Patients and specimens
A total of 13 PNET specimens, 7 non-small-cell lung cancer specimens and 7 colon cancer specimens were collected for analysis. Specimens were fixed in formalin and embedded in paraffin at the Diagnostic Histopathology Laboratory of Southwest Hospital of Third Military Medical University. All patients consented to an institutional review board-approved protocol that allows for the comprehensive analysis of tumor samples (Ethics committee of Southwest Hospital, Third Military Medical University (Army Medical University), Chongqing). This study conforms to the Declaration of Helsinki.
Mouse model
Four-week-old female nu/nu mice were approved for use by the Institutional Animal Care and Use Committee of the Third Military Medical University (Chongqing, China). Animal care was provided in accordance with the Guidelines for the Care and Use of Laboratory Animals. To establish xenografts, 3 × 107 BON cells in 100 µL of PBS and 100 µL of Matrigel were intraperitoneally injected into nude mice. After the tumor size reached ~100 mm3, the animals were assigned randomly to 2 groups (control group, PBS; and treatment group, anti-NRP2 antibody), with 2 mice per group. The body weights of the mice were similar in each group on the assignment day. The treatment group received intraperitoneal injection of 50 µg anti-NRP2 antibody (R&D AF567) every other day 4 times (total amount, 200 µg); control mice received equivalent injections of PBS. Tumor sizes were observed every other day. The mice were sacrificed 7 weeks after BON cell injection, and the xenografts were harvested and placed in 10% formalin for section preparation. The xenograft volume was calculated as VT = [ l (length) × w2 (width)] × 0.52. Nude mice without tumors were excluded.
Cell lines and culture conditions
BON cells were grown in DMEM/F12 medium supplemented with 20 mM L-glutamine and 10% foetal bovine serum. βTC3 cells were cultured in RPMI 1640 medium supplemented with 2 mM L-glutamine and 10% foetal bovine serum (100 µg/mL). HUVECs and HUVECs overexpressing NRP2 were grown in F-12K medium supplemented with 10% foetal bovine serum. All cell lines were cultured in medium supplemented with 100 µg/mL penicillin and 50 µg/mL streptomycin at 37°C under an atmosphere of 5% CO2 and passaged using standard cell culture techniques.
Western blot analysis
Western blotting was performed with antibodies targeting the following proteins: VEGF receptor 2 (2479S, Cell Signaling), NRP2 (ab185710, Abcam), phospho-VEGF receptor 2 (Tyr951) (4991S, Cell Signaling), CD31 (ab28364, Abcam), CD34 (ab81289, Abcam), GAPDH (5174S, Cell Signaling), cofilin (5175S, Cell Signaling), phosphorylated cofilin (Ser3) (3313S, Cell Signaling), and SSH1 (ab76943, Abcam). Cells were lysed in RIPA buffer containing a protease inhibitor mixture (Roche) and incubated on a rocker at 4°C for 15 min. The protein concentration of the lysates was measured using a BCA protein assay kit (Qiagen), and equal amounts of protein were separated by SDS-PAGE through 10% gels, transferred to PVDF membranes and probed with the indicated primary antibodies. Then, the blots were incubated with species-specific HRP-conjugated secondary antibodies, and the immunoreactive bands were visualized by enhanced chemiluminescence (ECL, Pierce). Three independent experiments were performed.
Cellular F-actin/G-actin assay
F-actin and G-actin fractions were obtained using an F-actin/G-actin assay kit (BK 037, Cytoskeleton). Cells were scraped in LAS2 buffer containing detergents to disrupt the cell membrane before they were gently homogenized to lyse the cells. Then, the lysates was centrifuged at 350 ×g (approx. 2,000 rpm in a table-top microfuge) for 5 min at room temperature to pellet unbroken cells and tissue debris. Next, 100 µL of the resulting supernatant was centrifuged at 100,000 ×g for 1 h at 37°C to separate F-actin from soluble G-actin. Finally, the supernatant and pellet were analysed for actin content (G-actin in the supernatant versus F-actin in the pellet) by Western blot.
Phalloidin staining
Whole-cell phalloidin staining was performed according to the manufacturer's protocol (Sigma P5282). Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) and viewed on an Olympus IX71 microscope.
Analysis of Triton-soluble and insoluble actin
To measure Triton-soluble actin, cytoskeletal proteins were extracted and subjected to Western blot analysis with the indicated antibodies as previously described [20].
Immunohistochemistry
Paraffin-embedded tissue sections were routinely dewaxed, rehydrated, and prepared for immunohistochemistry. Antigen retrieval was performed using sodium citrate, after which the sections were incubated in H2O2 (3%) for 10 min to block endogenous peroxidase activity. Next, the sections were blocked in 1% bovine serum albumin for 60 min, incubated with primary antibody at 4°C overnight, and incubated with corresponding secondary antibody for 60 min. The specimens were treated with H2O2-diaminobenzidine until the desired staining intensity was observed before they were counterstained with haematoxylin, dehydrated and mounted. The results were verified by 2 independent individuals. Immunohistochemical staining was evaluated in accordance with the immunoreactive score (IRS), in which IRS = staining intensity (SI) X percentage of positive cells (PP). The SI was scored as follows: negative SI = 0; weak SI = 1; moderate SI = 2; and strong SI = 3. Similarly, the percentage of PP was scored as follows: >10% PP = 0; 10% PP = 1; 11–50% PP = 2; 51–80% PP = 3; and >80% PP = 4. An IRS≥6 was identified as “high” expression, and an IRS<6 was identified as “low” expression. Immunohistochemistry was performed with an antibody against CD31 (ab28364, Abcam), a rabbit monoclonal antibody against VEGF receptor 2 (2479S, Cell Signaling), and a rabbit polyclonal antibody against NRP2 (ab185710, Abcam).
Plasmid construction, retrovirus infection, and stable cell line establishment
The human full-length open reading frame of NRP2 mRNA (NM_003872) was synthesized and integrated into the AgeI/EcoRI site of the pGC-LV-GV308 plasmid. For packaging, the lentiviral expression plasmid was cotransfected into HEK293T cells along with the helper plasmids pHelper 1.0 and 2.0. Culture media containing viral particles were harvested 48-72 h later and treated with polybrene before infection of HUVECs. Cells stably transduced with the lentiviral expression vectors were selected by culture in the presence of 2 µg/mL puromycin for 2 weeks. Stably transduced cell lines were seeded in 6-well plates at 140000 cells per well. To induce the expression of the NRP2 transgene, cells were treated with 12 µg/mL doxycycline for 2 days. A stable cell line transfected with an empty vector was established as a negative control.
siRNA transfection
siRNAs against NRP2, cofilin, and SSH1 and a non-targeting siRNA (siCtrl) were purchased from Shanghai Genechem Co., Ltd. All transfection experiments were performed using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer’s instructions. Briefly, HUVECs expressing the pGC-LV-GV308 plasmid containing empty vector or NRP2 (in 6-well plates) were treated with 12 µg/mL dox and conditioned medium from BON or βTC3 cells and were cultured to 70-80% confluence. Then, the cells were incubated with siRNA duplexes against NRP2, cofilin or SSH1 in Opti-MEM (Invitrogen). The medium was replaced with fresh F-12K medium 6 h after transfection. Cells were harvested 48 h after transfection to determine the mRNA and protein levels. The following siRNA sequences were used: SSH1, 5′ UCGUCACCCAAGAAAGAUA 3′; cofilin, 5′ AAGUCUUCAACGCCAGAGGAG 3′; NRP2, 5′-AAAGGCTGGAAGTCAGCACTAATTT-3′; and scrambled siRNA, 5′-AAAGGAGGGGCATGCCACGTTGG-3′.
Apoptosis assay
HUVECs stably transfected with NRP2 were treated with the indicated medium for 24 h. Then, the cells were harvested, double stained with propidium iodide (PI) and FITC-Annexin V and further analysed by flow cytometry (BD Biosciences) to evaluate apoptosis rates.
Wound-healing assay
For the wound-healing assays, HUVECs stably expressing empty vector or NRP2 were previously treated with 12 µg/mL dox, seeded into 6-well cell culture plates with complete medium and cultured to ~100% confluence. After 6 h of serum starvation, an artificial, homogenous wound was created by scratching the monolayer with a sterile 200-µL pipette tip. Images of cells migrating into the wound were captured under a microscope 24 h and 48 h after scratching.
Capillary tube formation assay
For the tube formation assay, Matrigel (Corning, #354248) was dissolved at 4°C overnight, added to each well of prechilled 96-well plates (100 µL/well) and incubated for 45 min at 37°C. HUVECs expressing empty vector or NRP2 were previously treated with 12 µg/mL dox, resuspended in conditioned medium from BON or βTC3 cells, plated at a density of 1× 104/well and cultured for 12 h in a humidified 5% CO2 atmosphere. After 3.5 h, 4 h, and 6 h, the capillary-like structures of HUVECs were photographed under a light microscope, and the images were stored on a computer. Tubular structures were quantified by manual counting at 100× magnification.
Gene Set Enrichment Analysis
Gene Set Enrichment Analysis (GSEA) software (http://software.broadinstitute.org/gsea/index.jsp) was used to determine whether a previously defined set of genes (from the GO, KEGG, and Reactome databases) showed significant differences in expression between the MLP and IT groups [21, 22]. A heatmap of 394 genes from GO: 0030029 was produced using R project (https://www.r-project.org/). The enlarged figure of the heatmap was drawn with genes exhibiting significant expression differences (fold change>2, P<0.001) between the MLP and IT groups.
Statistical analysis
Statistical significance was determined by two-tailed Student’s t test. Error bars represent the SD, as indicated in each figure legend. All experiments were repeated at least three times (biological replicates) with consistent results; however, the figures show one representative experiment (with an average of the technical replicates). Statistical significance is indicated by asterisks in the figures, as follows: *, P < 0.05; **, P < 0.005; ***, and P < 0.0005.