Int. 2017; 2017:5936171.
Guo XY, Chen JN, Sun F, Wang YQ, Pan Q, Fan JG. circRNA_0046367 Prevents Hepatoxicity of Lipid Peroxidation: An Inhibitory Role against Hepatic Steatosis. Oxid Med Cell Longev. 2017; 2017: 3960197.
Li P, Shan K, Liu Y, Zhang Y, Xu L, Xu L. CircScd1 Promotes Fatty Liver Disease via the Janus Kinase 2/Signal Transducer and Activator of Transcription 5 Pathway. Digestive Diseases and Sciences. 2019; 64(1):113-122.
Li J, Qi J, Tang YS, Liu HZ , Zhou KF , Dai ZR, Yuan LH, Sun CZ. A nanodrug system overexpressed circRNA_0001805 alleviates nonalcoholic fatty liver disease via miR-106a-5p/miR-320a and ABCA1/CPT1 axis. J Nanobiotechnology.2021;19(1):363.
Pérez-Matute P, López LP, Íñiguez M, Recio-Fernández E, Torrens R, Piñeiro-Hermida S, Alfaro-ArnedoE, Chau L, Walz C, Hoeflich A , Oteo JA, Pichel JG. IGF1R is a mediator of sex-specific metabolism in mice: Effects of age and high-fat diet.Front Endocrinol (Lausanne). 2022;13:1033208.
Yan CC, Zhao MM, Li S, Liu TJ, Xu TJ, Xu C, Liu L, Geng TY, Gong DQ. Increase of E3 ubiquitin ligase NEDD4 expression leads to degradation of its target proteins PTEN/IGF1R during the formation of goose fatty liver. J Anim Sci. 2020; 98(9):skaa270.
Xia T, Chen S, Jiang Z, Shao Y, Jiang X, Li P, Xiao B, Guo J (2015) Long noncoding RNA FER1L4 suppresses cancer cell growth by acting as a competing endogenous RNA and regulating PTEN expression. Sci Rep 5: 13445.
Shao Y, Ye M, Jiang X, Sun W, Ding X, Liu Z, Ye G, Zhang X, Xiao B, Guo J (2014) Gastric juice long noncoding RNA used as a tumor marker for screening gastric cancer. Cancer 120(21): 3320–3328.
De Alwis NM, Day CP. Nonalcoholic fatty liver disease: the mist gradually clears. J Hepatol. 2008;1:S104-S112.
Farrell GC, Wong VW, Chitturi S. NAFLD in Asis-as common and important as in the West. Nat Rev Gastroenterol Hepatol. 2013;10;307-318.
Wree A, Broderick L, Canbay A, et al. From NAFLD to NASH to cirrhosis-new insights into disease mechanisms. Nat Rev Gastroenterol Hepatol.2013;10:627-636.
Zeng QM, Liu CH, Wu DB, Jiang W, Zhang NN, Tang H. LncRNA and circRNA in Patients with Non-Alcoholic Fatty Liver Disease: A Systematic Review. Biomolecules. 2023;13(3):560.
Chen X, Tan QQ, Tan XR, Li SJ, Zhang XX. Circ_0057558 promotes nonalcoholic fatty liver disease by regulating ROCK1/AMPK signaling through targeting miR-206. Cell death dis. 2021;12(9):809.
Yepmo M, Potier JB, Pinget M, Grabarz A, Bouzakri K, Bourie AD. Discussing the role of circular RNA in the pathogenesis of non-alcoholic fatty liver disease and its complications . Front Endocrinol (Lausanne). 2022;13;1035159.

No competing interests reported.

actinandIGF1Rgels.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

CircDock6 promotes NAFLD by regulating IGF1R through targeting mmu-let-7 g-5p

Status:

Version 1

Abstract

Figures

Background

Methods

Mouse samples

Cell culture

Cell esterification modelling

qRT-PCR Analysis

Cell transfection

Oil red “O” staining

Triglyceride detection

Western blot analysis

Statistical analysis

Results

Successful modelling using OA-esterified AML-12 cells

CircDock6 was significantly upregulated in HFD tissues compared to SD tissues

Discussion

Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1