Derivation of fibroblasts
Dermal fibroblasts were isolated and cultured using a previously described protocol10. In brief, 1 mm3 skin biopsies obtained from the patients were washed with phosphate-buffered saline (PBS) (HyClone) and incubated overnight at 37˚C/5% CO2 in a 15 mL conical flask with 1 mL of a skin biopsy digestion medium containing DMEM with 20% FBS, 0.25% collagenase type I (Thermo Fisher Scientific, 0.05% DNAse I (Merck, and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin). The tube was briefly vortexed the next day, and 7 mL of DMEM containing 20% FBS was added. The dissociated cells were then plated in a T25 culture flask and incubated for 3 days at 37˚C/5% CO2. The medium was replaced on the fourth day with DMEM containing 10% FBS and antibiotics. The cells were cultured with a media change on alternate days until they reached approximately 80% confluency. Cells were then passaged at a 1:4 ratio using 0.05% trypsin–EDTA (Thermo Fisher Scientific). After two passages, the cells were cryopreserved.
Next-generation sequencing
DNA extracted from blood was used to perform targeted gene capture using a custom capture kit. The libraries were sequenced to mean > 80-100X coverage on the Illumina sequencing platform. The sequences obtained were aligned to human reference genome (GRCh37/hg19) using BWA program11,12 and analyzed using Picard and GATK version 3.6 to identify variants relevant to the clinical indication13. Gene annotation of the variants was performed using VP program against the Ensembl release 87 human gene model14. Clinically relevant mutations were annotated using published variants in literature and a set of diseases databases- ClinVar, OMIM, GWAS, HGMD and SwissVar15–17. Common variants re filtered based on allele frequency in 1000 Genome Phase 3, ExAC, EVS, dbNP147, 1000 Japanese Genome and Indian population database18,19. Non-synonymous variants effect was calculated using multiple algorithms such as PolyPhen-2, SIFT, MutationTaster2, Mutation Assessor, and LRT. Only non-synonymous and splice site variants found in the clinical exome panel comprising 6763 genes were used for clinical interpretation. Silent variations that do not result in any change in the amino acid coding region were not included.
Bioinformatics analysis for variant interpretation
Variant description: A heterozygous 2 base pair deletion in exon 2 of the RPS19 gene (chr19:12364865_42364866delAG; Depth: 46x) that results in a frameshift and premature truncation of the protein 42 amino acids downstream: to codon 8 (p.Asp8Arg(sTer42; ENST00000598742) was detected. This RPS19 variant has not been reported in the 1200 genomes EXAC and Indian databases. The reference region is conserved across species. OMIM phenotype: Diamond Blackfan anemia-1 (OBA) (OMIM#105650) is caused by heterozygous mutations in the RPS19 gene (OMIM*603474).
Generation of iPSCs
Dermal fibroblasts from the DBA patient and a normal control fibroblast were cultured in DMEM (Thermo Fisher Scientific) supplemented with 10% FBS (Thermo Fisher Scientific). At passage 2 (P2), the fibroblasts were dissociated with trypsin-EDTA 0.05% (Thermo Fisher Scientific), and 0.5 x 106 cells were electroporated with 1µg each of pCXLE-hOCT3/4-shp53-F (Addgene id:27077), pCXLE-hUL (Addgene id: 27080) and pCXLE-hSK (Addgene id: 27078) episomal vectors using Neon nucleofector (Thermo Fisher Scientific). The electroporated fibroblasts were cultured for 7 days in DMEM + 10% FBS until they reached ~ 90% confluence and then were transferred to Matrigel (Corning) coated cell culture dishes with TeSR-E7/ReproTESR medium (Stem Cell Technologies). The colonies were isolated based on morphology between 25 to 28 days after nucleofection, mechanically broken into small clumps, and seeded on vitronectin-coated dishes in E8 medium (Thermo Fisher Scientific). The clones were passaged at 60–70% confluence (4–5 days) by treatment with 0.5mM EDTA (Thermo Fisher Scientific) for 3 min in a 5% CO2 incubator. The passaged cells were maintained in the E8 medium. The iPSC clones were cultured for 15 passages before their characterization.
Immunofluorescence analysis
To assess pluripotency, the iPSC colonies were fixed with 4% paraformaldehyde for 15 min, followed by permeabilization with 0.1% TritonX-100 (Sigma) in phosphate buffer saline (PBS) for 15 min and blocking in blocking buffer (1% bovine serum albumin (BSA) + 5% Fetal bovine serum (FBS) in PBS) for 20 min at room temperature. The cells were incubated with primary antibodies (Table 1) in the blocking buffer overnight (16 hours) at 4°C, followed by incubation with suitable labeled secondary antibodies for 2 hours at room temperature. For nuclear staining, the cells were incubated with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min at room temperature and visualized under a fluorescence microscope (DS6000, Leica Microsystems) with appropriate filters.
Table 1
Antibodies used for immunofluorescence (IF) and flow cytometry.
| Purpose | Antibody | The company and Cat no. |
| Analysis of pluripotency by immunofluorescence | Anti-TRA-I-81 | StemLight Pluripotency AntibodyKit 9656S |
| Anti-SSEA-4 |
| Anti-NANOG |
| Anti-OCT-4 |
| Analysis of pluripotency by flow cytometry | Anti-TRA-I-60 | Thermofisher MA1-023-PE |
| Anti-TRA-I-81 | Thermofisher MA1-024-PE |
| Anti- SSEA4 | BD Pharmingen 560796 |
| Trilineage differentiation | Anti-PAX6 | Cell Signaling Technology, #60433 |
| Anti-Brachyury | Cell Signaling Technology, #81694 |
| Anti-SOX17 | Cell Signaling Technology, #81778 |
Flow Cytometry
iPSCs were dissociated into single cells using TrypLE™ Select (Gibco) and stained with antibodies against pluripotency markers listed in Table 1, analyzed by CytoFLEX Beckman Coulter flow cytometer, and data analysis was done using FlowJo software (V10.8.1).
Real-time PCR analysis
RNA was extracted from iPSC clones using NucleoZOL (Takara Bio) following the manufacturer’s protocol. 1 µg of total RNA was used for reverse transcription using PrimeScript™ RT Reagent (Takara Bio) as per the manufacturer's protocol. Quantitative real-time- polymerase chain reaction (RT-PCR) was set up with TB Green Premix Ex Taq II (Tli RNase H Plus) (Takara) using specific primers and analyzed with QuantStudio12K Flex (Life Technologies) real-time PCR systems. The list of primers is given in Table 2.
Table 2
The sequences of the PCR primers.
| Purpose | Gene | Primer sequences (5′–3′) |
| qRT-PCR analysis of pluripotency | β-ACTIN | Forward GACGACATGGAGAAAATCTG |
| Reverse ATGATCTGGGTCATCTTCTC |
| NANOG | Forward GTCAAGAAACAGAAGACCAG |
| Reverse GCCACCTCTTAGATTTCATTC |
| OCT-3/4 | Forward TGAGTAGTCCCTTCGCAAGC |
| Reverse GAAATCCGAAGCCAGGTGT |
| SOX2 | Forward ACACTGCCCCTCTCACACAT |
| | Reverse TTTTTCTTTTTGAGCGTACCG |
| DNMT3B | Forward ATAAGTCGAAGGTGCGTCGT |
| Reverse GGCAACATCTGAAGCCATTT |
| Mutation analysis | RPS19 | Forward GTCGGTGAGCTCCTTCAGAC |
| Reverse CAAGGGTTTCTCTCCCTCTT |
| Integration PCR | pCXLE-hOCT3/4-shp53-F | Forward CATTCAAACTGAGGTAAGGG |
| pCXLE-hUL | Forward GGCTGAGAAGAGGATGGCTAC |
| pCXLE-hSK | Forward CCACCTCGCCTTACACAT |
| pCXLE WPRE | Reverse TAGCGTAAAAGGAGCAACATAG |
Trilineage Differentiation
To induce trilineage differentiation, iPSCs were dissociated using TrypLE™ Select (Gibco) and plated as single cells in mTeSR + medium (StemCell Technologies) containing 10 µM revitacell (Thermo Fisher Scientific). On day 1, an appropriate volume of pre-warmed (37°C) STEMdiff™ Trilineage medium for ectoderm, endoderm and mesoderm differentiation was added to each well and the plates were incubated at 37°C for 24 hours. Medium change was done until day 5 (mesoderm and endoderm lineages) or day 7 (ectoderm lineage). Immunofluorescence was performed as per the method described above.
Karyotyping
Karyotyping was done according to a previously described method20. Briefly, the iPSC colonies in culture were exposed to 200 µg/ml colcemid for 30 minutes and harvested as a single cell suspension with 0.05% trypsin. The cell pellet was treated with 0.075 M KCl solution for 12 min at 37°C and then fixed using modified Carnoy's fixative (methanol and acetic acid in the ratio 3:1), followed by centrifugation at 1000 rpm for 10 minutes at room temperature. The fixed cells resuspended in 5 ml of modified Carnoy's fixative were spread on a slide and stained according to standard cytogenetics protocols. Images were acquired using the AxioImager A1 (Carl Zeiss, Germany) and analyzed using Ikaros Software (Metasystems, Germany).
Short tandem repeats (STR) analysis and mutation analysis.
Genomic DNA was isolated from DBA-iPSC, a control iPSC and the patient's blood using the Gentra Purgene DNA isolation kit (Qiagen). Short tandem repeats (STRs) were analyzed using PowerPlex ESI 17 Fast Systems (Promega) following the manufacturer’s protocol, and fragment length analysis was performed on an ABI 3130 Genetic Analyzer (Thermo Fisher Scientific) using Genemapper v4 software (Thermo Fisher Scientific). To confirm the RPS19 mutation identified by whole exome sequencing, primers were designed to amplify exon 2 of RPS19, and the forward primer was used for Sanger sequencing (Table 2).
Integration PCR
Genomic DNA was isolated as described above. PCRs were performed with primers (Table 2) designed to amplify the transgenes. The amplified PCR products were analyzed on the 1%-agarose gel. 5 ng of plasmids were used as positive controls. A previously characterized integration-free iPSC clone generated from a healthy donor was used as a negative control21.
Mycoplasma detection assay
Mycoplasma detection was performed using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza) following the manufacturer’s protocol. Briefly, 2 ml of cell culture supernatant was centrifuged at 200 x g for 5 minutes to pellet any cells. Then, 100 µl of the supernatant was transferred into one well of a 96-well plate. Next, 100 µl of MycoAlert™ PLUS Reagent was added to each sample and incubated for 5 minutes. Luminescence was measured by SpectraMax i3X (Molecular Devices) using the software SoftMax Pro 7 and recorded as reading A. Then, 100 µl of MycoAlert™ PLUS Substrate was added to each sample and incubated for 10 minutes. Luminescence was measured and recorded as reading B. The ratio was calculated as reading B/reading A. A ratio > 1.2 indicates mycoplasma contamination, while a ratio < 1 indicates the absence of mycoplasma in the cell culture.