Isolation and molecular characterization of root nodules bacteria on inoculated Bambara groundnut (Vigna subterranea (L) Verdc) Accessions

doi:10.21203/rs.3.rs-2886776/v1

Download PDF

Research Article

Isolation and molecular characterization of root nodules bacteria on inoculated Bambara groundnut (Vigna subterranea (L) Verdc) Accessions

https://doi.org/10.21203/rs.3.rs-2886776/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Soils in the tropics have often shown diverse reduction in the population of bacteria due to the pressure on the agricultural system with the nature of the climatic conditions, which eventually affect soil health. High priority has been placed on rhizobia inoculants over the inorganic fertilizer by farmers and this has led to the onset of great research on tropical rhizobia strains. In this study, bacteria isolates from root nodules of inoculated Bambara groundnut (BGN) were characterized using 16S rRNA gene, nitrogen fixing gene (nifH) and nodulating gene (nod A and nodC ). The result of the 16S rRNA revealed that the root of BGN are mostly associated with Bradyrhizobium spp (B. spp), which include: B. diazoefficiens, B. japonicum and Rhizobium spp in the screenhouse. The nifH, nod A and nod C gene analysis revealed that Streptomyces bacillaris, Pseudomonas knackmussi, B. ekanii, Sinorhizobium meliloti, Mesorhizobium spp, Bradyrhizobium spp and Rhizobium spp were isolated from the field in two locations (Ibadan and Ikenne). The rhizobia isolates have been previously confirmed to be playing an important role in nodulation and nitrogen fixation of BGN. The result of the study, therefore, revealed the isolation of bacteria species from the root nodules of BGN accessions using molecular techniques.

Bacteria

underutilized legume

16S rRNA

nifH

nod A and nod C

Nitrogen fixation and nodulation of rhizobia are most important factors in understanding the symbiotic relationship with legumes (1). The microbial communities in the roots are usually recruited from large and diverse pool of microbes in bulk soils through root exudate chemical signaling (2,3). The rhizosphere, which is the medium between plants and soil, has been labelled a hotspot for new genes and biomolecules (4).

Several genes are present in the nodulation process; the early nodulation genes, which include nod ABC, are responsible for the important structure of the Nod factors (5). The terminology ‘biovar’ has been frequently used in bacteria taxonomy to group and categorize strains of the same species with different physiological characters (6). In rhizobia research, it refers to strains symbiotic with the same host species (7). The characterization and relationship of peanut and Bradyrhizobium spp applying a molecular approach with the evaluation of housekeeping and symbiotic gene sequences was recently carried out in China (8) and South Africa (9) showing a large diversity of bacteria isolates. (10) postulated that the bacteria isolates studied from two different regions of South Africa were classified as B. kavangense, B. stylosanthis, B. elkanii and B. manauense along with four bacteria isolates which are close to B. diazoefficiens. (11) showed that among 36 bacteria isolates, 11 of them were closely related to B. japonicum and other 21 to B. guangxiense, in addition to other four bacteria related to B. iriomotense. The evaluation of symbiotic gene sequences is important to indicate the range of hosts nodulated by the bradyrhizobia isolates due to the determination of their “symbiovar” affiliation (12).

In addition, the concomitant evaluation of the sequences of housekeeping and symbiotic genes lead to a better understanding of the taxonomic position and phylogenetic relationships of the bacteria isolates (13). (14) reported that members of the family Burkholderi-aceae, class β-proteobacteria, called β‐rhizobia, also nodulate legumes. Furthermore, it was recorded that rhizobial bacteria have been well develop and was examined and detected not to be the only microorganism isolated from the root of nodules of legumes (15). (5) reported that non‐rhizobial bacteria isolated from the nodules of legumes are primarily Bacillus, Enterobacter, Agrobacterium, Acinetobacter, Paenibacillus, Pantoea, Mycobacterium, Micromonospora and Pseudomonas. Therefore, the aim of this study is to isolate, identify, and characterize bacteria using molecular technique, from the nodules of inoculated BGN accessions in the screenhouse and in two different geographical locations (Ibadan and Ikenne) in Nigeria.

Pot experiment

The experiment in the glasshouse was set up in (August and December) 2018 and 2019 using plastic pot filled with 10kg sterile soil (autoclaved) and two seeds each of the accession of BGN were sown in the sterile soil and after emergence (ten days), Broth solution of the each of the Bradyrhizobium japonicum strains (FA3, USDA110, RACA6 and IRJ2180A) were inoculated separately to each accessions of BGN. Sterile water was applied on regular interval to the seedlings of BGN accessions and at 50% flowering, plant samples were removed from the soil to examine the nodules for further analysis (molecular analysis).

Field experiments

The field experiments were set up in two location (Ibadan and Ikenne) between August and December 2019, 2meter plot were made with the aid of a tractor driven plough and a spacing of 1m apart between plots was created. Seeds of BGN accessions were coated with the Bradyrhizobium japonicum strains (FA3, USDA110, RACA6 and IRJ2180A) separately and allow to dry before planting on the field in both locations. Plant growth and development were sustained in both locations with the aid of adequate precipitation. At 50% flowering, seedling of BGN accession were examined for the nodulation and fixation potential and nodules were carefully removed for further analysis.

Nodule Extraction and Preparation

Nodule were carefully removed from root of accessions of BGN, nodules isolated from the screenhouse in 2018 and 2019 cropping seasons and from the field in two locations namely Ibadan and Ikenne in 2019 season were prepared into broth solution in Soil Microbiology Laboratory at IITA and samples in maccartny bottles and were taken to Bioscience Centre for molecular analysis (DNA Extraction, PCR and Sequencing) at (IITA) headquarters, Ibadan, Nigeria. The 16S primers was used during the determination of PCR of the nodules extracted from the screenhouse while the nifh, nod A, and nod C primers were used to determine the nodules extracted from the field.

Isolation of Bacterial from root nodules of BGN accessions

Recovering of nodules from the root of BGN accessions involves the removal of outside contamination by thorough washing of the root and nodules in water. Samples were collected at 50% flowering in the glasshouse and on the field with water. Nodules were washed in Gooch crucible/ glass vial (desiccators). After washing, the crucible containing the nodules was dipped into a petri dish containing mercury chloride solution (Conc. 1:1000). Floating nodules were held beneath surface of the liquid about two to five minutes. Large nodules were held in the solution much longer without injury to the nodule content. The crucible containing the nodules was removed from the mercury chloride solution and immersed into successive dishes of sterilized water (washing all mercury chloride from nodules). It was placed in a sterile petri dish with sterile forceps. Nodules were then open with sterile knife while the inoculating needle was used to carry one drop of sterile water into the centre of the broken surface and rotated slightly to secure the bacteria. The material was transferred into a drop sterilized water in a petri dish and was stirred to distribute the organism. Sterilized needle was used to transfer the loop-full of the culture to a second petri dish and it was stirred and transferred to the third petri dish. The rhizobia isolates which would be considered as representative strains were selected for further molecular studies [16].

Culturisation

Broth preparation

Yeast mannitol broth (mannitol-10 g, magnesium sulphate 0.1 g, sodium chloride-0.05 g, potassium phosphate- 0.25 g and yeast extract- 0.25 g) was prepared in conical flasks and sterilized at 121°C for 15 minutes. Isolates from the nodules of the accessions of BGN and indigenous rhizobia in the soil (nodules from uninoculated control) were placed in a rotator shaker for 7 days at 28°C with a revolution of 100 rev/ min [16].

DNA extraction

Twenty-six and seventy-one pure isolates were characterized using the 16S rRNA gene approach in the glass house in the first and the second season respectively while seventy pure isolates were obtained from two locations (Ibadan and Ikenne) on the field in the first and second season, using the nifh, Nod A and Nod C gene. Genomic DNA was extracted from pure bacteria isolates, using ZR Bacterial DNA miniprep™ Kit according to the recommendation by Zymo Research Corp South Africa—the manufacturer. The concentration and the purity of the DNA were estimated using the namedrops lite spectrophotometer, (Thermo Scientific Inc, USA) at 260–280 nm and by the horizontal gel electrophoresis (Thistle Scientific Ltd, USA) on a 0.8% (w/v) agarose gel at 100 V for 30min and was visualized under UV after staining with GelRed TM (Thermo Scientific Inc, USA). The PCR cocktail mix consist of 2.5µl of10x PCR buffer, 1µl of 25Mm MgC12, 1 µl each of forward and Reverse primers for the 16S rRNA gene (27F:AGAGTTTGATCMTGGCTCAG), (1525R:AAGGAGGTGWTCCARCCA), nifH gene ( F: AAGTGCGTGGAGTCCTCCGGTGG) (R:GTTCGGCAAGCATCTGCTCG),NodC(F:AYGTHGTYGAYGACGGTTC)(R:CGYGACAGCCANTCKCTATTG),NodA(F:TTTGAGCCCGACCCCCGA)(R:CCGTTTCGGTCGCTGATGGC) 1 µl of DMSO, 2 µL OF 2.5mMDNTPs, 0.1 µl of 5 µl/ul Taq DNA polymerase, and 3µl of 10ng/µl DNA. The total reaction Volume was made up to 25 µl using 13.4 of nuclease-free water. PCR was determined in gene Amp PCR System 9700 thermo cycler (Applied Biosystems), with an initial denaturation at 94°C for 5min, followed by 36 cycles of denaturation at 94°C for 30sec, annealing temp at 56°C for 30sec and elongation at 72°C for 45 sec. A final elongation procedure at 72°C For 7min and a hold temperature at 10°C and an amplified fragment was visualized on a safe view-stained 1.5agarose gel electrophoresis. Products were purified using ethanol and the EDTA precipitation protocol developed in Bioscience Centre at IITA. The purified PCR products were sequenced at the Iqaba, South Africa, using ABI3500 genetic Analyser (Applied Biosystems, Thermo Fisher Scientific Inc, USA). The sequence that were generated were analyzed using the NCBI BLAST portal (17).

Data Analysis

Sequence was submitted to the NCBI BLAST portal (www.ncbi.blast.Inm.nih.gov) for the sequence similarity search and the sequence that were greater than 75% similarity were retrieved for phylogenetic analysis (18).

The DNA of bacterial isolated from BGN accessions in the glasshouse and on the field in both locations showed the presence of rhizobial (Figure I and V). Also, The PCR obtained from the isolate of BGN accessions in the glasshouse and in both locations in the field showed the presence of bacterial in the gel picture (Figure II and Fig VI). Furthermore, the phylogenetic tree of the isolate from BGN accessions in the glasshouse experiments in the first season and both season combined showed the presence of different Bradyrhizobium spp (Figure III and IV). Moreso, the Phylogenetic tree built using the Nod A and Nod C on the field in both location showed the presence of Bradyrhizobium spp, rhizobium, sinorhizobium and mesorhizobium (Figure VIII and IX). The Phylogenetic tree obtained using the nitrogen fixing gene (nifh) on the field in both locations showed the presence of pseudomonas spp and streptomyces spp (Figure VII). The result obtained showed diverse bacterial responsible for the nodulation of the accessions of BGN in the glasshouse and on the field in both locations. The result obtained further revealed the nodulation and fixation of BGN accession was not base only on the inoculated Bradyrhizobium japonicum strains but on the indigenous bacterial present in the soil in the glasshouse and on the field in both locations.

Twenty-six and Seventy-one pure isolates were respectively characterized using the 16S rRNA gene approach in the screenhouse for the first and the second seasons. The difference in percentage recovery of rhizobia in the two seasons may be probably due to differences in seasons. The indigenous strains recovered alongside the B. japonicum strains used to inoculate Bambara groundnut accessions were mostly Bradyrhizobium spp. but also included the Rhizobium spp. This was similar to the findings of (19, 20 and 21) where the biodiversity of the rhizobia nodulating Bambara groundnut is diverse including microorganisms that belong to both α and β rhizobia spp. but they were mostly the Bradyrhizobium spp.

Furthermore, seventy pure isolates obtained from the field of two locations (Ibadan and Ikenne) were used for detection of nodulation genes nifH, Nod A and Nod C gene. The amplified genes had about 50bp in the three genes which was different from the findings of (22) which showed that the amplification of the nifh resulted in a single band at 601bp. While Nod A had a faint band at 666bp, the report in (23) held that Nod A had a single band at 100bp. It is evident that these genes are present in rhizobia-nodulating Bambara groundnut accessions, playing an important role but may vary in size from strain to strain probably due to difference in genetic arrangements.

The results of the study in both the screenhouse and on the field revealed the presence of Bradyrhizobium spp. and Rhizobium spp. in the root of Bambara groundnut accessions which is in accordance with the results obtained by (24) in which sequence analysis revealed that uncultured bacteria, Actinobacterium, Bradyrhizobium spp. and Sphingomonas spp. were common in the samples where maize plants were cultivated.

A great diversity of rhizobia is able to nodulate BGN accessions but the most common rhizobia nodulating BGN are Bradyrhizobium spp. In addition, Bradyrhizobium japonicum can effectively nodulate the underutilized legume. Nevertheless, further studies may need to be carried out to also study potential of indigenous rhizobia in the soils. The nodulation genes Nod A, Nod C and nitrogen fixing gene nifh were present in all the strains isolated and are important for the process of nodulation and nitrogen fixation of BGN accessions.

Acknowledgements

The authors are grateful to the Genetic Resources Center of the International Institute of Tropical Agriculture, Ibadan, Nigeria for germplasm, facilities and financial support.

Declaration of competing interest

The authors declare that they have no conflict of interest.

Author contributions

TDB conception and design, Data collection and analysis, sample preparation, original draft preparation and the submitting author, OOB and OO supervised and edit the manuscript, MA project administrator. All authors discussed the research article and contributed to the final manuscript.

Data Availability

Data presented in this study will be available on a fair request to the corresponding author.

Ethics Approval

Not applicable to this paper

Adedeji AA, Babalola OO (2020) Secondary metabolites as plant defensive strategy: a large role for small molecules in the near root region. Planta 252(4):1–12 [2]
Ajayi OO (2020) Effects of combined inoculation of bambara groundnut (vigna subterranean l. verdc.) with glomus mossea and Bradyhrhizobium japonicum on nitrogen and phosphorous uptake in shoot, plant biomass, leaf chlorophyll and mycorrhizal inoculation efficiency (mie). [23]
Babalola OO, Alawiye TT, Rodriguez Lopez CM, Ayangbenro AS (2020) Shotgun metagenomic sequencing data of sunflower rhizosphere microbial community in South Africa. Data in Brief 31:4
Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Ostell J, Pruitt KD, Sayers EW (2018) GenBank. Nucleic acids research, 46(Database issue), p.D41. [18]
Bumunang EW, Jordaan K, Barros E, Bezuidenhout C, Babalola OO (2015) Analysis of rhizobacterial community in field grown GM and non-GM maize soil samples using PCR-DGGE. J Agric Technol 11:831–838 [24]
Chen J, Hu M, Ma H, Wang Y, Wang ET, Zhou Z, Gu J (2016a) Genetic diversity and distribution of bradyrhizobia nodulating peanut in acid-neutral soils in Guangdong Province. J Syst Appl Microbiol 39(6):418–427 [8]
Chen J, Hu M, Ma H, Wang Y, Wang ET, Zhou Z, Gu J (2016b) Genetic diversity and distribution of bradyrhizobia nodulating peanut in acid-neutral soils in Guangdong Province. Syst Appl Microbiol 39(6):418–427 [10]
Delamuta JRM, Ribeiro RA, Menna P, Bangel EV, Hungria M (2012) Multilocus sequence analysis (MLSA) of Bradyrhizobium strains: revealing high diversity of tropical diazotrophic symbiotic bacteria. J Brazilian Journal of Microbiology 43(2):698–710 [13]
Etesami H (2022) Root nodules of legumes: a suitable ecological niche for isolating non-rhizobial bacteria with biotechnological potential in agriculture. Current Research in Biotechnology. [5]
Hartman K, Tringe SG (2019) Interactions between plants and soil shaping the root microbiome under abiotic stress. Biochem J 476(19):2705–2724 [3]
Haukka K, Lindström K, Young JPW (1998) Three phylogenetic groups of nodA and nifH genes in Sinorhizobium and Mesorhizobium isolates from leguminous trees growing in Africa and Latin America. Appl Environ Microbiol 64(2):419–426 [22]
Hungria M, Mendes IC (2015) Nitrogen fixation with soybean: the perfect symbiosis? Biological nitrogen fixation:1009–1024[12]
Ibny FY, Jaiswal SK, Mohammed M, Dakora FD (2019) Symbiotic effectiveness and ecologically adaptive traits of native rhizobial symbionts of Bambara groundnut (Vigna subterranea L. Verdc.) in Africa and their relationship with phylogeny. Sci Rep 9(1):1–17 [19]
Igiehon NO, Babalola OO (2018) Rhizosphere microbiome modulators: contributions of nitrogen fixing bacteria towards sustainable agriculture. Int J Environ Res Public Health 15(4):574 [1]
Jain D, Kumari A, Saheewala H, Sanadhya S, Maheshwari D, Meena RH, Singh A, Gera R, Mohanty S (2020) Biochemical, functional and molecular characterization of pigeon pea rhizobia isolated from semi-arid regions of India. Arch Microbiol 202(7):1809–1816 [7]
Kanu SA, Dakora FD (2012) Symbiotic nitrogen contribution and biodiversity of root-nodule bacteria nodulating Psoralea species in the Cape Fynbos, South Africa. Soil Biol Biochem 54:68–76 [20]
Krasova-Wade T, Neyra M (2007) Optimization of DNA isolation from legume nodules. Lett Appl Microbiol 45(1):95–99 [17]
Martínez-Hidalgo P, Hirsch AM (2017) The nodule microbiome: N2-fixing rhizobia do not live alone. Phytobiomes 1(2):70–82 [15]
Mohale KC, Belane AK, Dakora FD (2014) Symbiotic N nutrition, C assimilation, and plant water use efficiency in Bambara groundnut (Vigna subterranea L. Verdc) grown in farmers’ fields in South Africa, measured using 15 N and 13 C natural abundance. Biol Fertil Soils 50:307–319 [21]
Mukhtar S, Hirsch AM, Khan N, Malik KA, Humm EA, Pellegrini M, Shi B, Briscoe L, Huntemann M, Clum A, Foster B, Foster B, Roux S, Palaniappan K, Varghese N, Mukherjee S, Reddy TBK, Daum C, Copeland A, Ivanova NN, Kyrpides NC, Shapiro N Eloe-Fadrosh, E.A., Maymon, M., Mirza, M.S., [14]
Puozaa DK, Ahiabor B, Dakora FDJ (2015) Effects of seed flavonoid and anthocyanin content on the symbiotic performance of Bradyrhizobium-inoculated Bambara groundnut (Vigna subterranea L.) landraces. South Afr J Bot 98:198 [11]
Puozaa DK, Jaiswal SK, Dakora FDJ (2017) African origin of Bradyrhizobium populations nodulating Bambara groundnut (Vigna subterranea L. Verdc) in Ghanaian and South African soils. J PloS one 12(9):e0184943 [9]
Teresa MS, Goma-Tchimbakala J, Eckzechel NSA, Aimé LA (2021) Isolation and characterization of native rhizobium strains nodulating some legumes species in South Brazzaville in Republic of Congo. Adv Bioscience Biotechnol 12(01):10 [6]
Vincent JM, Nutman PS, Skinner FA (1979) ; The identification and classification of Rhizobium. In Identification Methods for Microbiologists, 2nd edn. pp. 49–69 Edited by Skinner F. A., Lovelock D. W. London: Academic Press; [16]

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Isolation and molecular characterization of root nodules bacteria on inoculated Bambara groundnut (Vigna subterranea (L) Verdc) Accessions

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Pot experiment

Field experiments

Nodule Extraction and Preparation

Isolation of Bacterial from root nodules of BGN accessions

Culturisation

Broth preparation

DNA extraction

Data Analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1