Patients and specimens
A total of 13 pancreatic neuroendocrine tumour specimens, 7 non-small-cell lung cancer specimens and 7 colon cancer specimens were recruited for analysis. Specimens were fixed in formalin and embedded in paraffin at the Diagnostic Histopathology Laboratory of Southwest Hospital of Third Military Medical University. All patients consented to an institutional review board-approved protocol that allows comprehensive analysis of tumour samples (Ethics committee of Southwest Hospital, Third Military Medical University (Army Medical University), Chongqing). This study conforms to the Declaration of Helsinki.
Mouse Model
Four-week-old female nu/nu mice were approved for use by the Institutional Animal Care and Use Committee of the Third Military Medical University (Chongqing, China). Animal care was provided in accordance with the Guidelines for the Care and Use of Laboratory Animals. To establish xenografts, 3 × 107 BON cells in 100 µL PBS and 100 µL Matrigel were implanted subcutaneously into nude mice. After the tumour size reached ~ 100mm3, the animals were assigned randomly to 2 groups (control group and treatment group), with 2 mice for each group. The body weights of mice were similar each group at the assignment day. PBS (control group) or 50 µg anti-NRP2 antibody (R&D AF567) (treatment group) was injected intratumourally every other day, for a total amount of 200 µg. Tumour sizes were observed every other day. Mice were sacrificed 7 weeks after BON cell injection, and the xenografts were harvested and placed in 10% formalin for section preparation. The xenograft volume was calculated as VT = [ l (length) × w2 (width)] × 0.52. Nude mice without tumours were excluded.
Cell Lines And Culture Conditions
BON cells were grown in DMEM/F12 medium supplemented with 20 mM L-glutamine and 10% foetal bovine serum. βTC3 cells were cultured in RPMI 1640 medium supplemented with 2 mM L-glutamine and 10% foetal bovine serum (100 µg/mL). HUVECs and HUVECs overexpressing NRP2 were grown in F-12K medium supplemented with 10% foetal bovine serum. All cell lines were cultured in medium supplemented with 100 µg/mL penicillin and 50 µg/mL streptomycin at 37 °C under an atmosphere of 5% CO2 and passaged using standard cell culture techniques.
Western Blot Analysis
Western blotting was performed with the following antibodies: VEGF receptor 2 (2479S, Cell Signaling), NRP2 (ab185710, Abcam), phospho-VEGF receptor 2 (Tyr951) (4991S, Cell Signaling), CD31 (ab28364, Abcam), CD34 (ab81289, Abcam), GAPDH (5174S, Cell Signaling), cofilin (5175S, Cell Signaling), phosphorylated cofilin (Ser3) (3313S, Cell Signaling), and SSH1 (ab76943, Abcam). Cells were lysed in RIPA buffer containing a protease inhibitor mixture (Roche) and incubated on a rocker at 4 °C for 15 min. The protein concentration of the lysates was measured using a BCA protein assay kit (Qiagen), and equal amounts of protein were separated by 10% SDS/PAGE, transferred to PVDF membranes and probed with the indicated primary antibodies. Then, the blots were incubated with species-specific HRP-conjugated secondary antibodies, and the immunoreactive bands were visualized by enhanced chemiluminescence (ECL, Pierce). Three independently experimental was repeated.
Cellular F-actin/g-actin Assay
F-actin and globular actin (G-actin) fractions were obtained using an F-actin/G-actin assay kit (BK 037, Cytoskeleton). Scrape cells in LAS2 buffer which contains detergents and will disrupt the cell membrane. Gently homogenize to lyse the cells in LAS2 buffer. Then, centrifuge the lysate at 350 g (approx. 2,000 rpm in a table top microfuge) for 5 min, room temperature to pellet unbroken cells or tissue debris. Centrifuge 100 µl of the supernatant from Step 3, at 100,000 g, 1 h, 37 °C to separate F-actin from soluble G-actin. At last, analyze supernatant for actin content (G-actin in the supernatant versus F-actin in the pellet) by Western blot.
Phalloidin Staining
Whole cell phalloidin staining was performed according to the manufacturer's protocol (Sigma P5282). Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) and viewed with Olympus IX71.
Analysis Of Triton-soluble And Insoluble Actin
To measure Triton-soluble actin, cytoskeletal proteins were extracted and subjected to Western blot analysis with the indicated antibodies as previously described [20].
Immunohistochemistry
Paraffin-embedded tissue sections were routinely dewaxed, rehydrated, and prepared for immunohistochemistry. Antigen retrieval was performed using sodium citrate. The sections were then incubated in H2O2 (3%) for 10 min, blocked in 1% bovine serum albumin for 60 min and incubated with fistary antibody at 4 °C overnight. After incubation with a secondary antibody for 60 min, the specimens were incubated with H2O2-diaminobenzidine until the desired staining intensity was observed. The sections were counterstained with hematoxylin, dehydrated and mounted. The results were verified by 2 independent individuals. Immunohistochemical staining was evaluated in accordance with the immunoreactive score (IRS), in which IRS = staining intensity (SI) X percentage of positive cells (PP). SI was scored as follows: negative SI = 0; weak SI = 1; moderate SI = 2; and strong SI = 3. Similarly, PP was scored as follows: negative PP = 0; 10% PP = 1; 11–50% PP = 2; 51–80% PP = 3; and > 80% PP = 4. IRS ≥ 6 identified as “high” expression level, IRS < 6 identified as “low” expression level. Immunohistochemistry was performed with an antibody against CD31 (ab28364, Abcam), a rabbit monoclonal antibody against VEGF receptor 2 (2479S, Cell Signaling), and a rabbit polyclonal antibody against NRP2 (ab185710, Abcam).
Plasmid Construction, Retrovirus Infection, And Stable Cell Line Establishment
Human full-length NRP2 mRNA (NM_003872) was synthesized and integrated into the AgeI/EcoRI site of the pGC-LV-GV308 plasmid. For packaging, the lentiviral expression plasmid was co-transfected into HEK293T cells along with helper plasmids pHelper 1.0 and 2.0. Culture media containing viral particles was harvested after 48–72 h and used to infect HUVECs in the presence of polybrene. Cells stably transduced with lentiviral expression vectors were selected by treating with 2 µg/ml puromycin for 2 weeks. Stably transduced cell lines were seeded in 6-well plates at 140000 cells per well. To induce the NRP2 transgene, the cells were then treated with 12 µg/ml doxycycline for 2 days. A stable cell line transfected with an empty vector was established as a negative control.
Sirna Transfection
siRNAs against NRP2, cofilin, SSH1 and a non-targeting siRNA (siCtrl) were purchased from Shanghai Genechem Co.,Ltd. All transfection experiments were performed using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer’s instructions. Briefly, HUVECs expressing the pGC-LV-GV308 plasmid or vector containing NRP2 (in 6-well plates) were treated with 12 µg/ml dox and supernatant from BON or βTC3 cells and were approximately 70–80% confluent at the time of transfection. The cells were incubated with siRNA duplexes against NRP2, cofilin or SSH1 in Opti-MEM (Invitrogen). The medium was replaced with fresh F-12K medium 6 h after transfection. Cells were harvested 48 h after transfection to determine mRNA and protein levels. The following RNA sequences were used: RNA oligonucleotide duplex targeted to SSH1: 5’ UCGUCACCCAAGAAAGAUA 3’; RNA oligonucleotide duplex targeted to cofilin: 5’ AAGUCUUCAACGCCAGAGGAG 3’; specific NRP2 siRNA: 5’-AAAGGCTGGAAGTCAGCACTAATT T-3’; scrambled siRNA: 5’-AAAGGAGGGGCATGCCACGTTGG-3’.
Wound Healing Assay
For the wound healing assays, HUVECs stably expressing empty vector or NRP2 were previously treated with 12 µg/ml dox, seeded into 6-well cell culture plates with serum-containing medium and cultured to ~ 100% confluence. After 6 h of starvation, an artificial, homogenous wound was created by scratching the monolayer with a sterile 200-µL pipette tip. Images of cells migrating into the wound were captured after 24 h and 48 h using a microscope.
Capillary Tube Formation Assay
For the tube formation assay, Matrigel (Corning, #354248) was dissolved at 4 °C overnight, and each well of prechilled 96-well plates was coated with 100 µL Matrigel and incubated for 45 min at 37 °C. HUVECs expressing empty vector or NRP2 were previously treated with 12 µg/ml dox, resuspended in culture medium from BON or βTC3 cells and then plated at a density of 1 104/well for 12 h in a humidified 5% CO2 atmosphere. After 3.5 h, 4 h, and 6 h, the capillary-like structures of HUVECs were photographed, and the light micrograph images were stored on a computer. Tubular structures were quantified by manual counting at 100 magnification.
Gene Set Enrichment Analysis
Gene Set Enrichment Analysis (GSEA) software (http://software.broadinstitute.org /gsea/index.jsp) was used to determine whether a previously defined set of genes (from GO, KEGG, Reactome database) show statistically differences between MLP (metastasis-like primary) and IT (islet tumour) groups [21, 22]. Heatmap of 394 genes from GO:0030029 was produced using R project (https://www.r-project.org/). The enlarged figure of the heatmap was drawn with genes with significant difference (Fold change > 2, P < 0.001) between MLP and IT groups.
Statistical analysis
Statistical significance was determined by two-tailed Student’s t-test. Error bars represent the SD, as indicated in each figure legend. All experiments were repeated at least three times (biological replicates) with consistent results; however, the figures show one representative experiment (with an average of the technical replicates). Statistical significance is indicated by asterisks in the figures, as follows: *, P < 0.05; **, P < 0.005; ***, and P < 0.0005.