Population
This study was registered with the Chinese Clinical Trial Registry Center (Registration No. ChiCTR1800016107) and approved by the Medical Ethics Committee of Sichuan Provincial Hospital for Woman and Children. All patients had given written informed consent. The study also conformed to the Declaration of Helsinki for Medical Research involving Human Subjects (2013 revision).
Ethnic Han Chinese patients diagnosed with POR according to the Bologna criteria [1] were enrolled from May 2018 to October 2019 and divided into three groups: group A (< 35 year old), group B (35-40 year old), and group C (> 40 year old). All patients underwent IVF-ET treatment. Patients were excluded from the study should they meet any of the following criteria: (1) Congenital uterine malformation, endometriosis, polycystic ovarian syndrome, intrauterine adhesion, single ovary; (2) Systemic lupus erythematosus and/or sicca syndrome; (3) Uncontrolled endocrinopathy such as diabetes, hyper/hypothyroidism, and hyperprolactinemia; (4) Abnormal karyotype; (5) Controlled ovarian stimulation (COS) in the past three months; and (6) Intracytoplasmic sperm injection (ICSI) cycle due to male factor infertility. Medical history was taken for all participants, including regularity of menstrual cycle, duration of infertility and pre-treatment protocols. Height and body weight (with shoes and heavy clothing taken off) were measured. Body weight index (BMI) was calculated as weight divided by height squared (kg/m2).
COS and IVF procedures
A GnRH antagonist protocol was conducted for all patients. From day 2 or 3 of the cycle, 187.5 ~ 225 IU/d human recombinant follicle stimulating hormone (rFSH) (Gonal-F, Merck Serono, Germany; Puregon®, Merck Sharp & Dohme, USA) and 75 IU/d human menopausal gonadotrophin (hMG) (menotrophin, Livzon Pharmaceutical Group Inc, Zhuhai, China) were injected. The dosage of rFSH and hMG was adjusted according to the ovarian response. Ganirelix (Merck Sharp & Dohme, USA) was administered should one of the following criteria be met: serum estradiol (E2) > 300 pg/ml, follicle diameter > 14 mm, luteinizing hormone (LH) > 10 IU/L. When the leading follicle reached 18 mm in diameter, 10 000 IU of urinary human chorionic gonadotrophin (uhCG) (Livzon Pharmaceutical Group Inc, Zhuhai, China) was injected to trigger the ovulation. Oocytes were retrieved by trans-vaginal ultrasound guidance within approximately 36 h after the trigger, and follicle flushing was not used.
Oocytes were fertilized by conventional IVF for 4-6 h. Mature oocyte was defined as being at the metaphase Ⅱ (MⅡ) stage with the first polar body visible in the cytoplasm. 17-18 h after the IVF, normal fertilized oocyte was confirmed should it contain two pronuclei (2PN). Cultured embryos were evaluated on day 3 based on the number of blastomeres and degree of fragmentation. Embryos of grade A-C on day 3 were defined as transplantable embryos [24]. One or two transplantable embryos were transferred. Luteal phase support was started on the oocyte retrieval day with the injection of 60 mg/d progesterone oil (Zhejiang Xianju Pharmaceutical Co., Ltd. Taizhou, China) or vaginal progesterone (Crinone 8% gel, Merck, Germany). The reasons for canceled cycles included follicular growth failure (10 days after COS, leading follicle diameter < 10 mm), failed oocyte retrieval at the time of follicle aspiration, no transplantable embryos (no mature oocyte, abnormal fertilization or cleavage), and accumulation of embryos and progesterone > 2.5 ng/ml on the trigger day. Clinical pregnancy was defined as detection of embryonic heartbeat. The rates of implantation, clinical pregnancy, multiple pregnancy, and miscarriage were calculated [8].
Measurement of basal endocrine parameters in serum
Endocrine parameters including E2, progesterone (P), total testosterone (TT), prolactin (PRL), FSH and LH were measured with an electrochemiluminescence immunoassay platform (Roche Diagnostics GmbH, Mannheim, Germany). Anti-Mullerian hormone (AMH) was measured with an enzyme-linked immunosorbent assay kit (Guangzhou Kangrun Biotech, Co., Ltd, Guangdong, China). Intra- and inter-assay coefficients for the above variables were set as < 5% and 10%, respectively.
Collection of FF and GCs
FF samples were carefully collected from follicles with a diameter of ≥ 18 mm, and centrifuged immediately at 700× g for 5 min. The supernatant was stored at -80℃. GCs were obtained by follicular aspiration and isolated from blood cells and cellular debris with a lymphocyte separation medium (Beijing Solarbio Science and Technology Corporation, Beijing, China) by centrifugation at 700× g for 10 min. Residual red blood cells were removed with a red blood cell lysis buffer (Solarbio Science and Technology Corporation, Beijing, China). The GCs were stored at -80℃ until the time of use. For each patient, the FF and GCs were collected from all follicles and pooled as one sample.
Determination of GDF9 and BMP15 in FF by ELISA
The concentrations of GDF9 and BMP15 in FF were measured with a commercial enzyme-linked immunosorbent assay kit (Elabscience Biotechnology Co., Ltd., Wuhan, China) by following the manufacturer’s instructions. The standard used was to make serial dilutions, i.e., 1000, 500, 250, 125, 62.5, 31.25, 15.63, 0 pg/ml, of a working solution of 1000 pg/ml before the measurement. The FF samples were thawed and mixed together, and 100 ul FF was added to each well in duplicate. The absorbance value was measured at 450 nm with a Perlong DNM-9602G microplate spectrophotometer (Perlong New Technology Co., Ltd., Beijing, China). The sensitivity of the assay was set as 9.38 pg/ml. The detection range of GDF9 and BMP15 was set as 15.36 ~ 1000 pg/ml. The concentration of GDF in some FF samples were above the range. Such samples were diluted 2 times, and 100 μl diluted FF was then added to each well. The final concentration was calculated by multiplication of the detection value and the dilution factor.
Determination of mRNA expression in GCs by quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was isolated from GCs with a RNAprep Pure Micro Kit (Tiangen Biotech Co., Ltd., Beijing, China). The purity and concentration of RNA were determined with Nanodrop-2000 (Thermo Fisher Scientific, Waltham, Massachusetts, USA) under the absorbance of 260 nm/280 nm. The RNA was reversely transcribed into cDNA using a PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa, Tokyo, Japan). The cDNA was then amplified using TB GreenTM Premix Ex TaqTM Ⅱ (TaKaRa, Tokyo, Japan) by qRT-PCR in triplicate. The PCR conditions were 95℃ for 30 s, followed by 40 cycles of 95℃ for 10 s, 60℃ for 30 s, and 65℃ for 5 s. Formation of a single product was verified with a melting curve method. GAPDH,β-actin and HPRT were used as the internal controls. The mRNA levels of the target genes were calculated with the 2-ΔCT method and expressed as fold change relative to the geometric means of the three internal controls. All PCR reactions were conducted in triplicate. Primers used in the qRT-PCR are shown in Table 1.
Table 1 Sequences of primers used in qRT-PCR
Gene
|
Primer (5'→3')
|
Annealing temperature (℃)
|
Efficiency
|
GDF9
|
F: TGGAGCATCCTTCAGCAC
R: GCAGCCTCTTCTCCCACA
|
57.2
|
98.8%
|
BMP15
|
F: TTTACCGCCATCATCTCCAA
R: TTTCCAAGCGTTAGACATCA
|
53.4
|
91.9%
|
GAPDH
|
F: ACGGATTTGGTCGTATTGGG
R: CGCTCCTGGAAGATGGTGAT
|
57.4
|
101.6%
|
β-actin
|
F: GACAGGATGCAGAAGGAGAT
R: CTGCTTGCTGATCCACATCT
|
53.5
|
99.6%
|
HPRT
|
F: CCATTCCTATGACTGTAGAT
R: CCAGTTAAAGTTGAGAGATCAT
|
51.8
|
96.5%
|
Determination of GDF9 and BMP15 in GCs by Western blotting
GCs were lysed in RIPA lysis buffer (KeyGen Biotech Co., Ltd., Nanjing, China) containing the HaltTM Protease Inhibitor Cocktail (Invitrogen, Karlsruhe, Germany). A BCA protein quantitative kit (Pierce, Thermo Fisher Scientific, Rockford, IL, USA) was used for determining the protein concentration. The total proteins (60 µg/lane) were subjected to 10% SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane (EMD Millipore, Billerica, MA, USA). The membrane was then blocked in TBST (Tris-buffered saline with Tween-20) containing 5% BSA (Bio-Rad, Hercules, CA, USA) at room temperature for 1 h, and incubated with primary antibody overnight at 4℃. The primary antibodies used in this study have included GDF9 (1:500, Beyotime Biotechnology Co., Ltd., Shanghai, China), BMP15 (1:500, Beyotime Biotechnology Co., Ltd.), and GAPDH (1:2000, Bioss, Beijing, China). After washed with TBST for three times, the membranes were incubated with secondary antibodies for 2 h at room temperature. The protein was then detected with a SuperSignal® West Pico Trial Kit (Thermo Scientific Pierce, IL, USA). Band intensity was measured with a Gel Doc XR densitometer (Bio-Rad, Hercules, CA, USA) and normalized with that of the internal control.
Statistical analysis
Data were analyzed with SPSS 17.0 software (SPSS Inc., Chicago IL, USA). Continuous variables were expressed as mean ± standard deviation (SD). The Kolmogorov-Smirnov test was used to assess the normality of data distribution. Continuous variables with normal distribution were compared using one-way ANOVA with post hoc Bonferroni test. Categorical data were compared using Chi-squared test. Significance level was set as < 0.05, and two-tailed test was used for all hypothesis tests.