Glial cell line-derived neurotrophic factor (GDNF) is essential for colonization and expansion of turbot (Scophthalmus maximus) spermatogonia stem cells in recipient and in vitro culture

doi:10.21203/rs.3.rs-2876076/v1

Germ cell transplantation (GCT) is a promising biotechnology producing donor-derived gametes in surrogate recipients. It plays a critical role of protecting endangered species, propagation of elite species with desired traits as well as long-term preservation of genetic resources in combination with cryopreservation. However, GCT often fails because of the low colonization rate even complete loss of donor cells in recipients. Glial cell line-derived neurotrophic factor (GDNF) is necessary for self-renew of mammals spermatogonia stem cells (SSCs), and it also contributes to the proliferation of SSCs in vitro culture in some animals. In turbot (Scophthalmus maximus), we found that the expressions of gdnf and gfrα1a were predominantly observed in spermatogonia rather than somatic cells, which differed from their expression patterns in mammals. The efficiency of exogenous spermatogonia transplantation in Japanese flounder (Paralichthys olivaceus) larvae could be substantially enhanced by incubating donor cells from turbot with 100ng/ml GDNF prior to transplantation, resulting in a notable rise in colonization rate from 33%-50% to 61.5%. Besides, the addition of 20ng/ml GDNF in cell medium could also promote the proliferation of turbot SSCs in vitro. These results demonstrated the gdnf in turbot testis expression characteristics and suggested that addition of GNDF might be an effective way to improve the GCT efficiency and promote the SSCs expansion in vitro culture.

GDNF

Spermatogonia stem cells

Germ cell transplantation

Turbot

Germ cell transplantation (GCT) is a powerful tool for producing donor-derived gametes in a surrogate recipient. Germline stem cells, including primordial germ cells (PGCs), spermatogonia and oogonia, were transplanted into allogeneic or xenogeneic recipients as donor cells and eventually produced donor-derived sperm or eggs. In teleost, this technology was first successfully conducted on Salmonidae(Takeuchi et al., 2003, Takeuchi et al., 2004), and then extended to other species, including Cyprinid(Saito et al., 2008, Saito et al., 2010), Cichlidae(Lacerda et al., 2006, Lacerda et al., 2008), Acipenseridae(Ye et al., 2017, Saito et al., 2014, Pšenička et al., 2015), and Adrianichthyidae(Seki et al., 2017, Li et al., 2016). The genetic resources of endangered species as well as superior strains would be preserved by the combination of GCT and cryopreservation (Yoshikawa et al., 2018, Lee et al., 2016). In addition, GCT is also applicable to sex control without using exogenous sex steroids, which is of great importance in aquaculture for the commercial value of many fishes differs greatly between male and female(Okutsu et al., 2015). However, the inefficiency of transplantation, especially between species with far phylogenetic distance, is a main limitation for GCT to be used in practical application.

Spermatogonia retain the ability of self-renew and have multiple differentiation potential. It is easier to obtain a large amount of spermatogonia from immature or mature fish gonads in comparison with PGCs. So in recent years spermatogonia were usually used as donor cells, especially for marine fish GCT, including Sciaenidae(Yoshikawa et al., 2017, Higuchi et al., 2011), Scombridae(Bar et al., 2016, Yazawa et al., 2010) and Carangidae(Morita et al., 2012, Morita et al., 2015). Nevertheless, spermatogonia may lose their stemness and proliferation ability during the processes of isolation, transplantation and early development in the recipient, which can result in transplantation failure.

Increasing the number of donor cells by in vitro culture is also a potential method to ensure high success rate of transplantation. So far the culture of spermatogonia stem cells (SSCs) has been tried in some fish species, such as rainbow trout(Iwasaki-Takahashi et al., 2020), zebrafish(Sakai, 2006), sturgeon(Xie et al., 2019) and carp(Panda et al., 2011). However, it is exceedingly difficult to maintain the stemness of SSCs over long-term culture, so stable SSCs line has only been established in medaka (Hong et al., 2004).

Glial cell line-derived neurotrophic factor (GDNF) contributes greatly to the regulation of mammals spermatogonia self-renewal(Meng et al., 2000). It has been proved that in vivo overexpression of gdnf could lead to accumulation of undifferentiated spermatogonia(Meng et al., 2001), and GDNF was involved in the in vitro proliferation of mice testicular germ cells(Guan et al., 2006, Kanatsu-Shinohara et al., 2003). In fish, the homologs of gdnf and gfrα1a have been identified in dogfish(Bosseboeuf et al., 2014), rainbow trout(Nakajima et al., 2014) and medaka(Zhao et al., 2018). Addition of GDNF in culture medium could also promote the spermatogonia proliferation in medaka (Wei et al., 2017) and zebrafish(Kawasaki et al., 2012). However, the available reports of effects of GDNF on SSCs self-renew and expansion in fish are still limited.

Turbot (Scophthalmus maximus) and Japanese flounder (Paralichthys olivaceus) are important marine commercial fish species and both belong to Pleuronectiformes. In previous study, the germ cells of turbot were transplanted into triploid Japanese flounder and successfully obtained donor-derived spermatozoa and offspring, whereas the transplantation efficiency was extremely low(Zhou et al., 2021). In present study, we explored the effect of GDNF on the isolated turbot spermatogonia in vivo and in vitro. Firstly, we analyzed the gdnf and gfrα1a expression patterns in immature and mature testis and confirmed gdnf highly expressed in SSCs by in situ hybridization. Secondly, we incubated donor cells with GDNF, and found that GDNF significantly increase the exogenous spermatogonia colonization rate by fluorescence tracing and detected recipients that had donor-derived cells. Finally, the in vitro cell culture experiment further approved the addition of GDNF also promoted the survival and proliferation of SSCs.

Ethical statement

All experiments were performed in compliance with the relevant national and international guidelines and approved by the Institutional Animal Care and Use Committee, Institute of Oceanology, Chinese Academy of Sciences.

Fish and sample preparation

The fish mentioned in this study were obtained from Shenghang Sci-Tech Co., Ltd. (Weihai, Shandong province, China). The turbot and Japanese flounder broodstock were raised in 30m³ circular tanks with flowing seawater and fed with frozen fish. The method of preparing triploids Japanese flounder (used as recipients) and feeding was conducted as previously described(Zhou et al., 2021). Briefly, the triploids recipients were produced by cold-shocking of freshly fertilized eggs at 0-2℃ for 45 min. After the cold shock treatment, the eggs were gradually warmed to 15.0±0.5℃ and placed in a 1.7 m³ hatching tank.

The turbot was over anesthetized by 0.05% MS222 (Sigma-Aldrich, USA). Heart, muscle, liver, stomach, kidney, brain, gill, skin, gut, spleen, ovary and testis were isolated and stored at -80℃ for the subsequent RNA extraction.

Reverse transcription polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qPCR)

Total RNA was extracted from removed tissues mentioned above using the SPARKeasy Improved Tissue/Cell RNA Kit (Sparkjade, Shandong, China) consulting the manufacturer’s instructions. Then the RNA was used to synthesize cDNA with PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Tokyo, Japan). Gene expressions of turbot gdnf (smgdnf), gfrα1a (smgfrα1a), ret (smret) in different tissues of turbot were determined by reverse transcription polymerase chain reaction (RT-PCR), and the β-actin was used as positive control. The primer sequences were shown in Table 1.

Quantitative real-time PCR (qPCR) was conducted in 73000 Real-Time Fluorescence ration PCR instrument (Applied Biosystems, Foster City, USA). SYBR Green was used to compare the expression difference of smgdnf, smgfrα1a and smret in immature and mature turbot testes. The results were analyzed by comparative Ct method. Target gene relative expressions were normalized against both 18S and β-actin, using the formula ΔCt=[Ct(Gene)-(Ct(18s)+Ct(β-actin))/2]. The primers were same as primers used in RT-PCR.

In situ hybridization (ISH)

The RNA probes were synthesized by DIG RNA Labeling Kit (SP6/T7; Roche, Mannheim, Germany) using the primers shown in Table 1 and purified with SigmaSpin^tm Sequencing Reaction Clean-Up (Sigma-Aldrich). Testicular tissues from 2-year-old (mature), 12-month-old (immature), and 6-month-old (immature) turbot males were dissected and fixed with 4% paraformaldehyde (PFA) for 24h, then washed in 70% ethanol, dehydrated in an ascending ethanol series, embedded in paraffin wax and cut into 7μm thick sections. After being de-waxed, rehydrated and washed in PBST, the sections were re-fixed in 4% PFA in PBS and digested with proteinase K (10μg/ml; Sangon Biotech, Shanghai, China) for 10 min. Then they were hybridized with the probes at 65℃ for 14h and counterstained by neutral red.

Table 1. Primer sequences used in this study

Primer	Sequence	Purpose
SmvasS1	AGTTGGCTCAGTCCTTGG	Nested PCR
SmvasA1	GCTTGGAACACATTTATT
SmvasS2	ACACCTCGTTGTAGTTTT
SmvasA2	GAAGAAGTCAAGAGATTA
Smgdnf-F	CCAGGGGACGGAGGGAGCAGAGA	ISH
Smgdnf-R	CCGACAGCAGGTGCGAGAGGGC
Smgfrα1a-F	GGCAATAACAAGGACGAAT
Smgfrα1a-R	GCCGAGTCTCTCAGGATG
gdnf-F	CAGCCAGCCAAGAGAACTCA	RT-PCR;qPCR
gdnf-R	GAGACCGGCGACGTCATATT
gfrα1-F	GTTGTACTGCTCGTGTCCGA
gfrα1-R	CAGCTCCAGACAGTTGGGTT
ret-F	GCCGACGTTCTCAGACATCA
ret-R	GAGAGAGCGTCGTCGTACAG
actin-F^a	GTAGGTGATGAAGCCCAGAGCA
actin-R^a	CTGGGTCATCTTCTCCCTGT
GADPH-F^a	TCCAATGTTTGTCATGGGAGTT	qPCR
GADPH-R^a	CCAGAGGAGCCAGGCAGTT	qPCR

^areferring to previous primers(Wei and Li, 2011)

Immunofluorescence

To observe the distribution of spermatogonia stem cells (SSCs) in turbot testes from different developing stages, 7μm thick testicular sections of a 2-year-old individual, a 12-month-old individual, as well as a 9-month-old individual were analyzed by immunofluorescence. The nanos2 was used as a specific marker of SSCs(Bellaiche et al., 2014a). For immunofluorescence, the sections were de-waxed, rehydrated and washed in PBST twice. Following the antigen retrieval in Sodium Citrate Antigen Retrieval Solution (Solarbio, Beijing, China) at 95℃ for 45 min and 3 washes in PBST, the sections were permeabilized by 0.3% Triton X-100 (Solarbio) for 10 min. Subsequently, 5% normal goat serum was used to block the sections. After 30 min blocking, the sections were stained by Anti-NANOS2 rabbit polyclonal antibody (1:200 dilution with 5% normal goat serum; Sangon Biotech) at 4℃ overnight. After 5 washes with PBST, sections were incubated with Cy3-conjugated goat anti-rabbit IgG (1:500 dilution with 5% normal goat serum; Sangon Biotech) for 30 min in dark and rinsed with PBST 3 times. Then the nuclei were counterstained with DAPI (1:500 dilution with PBS; Sigma-Aldrich) for 10 min and washed with PBST 3 times. Fluorescence images were obtained through a fluorescent microscope (Nikon, Japan).

Donor cells preparation

About 9-12 months old turbot males were used as donors. Approximately 1g of testes were removed from donor turbot after over anesthetization and minced into 1mm³ pieces and dissociated at 25℃ for 2.5h by 2ml Leibovitz’s L-15 medium containing 40mg/ml Collagenase H (Roche, Switzerland), 33.3mg/ml Dispase II (Roche), 5% fetal bovine serum (FBS) (Gibco, USA) and 1% DNaseⅠ. The dissociation was ended by 10μl FBS. Subsequently, the cell suspension was filtered through a 42-μm pore nylon mesh to obtain a single-cell suspension. Then the suspension was added to the top of percoll(Sigma-Aldrich) system consisting of 45%, 35%, 25% and 10% gradient from bottom to top, and the whole system was centrifuged at 800g for 30 min at 4℃. Cells from the first band were harvested and labeled by fluorescent membrane dye PKH26 (Sigma-Aldrich) for 5min. After staining, cells were rinsed twice with 2ml L-15 medium and resuspended by 200μl L-15 medium containing 1%FBS. Then the nuclei of 20μl PKH26-labeled cells was counterstained with 300nM DAPI to confirm the markers of PKH26 were positive cells. Fluorescence images were obtained through a fluorescent microscope (Nikon). Subsequently, labeled cells were equally divided into 4 parts and incubated with 0ng/ml, 10ng/ml, 50ng/ml and 100ng/ml recombinant human glial derived neurotrophic factor (GDNF) for 7h at room temperature, respectively. The blood count chamber was used to estimate the total number of cells and cells were diluted to 1×10⁶ cells/mL and kept at 4℃ until transplantation.

Transplantation of donor cells

About 19-22 days post hatching (dph; the length about 4-5mm) triploid Japanese flounder larvae were used as recipients considering the survival rate after transplantation. Donor cells with 0, 10, 50 and 100ng/ml GDNF incubation were transplanted into recipients from group A, B, C and D, respectively. Every group owned over 500 recipients, as shown in Table 2. The transplantation was conducted as previously described(Zhou et al., 2021). Non-transplanted triploid larvae were raised in the same condition as control group.

Observation and detection of donor-derived cells in recipients

To determine the existence and incorporation of PKH26-labled cells in recipient gonads, 10 recipients were randomly selected, and their abdomens were observed under the fluorescent microscope (Nikon) at 3, 7, 15, and 20 days post-transplantation (dpt), and the colonization rate of donor cells was recorded. At 50 dpt, 5 individuals were selected randomly from transplantation group and control group respectively and their gonads were exposed by tearing the skin of abdomen. After washed with PBS containing 1% penicillin-streptomycin, the distribution of donor-derived cells was observed with the fluorescent microscope (Nikon).

At 50 dpt, 12 recipients were selected from group B and C, and 13 recipients were selected form group D. Their gonads were removed and stored in -196℃ liquid nitrogen, then the genomic DNA was extracted from the cryopreserved tissue. Nested PCR was performed using turbot species-specific primers designed from turbot vasa 3’ untranslated region to detect donor DNA in recipients, as shown in Table 1. Finally, the PCR production was detected by 1% agarose gel electrophoreses.

In vitro cell culture of donor cells

The method of isolating testicular cells from 1-year-old turbot testis was described above. After density gradient centrifugation, cells from first band were harvested and transferred to 96-well plates in basal medium which was Leibovitz’s L-15 medium with 20% FBS, 10 ng/ml epidermal growth factor (EGF)(Peprotech, USA) and 10ng/ml basal fibroblast growth factor (bFGF)(Peprotech) at 25 ℃. Half culture medium was replaced every three days. After 60 days being cultured in basal medium, half cells were transferred into new medium that was basal medium with 20 ng/ml GDNF while the rest of cells were still cultured in previous medium. The cells were monitored and captured periodically with a microscope.

Statistical analyses

All the data are presented as mean±SE and were evaluated by one-way analysis of variance followed by Tukey’s test. Differences were considered significant at P<0.05.

The expression of smgdnf, smgfrα1a and smret in turbot testes

RT-PCR was conducted to explore the expression of smgdnf, smgfrα1a and smret in specific tissues of mature turbot. The result showed that these three genes obviously expressed in testis and brain and the expressions were all stronger in testis than in brain (Fig. 1a). Then the qPCR was performed to analyze the expression level of the three genes in both immature and mature testes. In adult testes, smgfrα1a expressed significantly higher than in juvenile testes, while smgdnf expression was lower. Meanwhile, the expression level of smret was similar in both adult and juvenile (Fig. 1b).

The localization of smgdnf and smgfrα1a in turbot testes during the gonadal development process was analyzed by ISH. The results showed that the signals mainly presented in the cytoplasm of cells, and the spermatogonia had the strongest smgdnf signal, whereas the signals were weaker in the spermatocyte and spermatid (Fig. 2a-c). No signal was detected in the somatic cells (Fig. 2d-f). Smgfrα1a exhibited strong signals in spermatogonia, predominantly localizing at the cellular periphery and diminished in spermatocytes, while no signal was observed in somatic cells (Fig. 2g, h). This expression pattern paralleled that of smgdnf.

Donor cells preparation before transplantation

Immunofluorescence staining results showed that fluorescence signals mainly distributed at the edge of testes from different developing stages, and the intensity of fluorescence signals gradually decreased from edge to center (Fig. 3a, d, g). In all three stages, 9-month-old testes exhibited highest fluorescence intensity (Fig. 3a, d, g) and had the largest proportion of SSCs at the same magnification followed by 12-month-old and mature testes (Fig. 3c, f, i). In short, SSCs mainly distributed at the edge of turbot testis, and the proportion of SSCs in testes decreased with gonadal development.

About 9-12 months old turbots were chosen as donors. Various types of testis cells were separated into different bands after density gradient centrifugation (Fig. 3j). About 50% cells from first band were spermatogonia of type A and B (Fig. 3k) and were stained with PKH26(Fig. 3l, m). Donor cells were traced easily in recipients with their bright red fluorescence.

Migration and colonization of donor cells in recipients

The migration of donor cells in group D (with donor cells incubated by 100ng/ml GDNF) is shown in Figure 4. The PKH26-labled cells still presented in the peritoneal cavity of recipients at 3 dpt (Fig. 4a-c) and migrated to the genital ridge at 7 dpt(Fig. 4 d-f). At 15 dpt, a noticeable decrease of the donor-derived cells was observed in the peritoneal cavity of recipients, while the number of fluorescent cells at the genital ridge increased and lined (Fig. 4g-i). At 20 dpt, the clusters of donor-derived cells occurred in the primary gonads of recipients (Fig. 4k, l). At 50 dpt, it could be observed that the donor-derived cells were randomly distributed in the recipient gonad (Fig. 4p-r), while the control still showed no fluorescence (Fig. 4m-o). Other three groups showed the similar results with group D.

Although the survival and colonization rate of all four groups gradually decreased with the development of recipients, the groups with GDNF incubation consistently exhibited higher survival and colonization rate compared to the group A, especially those with higher concentration of GDNF (Table 2). Then the results of nested PCR showed that the turbot DNA existed in only 3 out of 12 recipient gonads from group B and C (Fig. 5a), while 8 out of 13 recipients from group D contained donor species-specific DNA (Fig. 5b).

Table 2. The survival of recipients and colonization rates of transplanted donor cells after transplantation

Days post transplantation	Group^a	No. survived/ survival rate（%）	No. observed/colonized	Colonization rate (%)
1	A	594/ 100%	10/10	100%
	B	583/ 100%	10/10	100%
	C	601/ 100%	10/10	100%
	D	597/ 100%	10/10	100%
7	A	237/ 39.90%	10/3	30%
	B	264/ 45.28%	10/6	60%
	C	241/ 40.10%	10/3	30%
	D	253/ 42.38%	10/10	100%
15	A	133/ 22.39%	10/3	30%
	B	154/ 26.42%	10/3	30%
	C	180/ 29.95%	10/4	40%
	D	171/ 28.64%	10/7	70%
30	A	0/0	0/0	0/0
	B	9/ 1.54%	3/1	33%
	C	33/ 5.49%	10/6	60%
	D	30/ 5.03%	10/7	70%

^aRecipients receiving donor cells incubated with 0, 10, 50 and 100 ng/ml GDNF were divided into group A, B, C and D, respectively.

The effect of GDNF on SSCs proliferation

SSCs were round and always remained suspended in the basal culture medium, while somatic cells quickly adhered to the surface and exhibited a fibroblast-like morphology. Testicular cells stayed alive and suspended in basal medium for 2 months, but no evident proliferation of SSCs was observed. However, there was a significant increase in the number of somatic cells (Fig. 6a, b). After being transferred into new medium that contained 20ng/ml GDNF, the germ cells showed obvious proliferation (Fig. 6d-f), while the rest cells that persistently cultured in basal medium all died 30 days later（Fig. 6c）.

In this study, we assessed the effects of GDNF on isolated turbot spermatogonia cells in vivo and in vitro. We found that GDNF dramatically promoted turbot donor cells to survive and colonize in triploid Japanese flounder recipients. Moreover, the addition of GDNF in vitro SSCs culture can also enhance cell proliferation.

Gdnf-Gfrα1 pathway is known for its indispensable role in regulating SSCs self-renewal in mammals(Meng et al., 2000, Kubota et al., 2004). In mice, it is considered that GDNF is produced by different testicular somatic cells, including sertoli cells, testicular endothelial cells(Chen et al., 2016, Bhang et al., 2018) and peritubular myoid cells(Chen et al., 2016). As for gfrα1a, it only expresses in spermatogonial cells and usually used in cell sorting(Di Persio et al., 2017, Giassetti et al., 2019, Sharma and Braun, 2018, Kim and Kim, 2018). In this study, we found the expression patterns of smgdnf and smgfrα1a were significantly different from those reported in mammals. Both smgdnf and smgfrα1a transcripts were mainly expressed in germ cells, and the expression level gradually decreased as the spermatogonia started differentiating. Meanwhile, no expression of smgdnf was found in somatic cells. Likewise, gdnf and gfrα1 were co-expressed in type A spermatogonia and the expression levels synchronously decreased during the spermatogenesis in rainbow trout testis(Bellaiche et al., 2014b). Similar expression pattern was also found in dogfish (Scyliorhinus canicula)(Bosseboeuf et al., 2014), medaka(Oryzias latipes) (Zhao et al., 2018) and zebrafish(Doretto et al., 2022). These results suggest that GDNF most likely acts as an autocrine factor in fish testes, and the variation of gdnf/gfrα1a expression in different germ cells reveals that Gndf-Gfrα1a signaling pathway is mainly regulated SSC proliferation rather than meiosis.

Low efficiency is limitation for GCT to be wildly used in actual production. In the GCT between blue drum (Nibea mitsukurii) and sterile hybrid recipients, only 10% recipients could produce donor origin sperm(Xu et al., 2019). Although two successful inter-family GCTs, Chinese rare minnow (gobiocypris rarus) to zebrafish, turbot to Japanese flounder, have been reported, the colonization rates were only 22.2%-33.3% and 33%-50%, respectively (Zhou et al., 2021, Zhang et al., 2022). One reason for the low efficiency of GCT is that the donor cells are prone to lose the ability of proliferation during the process of isolation and transplantation. On the other hand, it is challenging for donor cells to proliferate in remote recipients due to the incompatible gonadal microenvironments among fish(Ryu et al., 2022). In our study, we incubated SGs with GDNF before transplantation. The results showed that although the incubation of different GDNF concentrations to donor cells had no significant effect on their migration and colonization pattern in recipients, 100ng/ml GDNF did increase the colonization rates from 33%-50% (Zhou et al., 2021)to 61.5%, suggesting that GDNF could promoted donor cells proliferation in recipiernts. Furthermore, the incubation solution was co-injected with donor cells, which might help to create a recipient gonadal microenvironment that was more suitable for donor cells to survive and proliferate.

The efficiency of transplantation depends mostly on the number and stemness of donor cells (Ryu et al., 2022). Therefore, how to obtain enough highly purified SSCs is an incredibly important issue. In mammals, it has been proved that the addition of GDNF to in vitro culture system enhanced the spermatogonia proliferation(Kanatsu-Shinohara et al., 2005, Ryu et al., 2005, Kanatsu-Shinohara et al., 2008, Kubota et al., 2011, Aponte et al., 2006, Oatley et al., 2004). In this study, we found that adding GDNF to medium was an effective method to maintain SSCs proliferative vitality, while the cells cultured in basal medium without GDNF all died after one month. Similar results have also been reported in other fish cell cultures. For example, in carp and dogfish, recombinant human GDNF was observed to promote the development of clones of spermatogonia, maintain their self-renewal and decrease cell apoptosis(Panda et al., 2011, Gautier et al., 2014). In zebrafish, GDNF also enhanced the spermatogonia proliferation in vitro culture, which was in a similar manner to mammalian in vitro culture system (Kawasaki et al., 2012).

All the above results of in vivo and in vitro experiments demonstrate that GDNF can promote SSCs proliferation, and this function is conserved in mammals and fish although different expression characteristics occur in different species testes. Our study established a promising method to improve the efficiency of GCT, especially for fish with far phylogenetic distance. Besides, the results of in vitro culture provide a reference for the establishment of turbot SSCs lines.

Data Availability

All data generated or analyzed during this study are included in this article.

Author contributions statement

Xueying Wang and Li Zhou designed the study. Lei Duan, Shuran Du and Li Zhou performed the experiments. Lei Duan wrote the manuscript, and Qinghua Liu and Jun Li revised the manuscript.

Funding

This work was supported by the Shandong Province Natural Science Foundation (ZR2020KC038), Research and Development Program of Shandong Province (2021LZGC029), National Key Research and Development Program (2018YFD0901205, 2018YFD0901204), China Agriculture Research System (CARS-47).

Competing Interest

The authors have declared that no competing interest exists.

Aponte, P.M., Soda, T., Van De Kant, H.J.G. & De Rooij, D.G. (2006). Basic features of bovine spermatogonial culture and effects of glial cell line-derived neurotrophic factor. Theriogenology, 65: 1828-1847. DOI 10.1016/j.theriogenology.2005.10.020
Bar, I., Smith, A., Bubner, E., Yoshizaki, G., Takeuchi, Y., Yazawa, R., Chen, B., Cummins, S. & Elizur, A. (2016). Assessment of yellowtail kingfish (Seriola lalandi) as a surrogate host for the production of southern bluefin tuna (Thunnus maccoyii) seed via spermatogonial germ cell transplantation. Reprod Fert Develop, 28: 2051-2064. DOI 10.1071/Rd15136
Bellaiche, J., Lareyre, J.-J., Cauty, C., Yano, A., Allemand, I. & Le Gac, F. (2014a). Spermatogonial Stem Cell Quest: nanos2, Marker of a Subpopulation of Undifferentiated A Spermatogonia in Trout Testis. Biol Reprod, 90. DOI 10.1095/biolreprod.113.116392
Bellaiche, J., Lareyre, J.J., Cauty, C., Yano, A., Allemand, I. & Le Gac, F. (2014b). Spermatogonial stem cell quest: nanos2, marker of a subpopulation of undifferentiated A spermatogonia in trout testis. Biol Reprod, 90: 79. DOI 10.1095/biolreprod.113.116392
Bhang, D.H., Kim, B.J., Kim, B.G., Schadler, K., Baek, K.H., Kim, Y.H., Hsiao, W., Ding, B.S., Rafii, S., Weiss, M.J., Chou, S.T., Kolon, T.F., Ginsberg, J.P., Ryu, B.Y. & Ryeom, S. (2018). Testicular endothelial cells are a critical population in the germline stem cell niche. Nature communications, 9: 4379. DOI 10.1038/s41467-018-06881-z
Bosseboeuf, A., Gautier, A., Auvray, P., Mazan, S. & Sourdaine, P. (2014). Characterization of spermatogonial markers in the mature testis of the dogfish (Scyliorhinus canicula L.). Reproduction, 147: 125-139. DOI 10.1530/rep-13-0316
Chen, L.-Y., Willis, W.D. & Eddy, E.M.J.P.O.T.N.a.O.S. (2016). Targeting the Gdnf Gene in peritubular myoid cells disrupts undifferentiated spermatogonial cell development. 113: 1829-1834.
Di Persio, S., Saracino, R., Fera, S., Muciaccia, B., Esposito, V., Boitani, C., Berloco, B.P., Nudo, F., Spadetta, G., Stefanini, M., De Rooij, D.G. & Vicini, E. (2017). Spermatogonial kinetics in humans. Development, 144: 3430-3439. DOI 10.1242/dev.150284
Doretto, L.B., Butzge, A.J., Nakajima, R.T., Martinez, E.R.M., De Souza, B.M., Rodrigues, M.D., Rosa, I.F., Ricci, J.M.B., Tovo-Neto, A., Costa, D.F., Malafaia, G., Shao, C.W. & Nobrega, R.H. (2022). Gdnf Acts as a Germ Cell-Derived Growth Factor and Regulates the Zebrafish Germ Stem Cell Niche in Autocrine- and Paracrine-Dependent Manners. Cells, 11. DOI 10.3390/cells11081295
Gautier, A., Bosseboeuf, A., Auvray, P. & Sourdaine, P. (2014). Maintenance of Potential Spermatogonial Stem Cells In Vitro by GDNF Treatment in a Chondrichthyan Model (Scyliorhinus canicula L.). Biol Reprod, 91. DOI 10.1095/biolreprod.113.116020
Giassetti, M.I., Ciccarelli, M. & Oatley, J.M. (2019). Spermatogonial Stem Cell Transplantation: Insights and Outlook for Domestic Animals. IN Lewin, H.A. & Roberts, R.M. (Eds.) Annual Review of Animal Biosciences, Vol 7.
Guan, K., Nayernia, K., Maier, L.S., Wagner, S., Dressel, R., Lee, J.H., Nolte, J., Wolf, F., Li, M., Engel, W. & Hasenfuss, G. (2006). Pluripotency of spermatogonial stem cells from adult mouse testis. Nature, 440: 1199-203. DOI 10.1038/nature04697
Higuchi, K., Takeuchi, Y., Miwa, M., Yamamoto, Y., Tsunemoto, K. & Yoshizaki, G.J.F.S. (2011). Colonization, proliferation, and survival of intraperitoneally transplanted yellowtail Seriola quinqueradiata spermatogonia in nibe croaker Nibea mitsukurii recipient. 77: 69-77.
Hong, Y., Liu, T., Zhao, H., Xu, H., Wang, W., Liu, R., Chen, T., Deng, J. & Gui, J.J.P.O.T.N.a.O.S. (2004). Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro. 101: 8011-8016.
Iwasaki-Takahashi, Y., Shikina, S., Watanabe, M., Banba, A., Yagisawa, M., Takahashi, K., Fujihara, R., Okabe, T., Valdez Jr, D.M. & Yamauchi, A.J.C.B. (2020). Production of functional eggs and sperm from in vitro-expanded type A spermatogonia in rainbow trout. 3: 308.
Kanatsu-Shinohara, M., Miki, H., Inoue, K., Ogonuki, N., Toyokuni, S., Ogura, A. & Shinohara, T.J.B.O.R. (2005). Long-term culture of mouse male germline stem cells under serum-or feeder-free conditions. 72: 985-991.
Kanatsu-Shinohara, M., Muneto, T., Lee, J., Takenaka, M., Chuma, S., Nakatsuji, N., Horiuchi, T. & Shinohara, T.J.B.O.R. (2008). Long-term culture of male germline stem cells from hamster testes. 78: 611-617.
Kanatsu-Shinohara, M., Ogonuki, N., Inoue, K., Miki, H., Ogura, A., Toyokuni, S. & Shinohara, T. (2003). Long-term proliferation in culture and germline transmission of mouse male germline stem cells. Biol Reprod, 69: 612-6. DOI 10.1095/biolreprod.103.017012
Kawasaki, T., Saito, K., Sakai, C., Shinya, M. & Sakai, N. (2012). Production of zebrafish offspring from cultured spermatogonial stem cells. Genes To Cells, 17: 316-325. DOI 10.1111/j.1365-2443.2012.01589.x
Kim, M. & Kim, D.J. (2018). GFRA1: A Novel Molecular Target for the Prevention of Osteosarcoma Chemoresistance. International Journal of Molecular Sciences, 19. DOI 10.3390/ijms19041078
Kubota, H., Avarbock, M.R. & Brinster, R.L.J.P.O.T.N.a.O.S. (2004). Growth factors essential for self-renewal and expansion of mouse spermatogonial stem cells. 101: 16489-16494.
Kubota, H., Wu, X., Goodyear, S.M., Avarbock, M.R. & Brinster, R.L.J.T.F.J. (2011). Glial cell line-derived neurotrophic factor and endothelial cells promote self-renewal of rabbit germ cells with spermatogonial stem cell properties. 25: 2604.
Lacerda, S., Batlouni, S., Silva, S., Homem, C. & França, L.J.a.R. (2006). Germ cells transplantation in fish: the Nile-tilapia model. 3: 146-159.
Lacerda, S., Batlouni, S.R., Assis, L.H., Resende, F.M., Campos-Silva, S.M., Campos-Silva, R., Segatelli, T.M. & Franca, L.R.J.C. (2008). Germ cell transplantation in tilapia (Oreochromis niloticus). 32: 115-118.
Lee, S., Iwasaki, Y. & Yoshizaki, G. (2016). Long-term (5 years) cryopreserved spermatogonia have high capacity to generate functional gametes via interspecies transplantation in salmonids. Cryobiology, 73: 286-90. DOI 10.1016/j.cryobiol.2016.08.001
Li, M., Hong, N., Xu, H., Song, J. & Hong, Y.J.S.R. (2016). Germline replacement by blastula cell transplantation in the fish medaka. 6: 1-10.
Meng, X., De Rooij, D.G., Westerdahl, K., Saarma, M. & Sariola, H. (2001). Promotion of seminomatous tumors by targeted overexpression of glial cell line-derived neurotrophic factor in mouse testis. Cancer research, 61: 3267-71.
Meng, X., Lindahl, M., Hyvonen, M.E., Parvinen, M., De Rooij, D.G., Hess, M.W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H. & Lakso, M.J.S. (2000). Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. 287: 1489-1493.
Morita, T., Kumakura, N., Morishima, K., Mitsuboshi, T., Ishida, M., Hara, T., Kudo, S., Miwa, M., Ihara, S., Higuchi, K., Takeuchi, Y. & Yoshizaki, G. (2012). Production of Donor-Derived Offspring by Allogeneic Transplantation of Spermatogonia in the Yellowtail (Seriola quinqueradiata). Biol Reprod, 86. DOI ARTN 176/biolreprod.111.097873
Morita, T., Morishima, K., Miwa, M., Kumakura, N., Kudo, S., Ichida, K., Mitsuboshi, T., Takeuchi, Y. & Yoshizaki, G. (2015). Functional Sperm of the Yellowtail (Seriola quinqueradiata) Were Produced in the Small-Bodied Surrogate, Jack Mackerel (Trachurus japonicus). Mar Biotechnol, 17: 644-654. DOI 10.1007/s10126-015-9657-5
Nakajima, S., Hayashi, M., Kouguchi, T., Yamaguchi, K., Miwa, M. & Yoshizaki, G. (2014). Expression patterns of gdnf and gfralpha1 in rainbow trout testis. Gene Expr Patterns, 14: 111-20. DOI 10.1016/j.gep.2014.01.006
Oatley, J.M., Reeves, J.J. & Mclean, D.J. (2004). Biological activity of cryopreserved bovine spermatogonial stem cells during in vitro culture. Biol Reprod, 71: 942-947. DOI 10.1095/biolreprod.104.028894
Okutsu, T., Shikina, S., Sakamoto, T., Mochizuki, M. & Yoshizaki, G.J.A. (2015). Successful production of functional Y eggs derived from spermatogonia transplanted into female recipients and subsequent production of YY supermales in rainbow trout, Oncorhynchus mykiss. 446: 298-302.
Panda, R.P., Barman, H.K. & Mohapatra, C. (2011). Isolation of enriched carp spermatogonial stem cells from Labeo rohita testis for in vitro propagation. Theriogenology, 76: 241-251. DOI 10.1016/j.theriogenology.2011.01.031
Pšenička, M., Saito, T., Linhartová, Z. & Gazo, I.J.T. (2015). Isolation and transplantation of sturgeon early-stage germ cells. 83: 1085-1092.
Ryu, B.-Y., Kubota, H., Avarbock, M.R. & Brinster, R.L.J.P.O.T.N.a.O.S. (2005). Conservation of spermatogonial stem cell self-renewal signaling between mouse and rat. 102: 14302-14307.
Ryu, J.H., Xu, L. & Wong, T.T. (2022). Advantages, Factors, Obstacles, Potential Solutions, and Recent Advances of Fish Germ Cell Transplantation for Aquaculture-A Practical Review. Animals (Basel), 12. DOI 10.3390/ani12040423
Saito, T., Goto-Kazeto, R., Arai, K. & Yamaha, E. (2008). Xenogenesis in teleost fish through generation of germ-line chimeras by single primordial germ cell transplantation. Biol Reprod, 78: 159-166. DOI 10.1095/biolreprod.107.060038
Saito, T., Goto-Kazeto, R., Fujimoto, T., Kawakami, Y., Arai, K. & Yamaha, E. (2010). Inter-species transplantation and migration of primordial germ cells in cyprinid fish. Int J Dev Biol, 54: 1481-1486. DOI 10.1387/ijdb.103111ts
Saito, T., Pšenička, M., Goto, R., Adachi, S., Inoue, K., Arai, K. & Yamaha, E.J.P.O. (2014). The origin and migration of primordial germ cells in sturgeons. 9: e86861.
Sakai, N.J.M. (2006). In vitro male germ cell cultures of zebrafish. 39: 239-245.
Seki, S., Kusano, K., Lee, S., Iwasaki, Y., Yagisawa, M., Ishida, M., Hiratsuka, T., Sasado, T., Naruse, K. & Yoshizaki, G.J.S.R. (2017). Production of the medaka derived from vitrified whole testes by germ cell transplantation. 7: 43185.
Sharma, M. & Braun, R.E. (2018). Cyclical expression of GDNF is required for spermatogonial stem cell homeostasis. Development, 145. DOI 10.1242/dev.151555
Takeuchi, Y., Yoshizaki, G. & Takeuchi, T. (2003). Generation of live fry from intraperitoneally transplanted primordial germ cells in rainbow trout. Biol Reprod, 69: 1142-1149. DOI 10.1095/biolreprod.103.017624
Takeuchi, Y., Yoshizaki, G. & Takeuchi, T. (2004). Biotechnology: surrogate broodstock produces salmonids. Nature, 430: 629-30. DOI 10.1038/430629a
Wei, D. & Li, S. (2011). Determination of internal controls for quantitative real time RT-PCR analysis of the effect of Edwardsiella tarda infection on gene expression in turbot (Scophthalmus maximus). Fish & Shellfish Immunology, 30: 720-728. DOI 10.1016/j.fsi.2010.12.028
Wei, J., Liu, L., Fan, Z., Hong, Y., Zhao, Y., Zhou, L. & Wang, D. (2017). Identification, Prokaryote Expression of Medaka gdnfa/b and Their Biological Activity in a Spermatogonial Cell Line. Stem cells and development, 26: 197-205. DOI 10.1089/scd.2016.0248
Xie, X., Li, P., Psenicka, M., Ye, H., Steinbach, C., Li, C.J. & Wei, Q.W. (2019). Optimization of In Vitro Culture Conditions of Sturgeon Germ Cells for Purpose of Surrogate Production. Animals, 9. DOI 10.3390/ani9030106
Xu, D., Yoshino, T., Konishi, J., Yoshikawa, H., Ino, Y., Yazawa, R., Dos Santos Nassif Lacerda, S.M., De Franca, L.R. & Takeuchi, Y. (2019). Germ cell-less hybrid fish: ideal recipient for spermatogonial transplantation for the rapid production of donor-derived sperm. Biol Reprod, 101: 492-500. DOI 10.1093/biolre/ioz045
Yazawa, R., Takeuchi, Y., Higuchi, K., Yatabe, T., Kabeya, N. & Yoshizaki, G. (2010). Chub Mackerel Gonads Support Colonization, Survival, and Proliferation of Intraperitoneally Transplanted Xenogenic Germ Cells. Biol Reprod, 82: 896-904. DOI 10.1095/biolreprod.109.081281
Ye, H., Li, C.-J., Yue, H.-M., Du, H., Yang, X.-G., Yoshino, T., Hayashida, T., Takeuchi, Y. & Wei, Q.-W.J.T. (2017). Establishment of intraperitoneal germ cell transplantation for critically endangered Chinese sturgeon Acipenser sinensis. 94: 37-47.
Yoshikawa, H., Ino, Y., Shigenaga, K., Katayama, T., Kuroyanagi, M. & Yoshiura, Y.J.A. (2018). Production of tiger puffer Takifugu rubripes from cryopreserved testicular germ cells using surrogate broodstock technology. 493: 302-313.
Yoshikawa, H., Takeuchi, Y., Ino, Y., Wang, J., Iwata, G., Kabeya, N., Yazawa, R. & Yoshizaki, G.J.A. (2017). Efficient production of donor-derived gametes from triploid recipients following intra-peritoneal germ cell transplantation into a marine teleost, Nibe croaker (Nibea mitsukurii). 478: 35-47.
Zhang, F.H., Hao, Y.K., Li, X.M., Li, Y., Ye, D., Zhang, R., Wang, X.S., He, M.D., Wang, H.P., Zhu, Z.Y. & Sun, Y.H. (2022). Surrogate production of genome-edited sperm from a different subfamily by spermatogonial stem cell transplantation. Sci China Life Sci, 65: 969-987. DOI 10.1007/s11427-021-1989-9
Zhao, Y., Yang, Z., Wang, Y., Luo, Y., Da, F., Tao, W., Zhou, L., Wang, D. & Wei, J. (2018). Both Gfrα1a and Gfrα1b Are Involved in the Self-renewal and Maintenance of Spermatogonial Stem Cells in Medaka. Stem cells and development. DOI 10.1089/scd.2018.0177
Zhou, L., Wang, X.Y., Liu, Q.H., Yang, J.K., Xu, S.H., Wu, Z.H., Wang, Y.F., You, F., Song, Z.C. & Li, J. (2021). Successful Spermatogonial Stem Cells Transplantation within Pleuronectiformes: First Breakthrough at inter-family Level in Marine Fish. Int J Biol Sci, 17: 4426-4441. DOI 10.7150/ijbs.63266

No competing interests reported.

Glial cell line-derived neurotrophic factor (GDNF) is essential for colonization and expansion of turbot (Scophthalmus maximus) spermatogonia stem cells in recipient and in vitro culture

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Declarations

References

Additional Declarations

Status:

Version 1