Trichoderma and sodium nitroprusside elicitation improves vinblastine and vincristine yield by increasing TIA pathway genes expression in cell suspension of Catharanthus roseus

doi:10.21203/rs.3.rs-2884766/v1

Download PDF

Research Article

Trichoderma and sodium nitroprusside elicitation improves vinblastine and vincristine yield by increasing TIA pathway genes expression in cell suspension of Catharanthus roseus

https://doi.org/10.21203/rs.3.rs-2884766/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Biotic and abiotic elicitors induce the production of plant secondary metabolites. In this study the effects of Trichoderma harzianum and sodium nitroprusside (SNP) as a biotic and abiotic elicitor on biochemical and molecular features of Catharanthus roseous cell suspension were investigated. Leaf explant and medium amended with concentration of 8 µM 2,4-D and 2 µM BAP were used for obtain cell suspension. Cell suspension exposed to T. harzianum. (%1 v/v) and SNP (150 µM) and after 12, 24, 48 and 72 hours harvested. The highest activity of catalase, ascorbate peroxidase, β (1–3) glucanase and chitinase were found 48 hours after application of treatments. Also, the highest level of G10H (2.5-fold), T16H (1.5-fold), D4H (1.1-fold), DAT (1.9-fold), STR (5-fold) and CrPRX (2-fold) were observed 48-hours after elicitor application. A positive correlation was observed between enzymes activities, TIAs biosynthesis pathway genes and vinblastine and vincristine accumulation. These results confirmed that fungus and SNP elicitors in C. roseous led to increase secondary metabolites production and gene expression related to biosynthesis of vinblastine and vincristine pathway 1.84 and 1.93-fold, 48-hours after elicitor application, respectively. All these results suggest that fungus and SNP elicitors after 48-houres exposure, effectively improve the pharmaceutical value of C. roseous.

Biotic and abiotic elicitors

Cell suspension

Enzymes activities

Gene expression

Secondary metabolites

Alkaloids are various compounds of low molecular weight nitrogen containing which are found in plant species and about 12,000 alkaloids have been known for their chemical structures (Facchini 2001). According to the alkaloids biological activities lots of them have been extremely applied to cure diseases (Zhou et al. 2010). Catharanthus roseus is one of the medicinal and ornamental members of Apocynaceae family and it is a sole source of the vincristine and vinblastine as an anticancer drug (Alhaithloul et al. 2019; Birat et al. 2022). In cell biology, vinblastine and vincristine bind to tubulin and cause polymerization and results in inhibiting microtubule assembly that leads to the disorder in the mitotic spindle, finally metaphase stopped (Zandi 2021). Moreover, the accumulation of these beneficial alkaloids is very limited, which rarely meet the global demand (Zhang et al. 2018). Lately studies for finding TIAs biosynthesis genes, regulation on TIAs biosynthesis pathway and illumination of pathway intermediates transport were successful (Liu et al. 2014). Though, a great progress was obtained, but there are lots of pathway genes, regulators and TIA transporters that need to further studies for a better understanding of the production of anticancer drug components by C. roseus (Pan et al. 2018). Secondary metabolites accumulated in plants when they are faced with various stresses, elicitors or signal molecules (Thakur et al. 2019; Siddiqui et al. 2023).

Depending on the source, elicitors can be classified in biological or chemical compounds that lead to increase secondary metabolites biosynthesis and accumulation by induction of defensive responses and physiological changes in plants (Baldi et al. 2009; Ramezani et al. 2018). On the other hand, one of the most efficient ways to enhancing secondary metabolite production is application of biotic or abiotic elicitors in plants in vitro cells and organs culture (Sahu et al. 2013). The use of biotic or abiotic elicitor techniques also reduces processing time in obtaining active compounds in volume (Coste et al. 2011). Between various biotic elicitors, fungal elicitors have been widely used for stimulating of secondary metabolite production in in vitro cultures (Singh et al. 2018). In order to realize the role of elicitor on plant defense responses varied antioxidant enzymes activity were considered as the addition of elicitors induced cellular stress on tissues (Tonk et al. 2016). Previous studies declared that the expression of TIAs biosynthesis pathway genes is regulated by tissue and cell specific controls in response to biotic and abiotic stimuli in C. roseus (Kellner et al. 2015). Although the enhancement of alkaloids is depended on treatment and cell line specific, but the utilization of biotic and abiotic elicitors in medium is an affordable approach to enhancing valuable alkaloids of medicinal aims (Tonk et al. 2016). As well as, biotic elicitors have been used to increase the production of secondary metabolites in cell culture of many medicinal plants (Ramezani et al. 2018). Several investigations were showed fungus elicitation effects on secondary metabolites enrichment such as hypericin (Gadzovska Simic et al. 2015), ginsenoside (Tonk et al. 2016) and vincristine and vinblastine (Tonk et al. 2016). The accumulation of ajmalicine in the cell suspension of C. roseus by amended medium with Aspergillus niger, Fusarium moniliforme and T. viride as biotic elicitors was considered. The result demonstrated 5% v/v concentrations of fungal elicitors had a great effect on accumulation and content of ajmalicine (Namdeo et al. 2002). Prasad et al. (2013) reported that fungal elicitation by T. harzianum, Colletotrichum lindemuthianum and Fusarium oxysporum application increased biomass and asiaticoside accumulation in Centella asiatica. Moreover, induction T. atroviride and polysaccharide fragments on the hairy roots of Salvia officinalis led to enhancing tanshinone (Ming et al. 2013). Ramezani et al. (2018) reported that after 48 hours of treatment, the highest D4H and DAT gene expression increased 1.2 times 0.7-fold, respectively and increase the vinblastine and vincristine production obtained from C. roseus cell suspension amended with T. tomentosum elicitor and it was more effective in comparison with Piriformospora indica.

Sodium nitroprusside (SNP) is a nitric oxide (NO) donor. NO has fundamental role in plant growth (Khurana et al. 2011), signaling and regulating plant defense or stress responses (Amooaghaie and Korrani 2018), induce secondary metabolites like alkaloids accumulation (Xu and Dong 2005) and balances the ROS damage by affecting the expression of antioxidant genes (Khan et al. 2017). Mahendran et al. (2021) reported Gymnema sylvestre cell suspensions exposed to 20 µM SNP treatment led to increase deacylgymnemic acid, gymnemagenin and gymnemic acid XVII 13.43, 13.86 and 17.33-fold higher than the control, respectively. According to Cai et al. (2012) report, elicitors cause cellular stress that could be consider by antioxidant enzymes, which scavenge stress levels in tissues. Several enzymes like superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) activities are most measured to determine the stress rate in plant tissues (Fatima et al. 2015). Tonk et al. (2016) declared addition of Aspergillus. flavus as a fungal elicitor on Catharanthus roseus callus made extracellular stress and finally led to improves vincristine and vinblastine yield and increase antioxidant enzyme activities. Therefore, this study was performed in two steps. In first step, in vitro callus of selected C. roseus explants in different hormonal medium inducted, cell suspension obtained and elicitors applied. In the second step, the activity of some enzymes and the expression of genes involved in the biosynthesis of vinblastine and vincristine including Geraniol 10-hydroxylase (G10H), Strictosidine synthase (STR) and Catharanthus roseus peroxidase (CrPrx) by real-time quantitative PCR (qRT-PCR) and evaluating the production of mentioned alkaloids under the influence of T. fungi and SNP as elicitor in periwinkle cell suspension were investigated. Finally, the merged results of enzyme activities, qRT-PCR and HPLC data led to get further insights overview into the effect of elicitors on TAs content in C. roseus cell suspension.

Plant material and in vitro culture conditions

C. roseus seeds were purchased from Syngenta Company, Basel, Switzerland. Seeds surface sterilized was done with modified (Tonk et al. 2016) protocol by using 70% ethanol for 5 minutes, 1.5% sodium hypochlorite for 12 minutes, and then rinsed with sterile distilled water 6 times for10, 8, 6, 4, 2, 1 minutes, respectively. Seeds were placed on basal medium (Murashige and Skoog 1962) without plant growth regulators. Different types of explants such as hypocotyl, cotyledon, nod, leaf and petiole were excised and all explants cultured in the MS medium which supplemented with 2, 4-D (2, 4 and 8 µmol/l) and BAP (0.5, 1 and 2 µmol/l) (Table 1). The media were solidified with 7 g/l of agar and the pH of them were adjusted to 5.7 ± 1 before autoclaving at 121^oC for 15 min. Cultures were incubated at 25 ± 2°C under 16-h photo period regime with cool white fluorescent (100 µmol^− 1 m^− 2 s^− 1 PFD).

Table 1

Different hormonal combination used in *C. roseus* callus induction. PGRs = Plant Growth Regulators, MS = Murashige and Skoog, 2,4-D = 2,4-Dichlorophenoxyacetic acid and BAP = BenzylAminoPurine
Medium name	PGRs (µmol L^− l)
MS1	2 µmol L^− 1 2,4-D + 0.5 µmol L^− 1 BAP
MS2	2 µmol L^− 1 2,4-D + 1 µmol L^− 1 BAP
MS3	2 µmol L^− 1 2,4-D + 2 µmol L^− 1 BAP
MS4	4 µmol L^− 1 2,4-D + 0.5 µmol L^− 1 BAP
MS5	4 µmol L^− 1 2,4-D + 1 µmol L^− 1 BAP
MS6	4 µmol L^− 1 2,4-D + 2 µmol L-1 BAP
MS7	8 µmol L^− 1 2,4-D + 0.5 µmol L^− 1 BAP
MS8	8 µmol L^− 1 2,4-D + 1 µmol L^− 1 BAP
MS9	8 µmol L^− 1 2,4-D + 2 µmol L^− 1 BAP
MS = Murashige and Skoog, 2,4-D = 2,4-Dichlorophenoxyacetic acid and BAP = BenzylAminoPurine

Callus induction and cell suspension

A factorial experiment in completely randomized design was done in triplicate for consider the effect of PGRs and explants types on callus formation. The soft callus derived from explant with highest vinblastine and vincristine percentage selected and shifted to the liquid MS medium with the best hormonal treatment for callus growth and then placed in the incubator shaker (120 rpm shaking at 25°C) for callus proliferation. Cell suspensions subculture was performed every 7 days until optimal cell growth rate was obtained and for drawing cell growth curve, used settled cell volume and cell count (Farjaminezhad et al. 2013). According to the growth curve, elicitor treatments were applied when the cells reached exponential growth.

The biotic elicitor was T. harzianum with 1% v/v ratio, the abiotic elicitor was 150 µM SNP and medium without elicitor used as control. After exposure to the elicitors (12, 24, 48 and 72 hours), the cell suspension was passed through a filter paper and then excess water was removed and the obtained mixture were stored at -80 C° for stabilize the samples to investigate the enzyme activities and RNA extraction.

Procurement, culture of fungi and preparation of elicitor

The T. harzianum strain obtained from the Department of Plant Pathology, of Bu-Ali Sina University, Hamedan, Iran. The fungi culture was done by Nakano and Asada (1981) method and the 1% (v/v) concentration of fungi extract applied to cell suspension (Tashackori et al. 2016). The abiotic elicitor was 150 µM SNP and medium without elicitor used as control. After exposure to the elicitors (12, 24, 48 and 72 hours), the cell suspension was passed through a filter paper and then excess water was removed and was stored at -80°C in order to stabilize the samples to investigate the enzyme activities and RNA extraction.

Enzyme activities assessment

The activities of catalase (Aebi 1984), ascorbate peroxidase (Aebi 1984), β (1–3) glucanase (Abeles and Forrence 1970) and chitinase (Fan et al. 2008) were assayed.

Extraction and assay of vinblastine and vincristine

According to Pan et al. (2010) protocol, samples harvested and dried at 25°C for a week and pulverized. 0.1 g of sample’s powder dissolved in 1 ml of methanol 85% (HPLC grade), shacked for 10 minutes ultra-sonicated at 30°C for 1 hour, centrifuged at 14000 rpm for 15 min and then supernatant coffected for assay. The final volume was made up of the residue of each sample reconstituted in ratio 1:10 for high-performance liquid chromatography analysis as described by (Junaid et al. 2006). Indole alkaloids were evaluated by RP-HPLC (Knauer Scientific Instruments, Berlin, Germany). Detection and quantification were carried out with a Smartline Pump 1050, a Smartline UV Detector 2600 and DGU-14 A degasser. All solutions were filtered through a 0.45 nm filter. Aliquots (80 µl) were injected into a C18 reversed-phase column (250 mm × 4.6 mm length, 5 µm particle size). For stock solution, vinblastine and vincristine sulfate of over 97% purity purchased from Sigma-Aldrich (St. Louis, USA) and 0.5 mg solved in 0.5 ml of methanol and 0.5 ml of acetonitrile. In addition, vinblastine and vincristine compounds were recognized by comparing their retention times with those of the standards. Also, content of compounds was determined using their standards calibration curve.

Total RNA extraction and gene expression analyses

By using the RNX-Plus Kit (Sinaclon, Iran) and according to the manufacturer’s instructions, total RNA from control and samples which treated with elicitors extracted. Agarose gel electrophoresis and Nanodrop (Thermo Scientific, Germany) spectrophotometer analyses were used to test quality and quantity of RNA, respectively. The first-strand cDNA manufactured of RNA by the instructions of the Sinaclon First-Strand cDNA synthesize kit. Primers for G10H, STR, T16H, D4H, DAT and CrPrx genes were designed by OligoArchitect online software and synthesized by Pishgam Company (Table 2). Real time PCR reaction performed with Siber Green dye through protocol (Sinaclon, Iran). The RPS9 gene was selected as a housekeeping gene for data normalization. The results were calculated as relative changes (Fold changes) compared to the control sample. The relative expression of each gene was calculated using the 2 ^−ΔΔCt method (Livak and Schmittgen 2001).

Table 2

Sequence of reciprocating primers used in Real time PCR reaction.
Gene and primer name	Primer sequence (5'-3')
G10H (forward)	TAGCAGGGACGGACACAACATCAA
G10H (reverse)	TCACGTCCAATTGCCCAAGCATTC
T16H (forward)	AGGACCTTGTTGATGTGCTAC
T16H (reverse)	CATTGCCCAATCGACTGTTG
D4H (forward)	TACCCTGCATGCCCTCAACC
D4H (reverse)	TTGAAGGCCGCCAATTGAT
DAT (forward)	TTCCCTCCGGAAGCCATAGA
DAT (reverse)	GCTGATTTCCCTGCTACCGT
CrPRX (forward)	GCAACATCTCCCAGACCACA
CrPRX (reverse)	GTTCTCCCAACACTATGAGCACC
RPS9 (forward)	TCCACCATGCCAGAGTGCTCATTA
RPS9 (reverse)	TCCATCACCACCAGATGCCTTCTT

Statistical analysis

The data were analyzed by one-way analysis of variance (ANOVAs) using SAS software (version 9.4 Cary, NC, USA). The presented mean values were separated using Duncan’s multiple range Test (DMRT) at p ≤ 0.05.

Callus induction and cell suspension

In this study after four weeks, callus formation percentage and callus fresh weight were measured. The effect of explants, hormonal treatment and their interaction on callus induction percentage (Fig. 1) and callus fresh weight (Fig. 2) of C. roseus were significant (P ≤ 0.01). Comparison between explants and hormonal treatments on callus formation also showed that the callus formation percentage of different explants was strongly influenced by hormonal treatment in culture medium and in some explants including hypocotyl, nodule and leaf in most hormonal treatments such as 4 µM 2,4-D, 2 µM BAP. Application of 8 µM 2,4-D and 2 µM BAP had 100 percentage callus formation. On the other hand, the lowest percentage of callus formation was seen in the medium with combination hormonal treatment of 2 µM 2,4-D and 2 µM BAP and leaf explants. Interaction effect of explant and hormonal treatment showed that callus fresh weight of various explants in culture media with different hormonal treatments was variable, so that the highest callus fresh weight was observed in 2 µM 2,4-D and 0.5 µM BAP – treated samples and hypocotyl explants and combination of 2 µM 2,4-D and 1 µM BAP and hypocotyl explants, respectively. The lowest callus fresh weight was observed in the medium supplemented with 2 µM 2,4-D and 2 µM BAP and hypocotyl explants (Fig. 2). The HPLC results showed that the simple effect of explants on the vinblastine and vincristine in C. roseus were significant (Fig. 3). The highest amount of vinblastine was obtained from leaf explants (1.348 µg/g dry weight) and hypocotyl (0.317 µg/g dry weight), respectively. The maximum amount of vincristine was obtained from leaf explants (0.657 µg/g dry weight) and hypocotyl (0.183 µg/g dry weight), respectively. There was no significant difference between petiole, node and cotyledon explants in aforesaid alkaloids (Fig. 3). Leaf explant showed the higher amount of vinblastine and variance therefore used for next stage. Application of 8 µM 2,4-D and 2 µM BAP was the most desirable medium for callus growth, so this medium was used for liquid culture and preparation of cell suspension. The increase in callus formation and percentage by plant growth regulators can related to the provision of necessary precursors for growth. Also, the increase in callus weight in hormonal treatments can goes back to the increase in cell number and cell size, which due to photosynthesis have the ability to produce the required carbon source and in the later stages will increase significantly (Tahir et al. 2011). Farhadi et al. (2021) investigated the effects of plant growth regulators BAP, 2,4-D and NAA on the percentage and weight of calluses from the roots and hypocotyl of C. roseus. Their results showed that in comparison with the explants, the highest percentage of calluses was obtained from hypocotyl explant and the highest hormonal treatment on the percentage and weight of calluses was 1 mgL^− 1 BAP and 1 mgL^− 1 2,4-D., reported that C. roseus hypocotyl explant in MS medium supplemented with 4.5 µM 2,4-D with 2 µM BAP had the highest callus formation and fragile and light-colored, fast-growing calluses were produced that could produce somatic embryos. In the present study, hormonal treatments are developed, in particular, the combination treatment of 4 µM 2,4-D and 1 µM BAP and the combined treatment of 4 µM 2,4-D and 2 µM BAP cause callus formation in most of the explants. The positive effect regulators especially 2,4-D and BAP on callus formation percentage and callus weight in many medicinal plants such as Stevia rebaudiana (Keshvari et al. 2018), Taxus baccata, Calotropis procera (Amirkavei Najafabadi et al. 2020), Calotropis procera (Abasi 2017), Mentha piperita (Ahmad et al. 2021) and Salacia macrosperma (Bouguemra et al. 2022) have been reported to be consistent with the results of this study. The balance between organic and inorganic nutrients, carbon source, plant growth regulators, stresses and plant growth stage can affect the biosynthesis pathway of alkaloids. Aslam et al. (2010) investigated the alkaloid content of vincristine in non-embryonic callus and embryogenic callus from leaf, root and node explants. Their results showed, the highest amount of vincristine alkaloid was in the embryonic germination stage (10.04 micrograms per gram of dry weight). Also, plants regenerated from somatic embryos had 2.2 µg per gram of dry weight of vinblastine more than plants grown in the field. Their results showed vinblastine alkaloid were not detected in the roots and the highest vinblastine alkaloid was observed in leaf explant. In the growth conditions comparison vinblastine alkaloid in the in vitro condition was 12.3 µg g^− 1 of dry weight and in field condition it was 9.4 µg g^− 1 of dry weight. In our study, the amount of vincristine and vinblastine in leaf-derived callus were 3.6 and 4.2-fold higher than hypocotyl explants, respectively (Fig. 3).

Enzymes Activities

In order to realize the effect of Trichoderma and sodium nitroproside elicitor on plant defense responses and secondary metabolism, several antioxidant enzymes activity evaluated as the addition of elicitor induced cellular stress on cell suspension. The results showed that Trichoderma, SNP and elicitors application time had significant effects on the catalase, ascorbate peroxidase, β (1–3) glucanase and chitinase activities in treated C. roseus cell suspension. There was a significant difference in elicitors and elicitor application time on content of catalase activity in C. roseus cell suspension. The results revealed that the T. viride ₊ SNP and T. harzianum ₊ SNP treatment after 48 hours elicitors application time led to increase the 2 and 1.9 -fold catalase activity in comparison with controls, respectively (Fig. 4). The interaction effect of elicitors and elicitors application time on ascorbate peroxidase activity have not significant difference but the most mentioned enzyme activity was observed in T. harzianum ₊ SNP (2.59 mg^–1 protein min^–1) and SNP (2.55 mg^–1 protein min^–1) treatment, respectively (Fig. 5). Also, a significant increase in ascorbate peroxidase activity was seen after 48 hours elicitors application time (Fig. 6). According to the results (Table 4), β (1–3) glucanase was affected by elicitors and elicitor application time. The results showed that β (1–3) glucanase activity increase in T. harzianum and T. harzianum ₊ SNP treatment after 48 hours elicitor application time about 2.4-fold increase rather than control (Fig. 7). Due to the Table 4, elicitors and elicitor application time led to change in chitinase activity so that, T. harzianum and T. harzianum ₊ SNP treatments after 48 hours elicitor application time increase 3.7-fold compared with control (Fig. 8).

In general, the results of this study showed that the effect of catalase and ascorbate peroxidase was higher than in most samples treated with T. harzianum. On the other hand, the activity of these enzymes in comparison with biotic and abiotic treatments was higher in SNP treatment than fungal treatments. The highest activity of these antioxidant enzymes was observed 48 hours after treatments. The most desirable elicitor and application treatment time for increasing the activity of catalase and ascorbate peroxidase enzymes was the treatment of T. harzianum and SNP after 48 hours. After 72 hours, due to the death of most cells in the suspension culture, the amount of activity of enzymes decreased and the amount of activity reached less than the amount of activity in the treated samples after 12 hours. Also, the activity of chitinase and β-1 and 3 glucanase enzymes in samples treated with T. harzianum was higher than that of T. viride, although no significant difference was observed between them. Comparing the effect of biological treatments and SNP elicitors on the activity of chitinase and β-1 and 3-glucanase enzymes, fungal treatments increased the activity of these enzymes compared to SNP treatment. After 24 hours of treatment, the highest activity of these enzymes was observed. In general, the highest activity of chitinase and β-1 and 3-glucanase enzymes was obtained from the treatment of T. harzianum and SNP after 24 hours. After 48 hours of treatment, the activity of these enzymes decreased and after 72 hours, it decreased to less than 12 hours of treatment with biotic elicitors and SNP elicitor. Tonk et al. (2016) in a study investigated the effect of Aspergillus flavus fungi elicitor on vinblastine and vincristine content in periwinkle invitro culture. Their results showed that adding 0.15% fungal elicitor to the culture medium in comparison with other concentrations and calluses derived from leaf explants, led to the highest activity of the antioxidant enzymes superoxide dismutase, catalase and ascorbate peroxidase. Khashan and Husain (2015) by treating fungi, yeast and bacteria as elicitor in the culture medium containing periwinkle leaf explants, reported the highest activity of catalase enzyme in the T. harzianum treatment (61.49 units) and then in bacteria and yeast treated samples. The highest content of vinblastine and vincristine from fungal elicitor treatment were 31.30 and 17.78-fold compared with control.

SNP as chemical elicitor in plants stimulates enzymes and genes involved in the scavenging of free radicals. On the other hand, it causes stress and responds to the mechanism of stress by stimulating enzymes and genes related to the defense response. Reduction of fusarium wilt by treating biotic and SNP elicitors was investigated in tomatoes (Chakraborty et al. 2021). The results showed that after 48 hours of treatment with biotic elicitor and SNP, activity of β-1,3-glucanase, chitinase, polyphenol oxidase, peroxidase and phenylalanine ammonia-lyase were increased and recorded as 3.34, 2.11, 3.34, 2.17 and 2-fold higher than controls. In this study, according to the results of enzymatic activity and non-significant differences between T. harzianum and T. viride elicitors, the experiment was continued with 1% v/v T. harzianum with 150 µM of SNP.

Expression analysis of TAs biosynthetic genes

The relative expressions of the G10H, T16H, D4H, DAT, STR and CrPRX gene of TIAs biosynthetic pathway in C. roseus cell suspension were significantly up-regulated with Trichoderma, SNP elicitor and the effect of elicitor application time. The gene expression began to increase after 12 hours and reached its maximum level in 48 hours and after 72 hours it was decreased to the less than primary level. T. harzianum ₊ SNP treatment after 48 hours elicitor application time led to maximum expression of all considered genes. The results of elicitors and application time on the G10H gene expression in C. roseus cell suspension showed the maximum relative expression seen in T. harzianum ₊ SNP treatment after 48 hours of elicitor application (2.53-fold compared with control) and T. harzianum ₊ SNP treatment after 24 hours elicitor application (2.32-fold compared with control) (Fig. 8). T. harzianum ₊ SNP and T. harzianum treatment after 48 hours elicitor application led to increase 1.5-fold and 1.37-fold T16H gene compared with control, respectively (Fig. 9b). The relative expression of the D4H gene was higher in C. roseus cell suspension treated with T. harzianum ₊ SNP after 48 hours elicitor application (1.18-fold compared with control) and T. harzianum ₊ SNP treatment after 24 hours elicitor application (1.15-fold compared with control) (Fig. 9C). The 1.98-fold and 1.68-fold increase in DAT gene relative expression observed in T. harzianum ₊ SNP after 48- and 24-hours elicitor application, respectively (Fig. 9D). The maximum STR gene relative expression obtained from T. harzianum ₊ SNP treatment after 48 hours elicitor application (5.08-fold compared with control) and T. harzianum ₊ SNP treatment after 24 hours elicitor application (4.46-fold compared with control) (Fig. 9E). T. harzianum ₊ SNP treatment after 48 and 24-hours elicitor application caused increase 2.07 and 1.79-fold CrPRX gene compared with controls, respectively (Fig. 9F). Among all, the lowest expression value observed in control. Totally, utilized elicitors stimulate the expression of the six key genes on vinblastine and vincristine biosynthesis in the TIAs biosynthetic pathway and leading to the accumulation of TIAs.

Vinblastine and vincristine alkaloid yield

The effect of Trichoderma fungi and SNP, the application elicitor time, the interaction effect of Trichoderma fungi and SNP and application elicitor time on vinblastine and vincristine alkaloid amount in C. roseus cell suspension were significant at 1% probability level (Figs. 10 and 11). Based on comparison of interaction effect of Trichoderma fungi and SNP and application elicitor time, the maximum of vinblastine (Fig. 10) and vincristine (Fig. 11) alkaloids observed in T. harzianum ₊ SNP 48 hours after elicitor application (1.84 and 1.93-fold compared with control respectively) and combination of T. harzianum ₊ SNP after 24 hours application elicitor (1.69 and 1.87-fold compared with controls, respectively). The lowest amount of vinblastine and vincristine alkaloids was obtained from controls with different application elicitor times that had no significant different with each other. It is very evident from this paper that the biotic elicitor stimulates enriched level of alkaloids in C. roseus cell suspension.

Correlation between phytochemical, molecular and metabolic evaluations

The results of correlation between enzymatic activity, molecular and metabolic evaluations in C. roseus cell suspension under the influence of Trichoderma fungi and SNP elicitors showed a positive and significant correlation between catalase, ascorbate peroxidase, β-1 and 3-glucanase and chitinase enzyme activity with the relative G10H, T16H, D4H, DAT, STR and CrPRX STR and CrPRX genes involved in the biosynthesis of vinblastine and vincristine alkaloids with the amount of production of these alkaloids. Due to these results, it is inferred that treatments of T. harzianum, SNP elicitor and elicitor application time induced the defense response and increased enzymatic activity and thus stimulated the relative expression of the biosynthetic pathway genes in the C. roseus cell suspension. enhancement of vinblastine and vincristine alkaloids confirms this because the increased production of vinblastine and vincristine alkaloids can be due to increased activity of the antioxidant enzyme (catalase and ascorbate peroxidase) and defense enzymes (β-1 and 3-glucanase and chitinase) or increase the expression of genes involved in the biosynthetic pathway of these alkaloids (Table 3).

Table 3

Correlation between phytochemical, molecular and metabolic attributes in *C. roseus* cell suspension. ** Significance in 1% probability.
Variable	Catalase enzyme	Ascorbate peroxidase enzyme	β-1 and 3-glucanase enzyme	Chitinase enzyme	Relative expression of G10H	Relative expression of T16H	Relative expression of D4H	Relative expression of DAT	Relative expression of STR	Relative expression of CrPRX	Vinblastine alkaloid
Ascorbate peroxidase enzyme	0.841**	-
β-1 and 3-glucanase enzyme	0.888**	0.678**	-
Chitinase enzyme	0.885**	0.659**	0.965**	-
Relative expression of G10H	0.859**	0.782**	0.776**	0.758**	-
Relative expression of T16H	0.512**	0.325**	0.603**	0.643**	0.463**	-
Relative expression of CrPRX	0.549**	0.351**	0.596**	0.469**	0.535**	0.652**	-
Relative expression of D4H	0.661**	0.529**	0.625**	0.656**	0.421**	0.552**	0.552**	-
Relative expression of STR	0.880**	0.760**	0.875**	0.864**	0.898**	0.598**	0.621**	0.776**	-
Relative expression of CrPRX	0.620**	0.490**	0.619**	0.643**	0.711**	0.432**	0.531**	0.966**	0.758**	-
Vinblastine alkaloid	0.743**	0.603**	0.798**	0.794**	0.800**	0.581**	0.669**	0.744**	0.903**	0.762**	-
Vincristine alkaloids	0.720**	0.519**	0.774**	0.775**	0.765**	0.616**	0.633**	0.697**	0.835**	0.730**	0.891**

The first part of the experiments was performed to screen the best explants and medium with high callus formation percentage, callus fresh weight and amount of vinblastine and vincristine. In second part, the effect of T. harzianum, SNP elicitor and elicitor application time, enzymatic activity and expression of the biosynthetic pathway of TIAs genes on C. roseus cell suspension were investigated. Liu et al. (2021) stated that cell suspension and hairy roots are the best methods to study the biosynthesis pathway of indole alkaloids in the periwinkle plant, although more recently seedlings (Mortensen et al. 2019), leaves (Sharma et al. 2018) and petals (Schweizer et al. 2018) have also been used to investigate the expression of genes related to the synthesis of valuable alkaloids in this plant. Therefore, in this study, C. roseus cell suspension derived from leaf callus was used. The production of the secondary metabolite is genetically controlled, but its accumulation in the plant occurs under the influence of biotic stresses and SNP elicitor (Verma et al. 2017). Fungal elicitors increase the production of secondary metabolites, especially those involved in plant defense mechanisms. Fungi, like plants, have cell walls, but their cell wall composition is different from plants. Elicitors attack cell wall compounds, and in response to the elicitors message, the plant's defense system is activated (Orbán et al. 2008). Decreased in growth of cells affected by fungal elicitors over time may be due to decreased primary metabolism and the onset of secondary metabolism. On the other hand, there are reports of increased growth affected by fungal elicitors (Wang et al. 2001). SNP is a source of nitric oxide, which is a free radical and has a wide range of physiological consequences in plant cells (Hayat et al. 2010). The role of signaling of this molecule in regulating important growth processes, development and defense responses has been identified (Hong et al. 2008). Nitric oxide activity in plant tissues and cells usually occurs in response to abiotic stresses, pathogen attacks, and fungal elicitor challenges. The most prominent role of nitric oxide is signaling and regulation of defense responses to stresses, which leads to increased production of secondary metabolites (Senthil 2020) and activation of enzymes and expression of genes related to their biosynthetic pathway (Ma et al. 2021). Considered the positive effects of fungal elicitors and SNP in this study, the effect of these elicitors on the change in the relative expression of genes involved in the biosynthetic pathway of vincristine alkaloid was investigated. It should be noted that the relative expression of G10H, T16H, D4H, DAT, STR and CrPRX genes involved in the biosynthetic pathway of vinblastine and vincristine alkaloid in C. roseus cell suspension under the treatment of Trichoderma elicitors of T. harzianum and SNP elicitors have not been studied at different application elicitor times. Current findings were similar to publications that reported the positive effect of biotic elicitor on biosynthesis pathway of terpenoid indole alkaloids. Pandey et al. (2016) investigated the effect of endophytic fungi (Choanephora infundibulifera and Curvularia spp.) on increasing the expression of vinduline genes in periwinkle. Result illustrated after inoculation with Curvularia spp. elicitor led to expression of STR (0.7-fold increase), SGD (0.2-fold decrease), T16H (0.3-fold decrease), 16OMT (1-fold increase), D4H (1.7-fold increase), DAT (5.3-fold increase) and PRX1 (2-fold increase) compared with the control. Choanephora infundibulifera elicitor led to changes in relative expression of STR (0.9-fold increase), SGD (0.4-fold decrease), T16H (0.2-fold decrease), 16OMT (2-fold increase), D4H (1-fold increase), DAT (4.8-fold increase) and PRX1 (2.4-fold increase). Ramezani et al. (2018) reported that the treatment of Trichoderma harzianum, Piriformospora indica and T. tomentosum 1% v/v in the periwinkle cell suspension was more effective than T. tomentosum. Gene expression began after 24 hours of treatment and expression of D4H and DAT genes after 48 hours of treatment had the highest gene expression of 1.2-fold and 0.7-fold, respectively. After 72 hours the expression of mentioned genes were reduced and reached the control level. Zhonghai et al. (2011) studied the effect of Fusarium oxysporum extract on increasing the expression of PAL and TDC genes in the biosynthesis pathway of alkaloids. Increased PAL and TDC activity led to the increase in the alkaloid synthesis of C. roseus suspension cell culture. Liang et al. (2018) investigated the effect of biotic elicitor on the expression of indole alkaloid production genes using Aspergillus flavus as an elicitor in the cell suspension resulting from C. roseus meristem. Treatment of different concentrations of the fungus (0, 5, 15 and 25 mgl^− 1) was applied at different treatments (12, 24, 36, 48 and 60 hours). qRT-PCR results showed that the combined treatment of 25 mg l^− 1 elicitor was the most desirable treatment after 48 hours and in this treatment the relative expression of D4H, G10H, GES, IRS, LAMT, SGD, STR, TDC and ORCA3 genes were compared with control increased by 49.4, 1.75, 1.71, 1.42, 3.12, 2.33, 2.87, 2.51 and 5.97-fold. These results showed that increasing the accumulation of vindoline, catharanthine and ajmaline alkaloids in periwinkle cells is correlated with increasing the expression of the above genes. Application of SNP elicitor increases the production of secondary metabolites and stimulates the expression of genes in the biosynthetic pathway of valuable medicinal compounds in plants (Zhou et al. 2010). Mahendran et al. (2021) reported that SNP at different concentrations (5, 10, 20, and 40 µM) in the cell suspension of the antidiabetic drug Gymnema sylvestre increases valuable secondary metabolites of this plant and their biosynthetic genes. Concentrations of 20 µM up to day 40 of the treatment resulted in the highest fresh and dry cell weight. The results of HPLC analysis showed that the maximum accumulation of gymnemic diacyl acid (5.51 mg g^− 1 callus dry weight), gymnemagnine (2.80 mg g^− 1 callus dry weight) and gymnemic acid (2.08 mg g^− 1 callus dry weight) in the treatment of 20 µM SNP was observed after 40 days of treatment, which was 13.43, 13.86 and 17.33-fold higher than the control, respectively. They attributed the increase to a change in the expression pattern of genes involved in the biosynthesis of these compounds by 20 µM SNP treatment after 40 days and they recommended this treatment as a good strategy for large-scale production of these secondary metabolites in industrial level. Liang et al. (2012) reported the application of SNP elicitor (100 µM) in salvia hairy root culture significantly increased tanshinone production. This treatment increased the expression of two key genes HMGR and DXR in the biosynthesis pathway of tanshinone alkaloid 16.7 and 14.1-fold, respectively. Wang et al. (2009) by application of cerebroside (30 µg ml^− 1) and SNP (10 µmol) in the hairy root of the artemisia reported that SNP alone did not change the expression of genes involved in the biosynthesis pathway of artemisinin sesquiterpene alkaloid. The results of qRT-PCR showed the combination of the two above-mentioned elicitors resulted in the highest expression of HMGR (9.3-fold) and DXR (6.6-fold) genes compared to the control. Xu and Dong (2005) in a study evaluated the SNP role as a nitric oxide donor in secondary metabolites production in cell suspension of periwinkle. The results showed that production of ajmalicine and catharanthine in the treatment of 10 mmol l^− 1 SNP increased by 1.6 and 2.9-fold, respectively, which increased followed by high expression of genes involved in the production of ajmalicine and catharanthine alkaloids. Zhou et al. (2010) investigated the transcriptional response of the catharanthine alkaloid biosynthesis pathway in hairy root culture of periwinkle using methyl jasmonate (50 mg l^− 1) and SNP (10 mg l^− 1) elicitors. The results showed SNP elicitor treatment alone and in combination with methyl jasmonate caused overexpression of ORCA3 and subsequently decreased catharanthine levels and also significant enhancement of CPR and ZCT transcription. Methyl jasmonate increased the expression of TDC, STR, MECS, SLS, SGD and G10H genes, which was inhibited by SNP. This response of transcription receptors and pathogen genes may indicate the role of methyl jasmonate and SNP antagonists in the biosynthesis of the catharanthine alkaloid. Li et al. (2011) used different concentrations of SNP (0, 0.1, 1 and 10 mM) for investigating its effects on growth and alkaloid compounds production in hairy root culture of periwinkle. Their results showed that 10 mM of SNP was a complete inhibitor of hairy root growth and 1and 10 mM SNP were toxic and reduced the production of indole-terpenoid alkaloids. 0.1 mM up to day 9 of the treatment increased the alkaloids of ajmalicine and taberzonin and decreased the alkaloid of catharanthine and serpentine alkaloids reached their maximum on day 14 of treatment but decreased by day 30. Treatment of 0.1 mM concentration up to day 12 reduced the expression of STR, ORCA3 and Crgbf1 genes and 21 days after treatment the relative expression of ZCT1 gene doubled compared to the control and until the 28th day the relative expression of G10H gene upward trend.

Previous studies have shown that elicitors can control large number of transcription factor regulators of key genes in the biosynthesis pathway of terpenoid indole alkaloids and stimulate the expression of these genes at the biochemical and molecular level (Khataee et al. 2019). However, the results of this research showed that simultaneous application of biotic elicitor and SNP have a greater effect on stimulating production of secondary metabolites. These results were consistent with previous studies and showed the combined treatment of Trichoderma elicitor (T. harzianum) with abiotic elicitor (SNP) was more effective on the activity of enzymes, relative expression of mentioned genes and vinblastine and vincristine alkaloids amount in C. roseus cell suspension culture.

In this study we investigate the effect of T. harzianum and SNP on phytochemical, molecular and metabolic change in C. roseus cell suspension. Base on the results, leaf explant and 8 µM 2,4-D and 2 µM BAP were selected for liquid culture and preparation of cell suspension. In addition, the use of T. harzianum elicitor in combination with SNP elicitor 48 hours after application is recommended to increase the enzyme activities, expression of genes involved in biosynthesis pathway of vinblastine and vincristine alkaloids in periwinkle. The results of this paper can be useful to secondary metabolite production with higher quality under in vitro status.

Funding

This work was supported by Bu-Ali Sina university (Grant No: 98-936).

Competing interest

The authors have no main and known competing financial interests or important and personal relationships that could have appeared to influence the study reported in this paper.

Author Contributions

Leila Farzaei: Former Ph. D. student, Department of Horticultural Sciences, Faculty of Agriculture, Bu-Ali Sina University, Hamedan, 51664, Iran. Author 1 in supervision of second author, conducted the research, prepared the materials and collected the data.

Mohammad Sayyari: Author 2 was supervisor of Ph. D. project of author 1 and cooperated in conducting the experiment, analyzing the data and preparing the manuscript.

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Acknowledgements:

The support of this research provided by Bu-Ali Sina University (BASU) has been acknowledged.

Abasi H (2017) Study of milkweed (Calotropis procera) regeneration potential in vitro culture conditions. J Plant Res (Iranian J Biol 29:833–842).
Abeles FB, Forrence LE (1970) Temporal and hormonal control of β-1, 3-glucanase in Phaseolus vulgaris L. Plant Physiol 45:395–400. https://doi.org/10.1104/pp.45.4.395
Aebi H (1984) [13] Catalase in vitro. In: Methods in enzymology. Elsevier, pp 121–126. https://doi.org/10.1016/S0076-6879(84)05016-3
Ahmad A, ul Qamar MT, Shoukat A, et al (2021) The effects of genotypes and media composition on callogenesis, regeneration and cell suspension culture of chamomile (Matricaria chamomilla L.). PeerJ 9:e11464. https://doi.org/10.7717/peerj.11464
Alhaithloul HA, Soliman MH, Ameta KL, et al (2019) Changes in ecophysiology, osmolytes, and secondary metabolites of the medicinal plants of Mentha piperita and Catharanthus roseus subjected to drought and heat stress. Biomolecules 10:43. https://doi.org/10.3390/biom10010043
Amirkavei Najafabadi B, Qavami N, Ebrahimi MA, et al (2020) Enhancement of Taxol production by applying amino acid complex along with chitosan in suspension culture of Taxus baccata L. J Med Plants 19:99–109. https://doi.org/10.29252/jmp.19.76.99
Amooaghaie R, Korrani FM (2018) Bacillus subtilis and vermicompost suppress damping-off disease in psyllium through nitric oxide-dependent signaling system. Russ J Plant Physiol 65:435–445. https://doi.org/10.1134/S1021443718030093
Aslam J, Mujib A, Fatima Z, Sharma MP (2010) Variations in vinblastine production at different stages of somatic embryogenesis, embryo, and field-grown plantlets of Catharanthus roseus L.(G) Don, as revealed by HPLC. Vitr Cell Dev Biol 46:348–353. https://doi.org/10.1007/s11627-010-9290-y.
Baldi A, Srivastava AK, Bisaria VS (2009) Fungal elicitors for enhanced production of secondary metabolites in plant cell suspension cultures. In: Symbiotic fungi. Springer, pp 373–380. https://doi.org/10.1007/978-3-540-95894-9_23
Birat K, Siddiqi TO, Mir SR, et al (2022) Enhancement of vincristine under in vitro culture of Catharanthus roseus supplemented with Alternaria sesami endophytic fungal extract as a biotic elicitor. Int Microbiol 25:275–284. https://doi.org/10.1007/s10123-021-00213-w
Bouguemra S, Ouafi S, Bouguedoura N, Chabane D (2022) Enhancing bioactive potential by growth regulators in callus of Mentha longifolia L. leaves for anti-inflammatory and analgesic activities. Indian J Exp Biol 58:122–130.
Cai Z, Kastell A, Mewis I, et al (2012) Polysaccharide elicitors enhance anthocyanin and phenolic acid accumulation in cell suspension cultures of Vitis vinifera. Plant Cell, Tissue Organ Cult 108:401–409. https://doi.org/10.1007/s11240-011-0051-3
Chakraborty N, Sarkar A, Acharya K (2021) Biotic elicitor induced nitric oxide production in mitigation of Fusarium wilt of tomato. J Plant Biochem Biotechnol 30:960–972. https://doi.org/10.1007/s13562-021-00705-w
Coste A, Vlase L, Halmagyi A, et al (2011) Effects of plant growth regulators and elicitors on production of secondary metabolites in shoot cultures of Hypericum hirsutum and Hypericum maculatum. Plant Cell, Tissue Organ Cult 106:279–288. https://doi.org/10.1007/s11240-011-9919-5
Facchini PJ (2001) Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annu Rev Plant Biol 52:29–66. https://doi.org/10.1146/annurev.arplant.52.1.29
Fan B, Shen L, Liu K, et al (2008) Interaction between nitric oxide and hydrogen peroxide in postharvest tomato resistance response to Rhizopus nigricans. J Sci Food Agric 88:1238–1244. https://doi.org/10.1002/jsfa.3212
Farhadi H, Hassanpouraghdam MB, Aazami MA (2021) The induction and development of somatic embryos from the in vitro cultures of Catharanthus roseus (L.) G. Don. Adv Hortic Sci 35.
Farjaminezhad R, Zare N, ZAKARIA RA, Farjaminezhad M (2013) Establishment and optimization of cell growth in suspension culture of Papaver bracteatum: a biotechnology approach for thebaine production. Turkish J Biol 37:689–697. https://doi.org/10.3906/biy-1304-54
Fatima S, Mujib A, Tonk D (2015) NaCl amendment improves vinblastine and vincristine synthesis in Catharanthus roseus: a case of stress signalling as evidenced by antioxidant enzymes activities. Plant Cell, Tissue Organ Cult 121:445–458. https://doi.org/10.1007/s11240-015-0715-5
Gadzovska Simic S, Tusevski O, Maury S, et al (2015) Fungal elicitor-mediated enhancement in phenylpropanoid and naphtodianthrone contents of Hypericum perforatum L. cell cultures. Plant Cell, Tissue Organ Cult 122:213–226. https://doi.org/10.1007/s11240-015-0762-y
Hayat S, Hasan SA, Mori M, et al (2010) Nitric oxide: chemistry, biosynthesis, and physiological role. Nitric oxide plant Physiol 1–15. https://doi.org/10.1002/9783527629138
Hong JK, Yun B-W, Kang J-G, et al (2008) Nitric oxide function and signalling in plant disease resistance. J Exp Bot 59:147–154. https://doi.org/10.1093/jxb/erm244
Junaid A, Mujib A, Bhat MA, Sharma MP (2006) Somatic embryo proliferation, maturation and germination in Catharanthus roseus. Plant Cell Tissue Organ Cult 84:325–332. https://doi.org/10.1007/s11240-005-9041-7
Kellner F, Kim J, Clavijo BJ, et al (2015) Genome‐guided investigation of plant natural product biosynthesis. Plant J 82:680–692. https://doi.org/10.1111/tpj.12827
Keshvari T, Najaphy A, Kahrizi D, Zebarjadi A (2018) Callus induction and somatic embryogenesis in Stevia rebaudiana Bertoni as a medicinal plant. Cell Mol Biol 64:46–49. https://doi.org/10.14715/cmb/2018.64.2.9
Khan MN, Mobin M, Abbas ZK, Siddiqui MH (2017) Nitric oxide-induced synthesis of hydrogen sulfide alleviates osmotic stress in wheat seedlings through sustaining antioxidant enzymes, osmolyte accumulation and cysteine homeostasis. Nitric Oxide 68:91–102. https://doi.org/10.1016/j.niox.2017.01.001
Khashan KT, Husain MA (2015) Effect of biotic factors stresses on vinblastine and vincristine production from callus of Catharanthus roseus. Euphrates J Agric Sci 7:25–41.
Khataee E, Karimi F, Razavi K (2019) Chromium-induced alkaloid production in Catharanthus roseus (L.) G. Don in vitro cultured shoots and related gene expression patterns particularly for the novel gene GS. Acta Agric Slov 113:95–108.
Khurana A, Khurana JP, Babbar SB (2011) Nitric oxide induces flowering in the duckweed Lemna aequinoctialis Welw.(Syn. L. paucicostata Hegelm.) under noninductive conditions. J Plant Growth Regul 30:378–385. https://doi.org/10.1007/s00344-011-9199-7
Li M, Peebles CAM, Shanks J V, San K (2011) Effect of sodium nitroprusside on growth and terpenoid indole alkaloid production in Catharanthus roseus hairy root cultures. Biotechnol Prog 27:625–630. https://doi.org/10.1007/s00299-004-0815-x
Liang C, Chen C, Zhou P, et al (2018) Effect of Aspergillus flavus fungal elicitor on the production of terpenoid indole alkaloids in Catharanthus roseus cambial meristematic cells. Molecules 23:3276. https://doi.org/10.3390/molecules23123276
Liang Z-S, Yang D-F, Liang X, et al (2012) Roles of reactive oxygen species in methyl jasmonate and nitric oxide-induced tanshinone production in Salvia miltiorrhiza hairy roots. Plant Cell Rep 31:873–883. https://doi.org/10.1007/s00299-011-1208-6
Liu L-YD, Tseng H-I, Lin C-P, et al (2014) High-throughput transcriptome analysis of the leafy flower transition of Catharanthus roseus induced by peanut witches’-broom phytoplasma infection. Plant Cell Physiol 55:942–957. https://doi.org/10.1093/pcp/pcu029
Liu Y, Patra B, Singh SK, et al (2021) Terpenoid indole alkaloid biosynthesis in Catharanthus roseus: effects and prospects of environmental factors in metabolic engineering. Biotechnol Lett 43:2085–2103. https://doi.org/10.1007/s10529-021-03179-x
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 25:402–408. https://doi.org/10.1006/meth.2001.1262
Ma YJ, Li XP, Wang Y, Wang JW (2021) Nitric oxide donor sodium nitroprusside-induced transcriptional changes and hypocrellin biosynthesis of Shiraia sp. S9. Microb Cell Fact 20:1–16. https://doi.org/10.1186/s12934-021-01581-8
Mahendran G, Kumar D, Verma SK, et al (2021) Sodium nitroprusside enhances biomass and gymnemic acids production in cell suspension of Gymnema sylvestre (Retz.) R. Br. ex. Sm. Plant Cell, Tissue Organ Cult 146:161–170. https://doi.org/10.1007/s11240-021-02058-7
Ming Q, Su C, Zheng C, et al (2013) Elicitors from the endophytic fungus Trichoderma atroviride promote Salvia miltiorrhiza hairy root growth and tanshinone biosynthesis. J Exp Bot 64:5687–5694. https://doi.org/10.1093/jxb/ert342
Mortensen S, Bernal-Franco D, Cole LF, et al (2019) EASI transformation: an efficient transient expression method for analyzing gene function in Catharanthus roseus seedlings. Front Plant Sci 10:755. https://doi.org/10.3389/fpls.2019.00755
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473–497.
Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant cell Physiol 22:867–880. https://doi.org/10.1093/oxfordjournals.pcp.a076232
Namdeo A, Patil S, Fulzele DP (2002) Influence of fungal elicitors on production of ajmalicine by cell cultures of Catharanthus roseus. Biotechnol Prog 18:159–162. https://doi.org/10.1021/bp0101280
Orbán N, Boldizsár I, Szűcs Z, Dános B (2008) Influence of different elicitors on the synthesis of anthraquinone derivatives in Rubia tinctorum L. cell suspension cultures. Dye Pigment 77:249–257. https://doi.org/10.1016/j.dyepig.2007.03.015
Pan Q, Chen YU, Wang Q, et al (2010) Effect of plant growth regulators on the biosynthesis of vinblastine, vindoline and catharanthine in Catharanthus roseus. Plant Growth Regul 60:133–141. https://doi.org/10.1007/s10725-009-9429-1
Pan Y, Lin Y, Yu B, et al (2018) Transcriptomics comparison reveals the diversity of ethylene and methyl-jasmonate in roles of TIA metabolism in Catharanthus roseus. BMC Genomics 19:1–14. https://doi.org/10.1186/s12864-018-4879-3
Pandey SS, Singh S, Babu CS, et al (2016) Fungal endophytes of Catharanthus roseus enhance vindoline content by modulating structural and regulatory genes related to terpenoid indole alkaloid biosynthesis. Sci Rep 6:1–14. https://doi.org/10.1038/srep26583
Prasad A, Mathur A, Kalra A, et al (2013) Fungal elicitor-mediated enhancement in growth and asiaticoside content of Centella asiatica L. shoot cultures. Plant Growth Regul 69:265–273. https://doi.org/10.1007/s10725-012-9769-0
Ramezani A, Haddad R, Sedaghati B, Jafari D (2018) Effects of fungal extracts on vinblastine and vincristine production and their biosynthesis pathway genes in Catharanthus roseus. South African J Bot 119:163–171. https://doi.org/10.1016/j.sajb.2018.08.015
Sahu R, Gangopadhyay M, Dewanjee S (2013) Elicitor-induced rosmarinic acid accumulation and secondary metabolism enzyme activities in Solenostemon scutellarioides. Acta Physiol Plant 35:1473–1481. https://doi.org/10.1016/j.plantsci.2005.12.004
Schweizer F, Colinas M, Pollier J, et al (2018) An engineered combinatorial module of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab Eng 48:150–162. https://doi.org/10.1016/j.ymben.2018.05.016
Senthil K (2020) Establishment of callus and cell suspension culture of Sophora alopecuroides Linn. for the production of oxymatrine. J Phytol 12:35–39.
Sharma A, Verma P, Mathur A, Mathur AK (2018) Genetic engineering approach using early Vinca alkaloid biosynthesis genes led to increased tryptamine and terpenoid indole alkaloids biosynthesis in differentiating cultures of Catharanthus roseus. Protoplasma 255:425–435. https://doi.org/10.1007/s00709-017-1151-7
Siddiqui ZH, Mujib A, Abbas ZK, et al (2023) Vinblastine synthesis under the influence of CaCl2 elicitation in embryogenic cell suspension culture of Catharanthus roseus. South African J Bot 154:319–329. https://doi.org/10.1016/j.sajb.2023.01.046
Singh NR, Rath SK, Behera S, Naik SK (2018) In vitro secondary metabolite production through fungal elicitation: an approach for sustainability. In: Fungal Nanobionics: Principles and Applications. Springer, pp 215–242. https://doi.org/10.1007/978-981-10-8666-3_9.
Tahir SM, Victor K, Abdulkadir S (2011) The effect of 2, 4-Dichlorophenoxy acetic acid (2, 4-D) concentration on callus induction in sugarcane (Saccharum officinarum). Niger J Basic Appl Sci 19.
Tashackori H, Sharifi M, Ahmadian Chashmi N, et al (2016) Induced-differential changes on lignan and phenolic acid compounds in Linum album hairy roots by fungal extract of Piriformospora indica. Plant Cell, Tissue Organ Cult 127:187–194. https://doi.org/10.1007/s11240-016-1041-2
Thakur M, Bhattacharya S, Khosla PK, Puri S (2019) Improving production of plant secondary metabolites through biotic and abiotic elicitation. J Appl Res Med Aromat Plants 12:1–12. https://doi.org/10.1016/j.jarmap.2018.11.004
Tonk D, Mujib A, Maqsood M, et al (2016) Aspergillus flavus fungus elicitation improves vincristine and vinblastine yield by augmenting callus biomass growth in Catharanthus roseus. Plant Cell, Tissue Organ Cult 126:291–303. https://doi.org/10.1007/s11240-016-0998-1
Verma P, Mathur AK, Khan SA, et al (2017) Transgenic studies for modulating terpenoid indole alkaloids pathway in Catharanthus roseus: present status and future options. Phytochem Rev 16:19–54. https://doi.org/10.1007/s11101-015-9447-8
Wang C, Wu J, Mei X (2001) Enhancement of taxol production and excretion in Taxus chinensis cell culture by fungal elicitation and medium renewal. Appl Microbiol Biotechnol 55:404–410. https://doi.org/10.1007/s002530000567
Wang JW, Zheng LP, Zhang B, Zou T (2009) Stimulation of artemisinin synthesis by combined cerebroside and nitric oxide elicitation in Artemisia annua hairy roots. Appl Microbiol Biotechnol 85:285–292. https://doi.org/10.1007/s00253-009-2090-9
Xu M, Dong J (2005) Nitric oxide stimulates indole alkaloid production in Catharanthus roseus cell suspension cultures through a protein kinase-dependent signal pathway. Enzyme Microb Technol 37:49–53. https://doi.org/10.1016/j.enzmictec.2005.01.036
Zandi M (2021) Cytotoxicity of Taxol in Combination with Vincristine and Vinblastine Against A375 Cell Line. Gene, Cell Tissue 8. https://doi.org/10.5812/gct.114359
Zhang X-N, Liu J, Liu Y, et al (2018) Metabolomics analysis reveals that ethylene and methyl jasmonate regulate different branch pathways to promote the accumulation of terpenoid indole alkaloids in Catharanthus roseus. J Nat Prod 81:335–342. https://doi.org/10.1021/acs.jnatprod.7b00782
Zhonghai T, Liqun R, Guoping P, et al (2011) Effects of endophytic fungus and its elicitors on cell status and alkaloid synthesis in cell suspension cultures of Catharanthus roseus. J Med Plants Res 5:2192–2200.
Zhou M-L, Zhu X-M, Shao J-R, et al (2010) Transcriptional response of the catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture. Appl Microbiol Biotechnol 88:737–750. https://doi.org/10.1007/s00253-010-2822-x

Download PDF

Version 1

posted

You are reading this latest preprint version

Trichoderma and sodium nitroprusside elicitation improves vinblastine and vincristine yield by increasing TIA pathway genes expression in cell suspension of Catharanthus roseus

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Callus induction and cell suspension

Procurement, culture of fungi and preparation of elicitor

Enzyme activities assessment

Extraction and assay of vinblastine and vincristine

Total RNA extraction and gene expression analyses

Statistical analysis

Results

Callus induction and cell suspension

Enzymes Activities

Expression analysis of TAs biosynthetic genes

Vinblastine and vincristine alkaloid yield

Correlation between phytochemical, molecular and metabolic evaluations

Discussion

Conclusion

Declarations

References

Status:

Version 1