Effects of temperature and salinity on tissue structure, antioxidant capacity and heat shock protein gene expression of Penaeus monodon

doi:10.21203/rs.3.rs-2947578/v1

Download PDF

Research Article

Effects of temperature and salinity on tissue structure, antioxidant capacity and heat shock protein gene expression of Penaeus monodon

https://doi.org/10.21203/rs.3.rs-2947578/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

In order to explore the influence of temperature and salinity on stress response of P. monodon, four experimental groups were set, respectively were normal temperature and normal salt (Control group), normal temperature and low salt(Group A), high temperature and low salt(Group B), high temperature and normal salt(Group C). The stress experiment was conducted for 96 hours, and the activities of acid phosphatase(ACP), alkaline phosphatase(AKP), total superoxide dismutase (T-SOD) and total antioxidant capacity (T-AOC) in hepatopancreas, the changes of tissue structure and the expression of related heat shock protein genes were measured．The results showed that the branchial structures of the three stress groups were found to be damaged to varying degrees. In Group A, AKP and ACP levels increased initially and then decreased, while T-SOD levels decreased initially and then steadily increased. In Group B and Group C, the four enzymes showed similar trends.There was no significant difference in the expression level of Hsps in the low salt group. The expression levels of Hsp-10, Hsp-60 and Hsp-90 genes showed a similar trend, and the maximum expression levels of the four genes were all at 96h. The expression levels of Hsps in muscle tissue were similar to those in hepatopancreas tissue. However, the highest expression levels of Hsp-70 and Hsp-90 in high temperature and low salt group were at 24h. Through this work on P. monodon stress responses to high temperature and low salinity, we have gained a deeper understanding of the physiological responses to environmental stressors, which will be useful in the development of protective measures for the shrimps under aquaculture conditions that replicate these stressors.

Penaeus monodon

Environmental stress

Organizational structure

Antioxidant capacity

Heat shock protein

The black tiger shrimp (Penaeus monodon) remains one of the most widely farmed species in the world and the yield of P. monodon ranks second among marine shrimp, second only to Litopenaeus vannamei. P. monodon is the species of choice for many farmers all over the word due to its rapid growth rate, low cost food requirements and ability to reach a larger size than other commonly farmed species, which is also very important in the aquaculture industries in China[1]. As an important environmental factor, water temperature plays an extremely important role in the growth, development, morphology, behavior, quantity and distribution of aquatic organisms[2]. P. monodon belongs to the ectotherm and the body temperature changes with the change of environmental temperature, which will affect the metabolism, feeding, growth, molting, survival and disease resistance [3]. Abnormal temperature is able to disrupt the normal physiological function and immune defense ability of cells, leading the susceptibility of shrimp to pathogens. Within a certain temperature range, their metabolism level will increase with the increase of environmental temperature, and at the same time, the activity of antioxidat enzymes in the tissues will be enhanced. However, too high or too low temperature is able to lead to the decrease of enzyme activity [4]. Moreover, salinity is also an important environmental factor affecting the growth and immunity of crustaceans. When the shrimp are in the normal environment, the osmolar pressure of shrimp body is relatively stable. When the salinity of the external water environment changes, shrimp must consume a lot of energy to adjust the osmolar pressure in order to maintain the stability of the internal environment of the body, thus affecting the survival, growth, reproduction, development and other physiological activities of shrimp. When the salinity is too high or too low, it will cause the imbalance of internal and external osmotic pressure in the body, acute stress of high temperature and salinity disturbs the balance of metabolism and energy supply of crustaceans, greatly reducing the energy input of the body for immune defense, and leads to the decrease of immune-related enzyme activities,which will slow down the growth rate of crustaceans, ultimately affect the growth and survival of the shrimp body[5]. Therefore, the study of the effects of temperature and salinity stress on antioxidant enzymes,expression of related genes and organizational structure will be able to provide a more in-depth understanding of the response of P. monodon to environmental stress.

2.1 Effects of temperature and salinity on tissue structure of P. monodon

Figures 1, 2, and 3 show the gill structure changes of the three experimental　groups. In the absence of stress (0h), the gill tissue structure was normal, with neatly arranged epithelial cells and blood cells.

In GroupA (FIG.1), the end of branchial lamellae expanded and the thickness of the base of branchial lamellae became uneven with increasing stress time. Blood cells transferred from the base of branchial lamellae to the end of branchial lamellae. The width of branchial lamellae increased gradually, while the gap decreased gradually. The length of branchial lamellae increased first and then decreased. The degree of blood cell disorder increased continuously, and the lamellar epithelial cells showed swelling and bending, becoming more obvious with time.

In GroupB (FIG.2), the width of branchial lamellae decreased from thick (24h) to thin (48h and 72h) and then to thick (96h). The gap changed from small to large and then to small, and the length changed from short to long and then to short. The end of branchial lamellae gradually enlarged, and with increasing stress time, blood cells gathered towards the end of branchial lamellae. The curvature of the stratified epithelium increased, and the degree of hemocyte disorder increased.

In GroupC (FIG.3), the gap between branchial lamellae gradually narrowed, the width gradually increased, and the blood cells gradually increased. The end of branchial lamellae gradually enlarged and became irregular. The gill wires showed loose connections, swelling increased, and blood cell disturbances persisted.

2.2 Effects of temperature and salinity stress on antioxidant capacity of hepatopancreas in P. monodon

Figure 4 shows the activity of ACP, AKP, T-AOC and T-SOD in the three experimental groups.

In GroupA, the activity of ACP and AKP decreased significantly at 24 hours and then showed a slow decline. There were significant differences between the experimental groups and control groups (P<0.05).With the increase of time, T-AOC also showed an increasing trend, and there were significant differences between the experimental group and the control group (P<0.05).T-SOD decreased first and then increased, and then stabilized.

In GroupB, ACP and AKP showed a decreased trend, and there were significant differences between treatment groups and control group (P<0.05).With the increase of time, T-AOC also showed an increasing trend, and there were significant differences between the experimental group and the control group (P<0.05).T-SOD increased slowly at 24 and 48 h, and increased more at 72 h, with significant differences among experimental groups (P<0.05).

In GroupC, ACP and AKP of hepatopancreas were firstly increased and then decreased.T-AOC showed an increasing trend, and there were significant differences between experimental groups and control groups (P<0.05).T-SOD firstly decreased and then increased, and the difference between 24 and 48 hours and 72 and 96 hours was significant (P<0.05).

2.3 Effects of temperature and salinity stress on heat shock protein gene expression in P. monodon

The expression levels of heat shock protein genes(Hsp10, Hsp60, Hsp70 and Hsp90) in the three groups are shown in the figures(FIG. 5 and FIG. 6).

In hepatopancreas tissue(FIG. 5), there was no significant difference in the expression level of Hsps in the low-salt group (A) at different time periods.In the high temperature and low salt group (B), Hsp10, Hsp60, and Hsp90 had no significant change in the first 72 hours and suddenly increased at the 96th hour, while the expression of Hsp70 decreased slowly in the first 72 hours and increased to the highest at the 96th hour.In the high temperature group (C), Hsp10, Hsp60 and Hsp90 had no significant change in the first 72 hours, and rose to the highest at the 96th hour, while Hsp70 showed a slow rising trend.

In muscle tissue(FIG. 6), there was no significant difference in the expression level of Hsps in the low salt group (A).The highest expression of Hsp-70 and Hsp-90 in high temperature and low salt group (B) was 24 h, Hsp10 showed a slow increase trend, while Hsp60 showed a first decrease and then increase trend.In the high temperature group (C), both Hsp10 and Hsp60 showed a slow rising trend, Hsp70 showed no significant change in the first 72 hours and rose to the highest at 96h, while Hsp90 showed a trend of first decreasing and then increasing.

3.1 Experimental materials

The experiment was conducted in Shenzhen Base of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences from September 8th to September 12th, 2022. The new national approved variety "Nanhai No. 2", which was bred and preserved by the project team, was used in the experiment. Prior to the experiment, the shrimp were removed from their breeding tank and transferred to a cement tank with a capacity of 8 cubic meters where they were kept for three days. The health condition of shrimp was judged according Rahi[1]. During this period, the shrimp were fed normally. The feeding was stopped one day before the experiment began. The average body length of the shrimp tested was 6.66 ± 0.26cm and the average weight was 3.60 ± 0.13g.

3.2 Experiment Management

The experiment was conducted in a 500L culture barrel. According to the salinity temperature range of the growth of P. monodon, four experimental groups were set, namely normal temperature normal salt (Control group), normal temperature and low salt(Group A), high temperature and low salt(Group B) and high temperature and normal salt(Group C), among which the normal temperature was 27.5 ℃, high temperature 34℃ and the low salt was 3ppt, normal salt was 30ppt. According to the results of Si ‘experiments, the safe salinity and semi-lethal salinity of 96h under acute salinity stress were determined to be 17ppt and 3ppt respectively[6]. Three replicates were set up for each group, with each replicate consisting of 40 shrimp.The heating rod with constant temperature was used for heating and temperature control, and salinity was adjusted by mixing seawater with fresh water. The shrimp were not fed during the experiment, which lasted for a duration of 96 hours. During the experiment, continuous aeration was carried out in the barrel to maintain the dissolved oxygen content higher than 6.0 mg/L, ammonia-nitrogen content was maintained not higher than1.8 mg/L and pH was maintained between 8.0-8.5. The seawater used in the experiment was filtered through a sand filter, and sterilized by ultraviolet light.

3.3 Sample collection

Samples were collected at 0, 24, 48, 72, and 96 hours of the experiment. Four shrimps were randomly selected from each replicate group, and their gill, liver, and muscle tissues were collected to observe changes in tissue structure and to determine the activity of antioxidant enzymes. Branchial tissue for slicing was preserved at 4 ° C using 4% paraformaldehyde universal tissue fixator. The gills, livers, and muscles used for determining enzyme activity were collected using cryopreservation tubes and transferred to -80℃ after 24 hours of rapid freezing with liquid nitrogen.

3.4 Primer design

Primers were designed using the Primer Premier 5.0 software, based on the corresponding sequence. The relevant primers used in the experiment are shown in Table 1.

Table 1

Primers for expression analysis
Primer name	Sequence(5’→3’)	Purpose	Amplicon Size (bp)
qHsp10-F	AGTTTGTTCCCCTGTTCGAC	Real-time fluorescence quantitative PCR	72
qHsp10-R	AGATTCCCTTTGCAGTACGG	Real-time fluorescence quantitative PCR	72
qHsp60-F	TGCACCCATCTCTGCTAATG	Real-time fluorescence quantitative PCR	127
qHsp60-R	TGCACCCATCTCTGCTAATG	Real-time fluorescence quantitative PCR	127
qHsp70-F	ATCTCGGGTCTTAATGTGCTG	Real-time fluorescence quantitative PCR	150
qHsp70-R	CTCGATGGTAAGGATGGACAC	Real-time fluorescence quantitative PCR	150
qHsp90-F	GTACAAAGATCACCCTCCACC	Real-time fluorescence quantitative PCR	139
qHsp90-R	TCCTTGTCCCTCTCCTTCTC	Real-time fluorescence quantitative PCR	139
EF-1a-qF	AAGCCAGGTATGGTTGTCAACTTT	Real-time fluorescence quantitative PCR	150
EF-1a-qR	CGTGGTGCATCTCCACAGACT	Real-time fluorescence quantitative PCR	150

3.5 Total RNA isolation and cDNA synthesis

Total RNA from all samples was extracted using the Hipure total RNA plus Mini Kit (Magen, China), following the manufacturer’s protocol. The quality and purity of RNA were evaluated by measuring the absorbance at 260 and 280 nm using the NanoDrop 2000 (ThermoScientific, USA). The integrity of RNA was verified by running 1.2% garose gel electrophoresis. The first strand of cDNA was synthesized from total RNA for gene cloning using the PrimeScript II 1st Strand cDNA Synthesis kit (TaKaRa, Dalian, China). The first strand of cDNA was amplified using the PrimeScript RT Reagent kit with gDNA Eraser (TaKaRa, Dalian, China) for real-time quantitative PCR (qRT-PCR) analysis. The cDNA was diluted to a concentration of 60 ng/µL and stored at -20℃ until further use.

3.6 Measurement and analysis

The superoxide anion radical was produced through the xanthine and xanthine oxidase reaction system. The radical then oxidized hydroxylamine to form nitrite, which was further developed into a purple color under the action of a color development agent. The absorbance of this purple color was measured using a visible light spectrophotometer. When the measured sample contained SOD, it exhibited a specific inhibitory effect on the superoxide anion radical, leading to a decrease in the formation of nitrite. In comparison, the absorbance value of the measuring tube would be lower than the absorbance value of the control if the measured sample contained SOD. The amount of SOD in the measured sample could be calculated using a formula.[7]. Acid phosphatase, alkaline phosphatase and total antioxidant activity were tested using a commercial test kit (Nanjing Jiengcheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions.

According to the method of Liu (2020a), the Primer Premier 5.0 software was used to design primers, with EF-1α serving as the internal reference gene (Table 1). For real-time PCR analysis of target genes, SYBR PremixEx Taq II (TaKaRa, Japan) was used. The target gene was quantified on a Light Cycler 480 system (Roche Diagnostics, Shanghai, China) according to the instructions: 95 ◦C for 30 s, 95 ◦C for 5 s and 60 ◦C for 30 s for 40 cycles, and 65–95 ◦C for melting curve analysis. Each measurement of all samples was repeated three times, and the expression of the gene was calculated by the 2-ΔΔct method.

3.7 Statistical analysis

The results were presented as mean ± standard deviation, and the effect was tested using one-way analysis of variance (ANOVA). If a significant difference (P < 0.05) was observed, the mean values of the groups were further compared using Duncan's multiple range test. All statistical analyses were performed using SPSS 19.0.

4.1 Effects of temperature and salinity stress on tissue structure of P. monodon

Gills are important respiratory organs of crustaceans, which are in direct contact with the external environment and play an important role in gas exchange and osmotic pressure balance, it is usually composed of gill axis and gill lobe.The branchial lobe is the most basic functional unit, which is composed of the stratum corneum, respiratory epithelium and microblood chamber.Since the gills of shrimp are directly in contact with the aquaculture water environment, it is easy to suffer from the stress of water environment, resulting in the disorder of its organizational structure and physiological function [8]. The pathogens in hemolymph are mainly absorbed or eliminated by the gill. The damage of pathogens to the gill tissue is much higher than that of other organs, and its physiological function is easy to be disturbed. Xiong Dalin et al. showed that pathological structural changes would occur in the gill tissue of Litopenaeus vannamei under combined stress of high temperature and ammonia nitrogen [9]. Chen Yining et al. found that after high temperature stress on Pikeperch Sander Lucioperca, the degree of gill tissue damage increased with the extension of 29℃ heat stress time [10]. In our study ,in hyposaline stress,the degree of blood cell disorder increased continuously, and the lamellar epithelial cells began to appear swelling and bending phenomenon, which became more and more obvious with the extension of time;Under high temperature and low salt stress, the branchial lamelloid width decreased from coarse (24h) to thin (48, 72h) and then to coarse (96h).The curvature of the stratified epithelium increased and the degree of hemocyte disorder increased;Under high temperature stress, The gill wires are loosely connected, swelling increases, and blood cell disturbances persist.The results showed that the gill structure of P. monodon was changed, and when the structure of the gill tissue is damaged, its normal physiological function will be affected. The shedding of respiratory epithelial cells weakens its ability of gas exchange, which is easy to cause tissue hypoxia. This also explains why high temperatures tend to cause severe hypoxia in aquatic animals.

4.2 Effects of temperature and salinity stress on antioxidant capacity of P. monodon

Enzymes are special proteins that catalyze biological reactions. Most of the chemical reactions in organisms are carried out under the action of catalysts.Enzyme activity can be regulated and is closely related to the conversion of different energy forms. Oxidative stress is one of the response mechanisms of animal body to environmental stress.Under normal physiological conditions, the antioxidant system of aquatic animals can remove the reactive oxygen species produced by the metabolic process in time.However, under environmental stress, a large number of reactive oxygen species will be produced in the body, resulting in body damage [11]. Prawn has a relatively complete antioxidant system, which can remove excessive reactive oxygen species in the body of prawn, thus maintaining body homeostasis [12]. SuperoxideDismutase (SOD) plays a crucial role in the balance between oxidation and antioxidant in the body. This enzyme can remove superoxide anion free radicals (O2-) to protect cells from damage, and is an important antioxidant oxidase to maintain normal metabolism of cells in the body [13]. Ren Hai et al. conducted a study on ammonia stress of Exopalaemon carinicaudaand found that with the increase of ammonia concentration and the extension of stress time, SOD activities in hemolymph and hepatopancreas of Exopalaemon carinicaudaand showed a trend of first rising and then decreasing, and SOD activities in hemolymph and hepatopancreas of groups with different ammonia concentration increased gradually with the extension of stress time [14]. Total antioxidant capacity (T - AOC) is a variety of antioxidants and antioxidant enzymes of total antioxidant level, to protect the cells and the body from active oxygen free radicals oxidative stress damage, so it can be total antioxidant capacity to evaluate biological active substances of antioxidant capacity [15]. According to the study of Zhu Mengkai and Yao Cuiluan, low temperature at 15℃ and high temperature at 31 and 35℃ can significantly increase the content of O2- in hepatopancreas of Litopenaeus vannamei [16]. Wang Yun et al. found that after 6h of 8mg/L ammonia nitrogen stress, T-AOC in hemolymph of Fenneropenaeus chinensis increased significantly, but then gradually decreased [17]. The results of this study showed that the antioxidant enzymes T-AOC and T-SOD in high temperature group and low salt group were increased to varying degrees, and the activities of antioxidant enzymes T-AOC and T-SOD in high temperature and low salt stress group were the highest. Therefore, it was speculated that high temperature and salinity single factor stress or their combination stress could induce oxidative stress reaction in the hepatopancreas of P. monodon.However, there was no subsequent downward trend, such as Wang Yun. It is speculated that the toxicity effect of salinity and temperature is far less than that of ammonia nitrogen, and the two antioxidant enzymes did not reach the critical point.

Acps are important phosphomonoester hydrolases in macrophages and play an important role in the immune response of prawn [18]. Chun-xiang ai and yuan-yuan zeng study showed that ammonia nitrogen stress lead to Scyllaparamamosain gill tissue ACP activity significantly reduced [19]. Ruan Guoliang et al. conducted heat stress experiments on Procambarus clarkii, and found that its AKP activity increased significantly at 12h, reached a peak, and then gradually decreased to a minimum, and its ACP activity increased significantly at 6h-12h, reached a peak, and then gradually decreased [20]. Xiong found that ACP activity in gill tissue of L. vannamei decreased significantly under high temperature stress and combined stress of high temperature and ammonia nitrogen [9]. In this experiment, the decrease trend of ACP and AKP in the low salt stress group was not obvious, while the ACP and AKP in the two experimental groups with high temperature stress increased rapidly in the short term and then decreased slowly, indicating that heat stress was able to stimulate the effect of immune-related enzymes, according to Yang,results, The reason for changes in AKP may be that shellfish need muchenergy to regulate the osmotic pressure balance after severe changes in osmotic pressurecaused by high and low salt, and the immune level is thus enhanced[21]. The reason for the decrease may be that the stress of high temperature and low salt exceeded the upper tolerance limit of the body. Therefore, it is speculated that P. monodon can activate the innate immune system and maintain immune homeostasis to adapt to short-term thermal stimulation.

4.3 Effects of temperature and salinity stress on heat shock protein gene expression in P. monodon

Temperature beyond the optimal limit of a particular species may cause a variety of pathophysiological disturbances that can lead to the death of the species [22]. Heat shock proteins (HSPs) are a family of highly conserved proteins that are produced in all organisms ranging from prokaryotes to higher eukaryotes [23]. HSPs are involved in many essential cellular functions, including growth and differentiation, as well as in defense functions under a wide variety of stress stimuli, such as the presence of heavy metals, anti-inflammatory drugs, UV irradiation, nutrient deprivation, microbial damage, salinity changes, and toxic chemicals [24]. HSPs may serve as biomarkers of stress and environ-mental contamination in aquatic organisms. In addition, HSPs play important roles in both innate and adaptive immune activation and responses [25]. Studies show that HSPs are involved in numerous cellular functions and the immune response. The HSP family consists of HSP60, HSP70, HSP90, HSP100, and other low-molecular mass HSPs. HSP60, HSP90, and especially HSP70, play an important role in the response to various stresses [26]. Heat shock proteins (Hsps) serve as potential biomarkersto understand the response of fish towards temperature stress. Hspplays significant role in folding, fidelity and translocation of proteins; itinhibits faulty interactions and thus, gives protection to vital cellular functions [27]. Chen et al.found that the HSPs may directly or indirectly involved in immune defense in fish, at least in the loach [28]. Hsp 70 has been shown to be synthesized in gill and liver of live salmon for the first 3 h after exposure to a thermal shock and persists in tissues with no apparent degradation for at least 12 h. Heat shocked fish with elevated intracellular levels of hsp 70 survived osmotic challenge at much higher rates than control fish, suggesting a role for this protein in osmotic adaptation [29]. Lif and Zhangm reported that HSP90 mRNA levels, in both hemocytes and gill, were induced at 2h and depressed at 8h during hypoxia stress in Fenneropenaeus chinensis [30]. Sharp et al. reported that in long-term environmental stress, Hsps increased initially to protect tissues fromstructural damage during further exposure. In catla, higher expressionof Hsp60 after 12 h exposure might help the fish to overcome the protein damage during long term exposure [31]. In M. japonicus gills, low salinity down-regulated the mRNA expression of most HSPs, but not HSP60. The expression levels of HSP70, HSP60, and HSP90 also exhibit down-regulation in the swimming crab P. trituberculatus following low salinity stress [32]. In Yang,experiment, the expression of HSP60 and HSP70 was significantly upregulated, while other HSPs decreased or had no significant change at low temperatures in crayfish. His results indicated that HSP60 and HSP70 might have stronger protective effects at lowtemperature acclimation in C. destructor[33]. In our experiment, mRNA expression of most hsps showed a low level of decline under low salinity conditions, which was consistent with the experimental results of Bao et al.Therefore, the hepatopancreas exhibit a sensitive HSPs response to promote immune process adaptation to salinity changes.These results suggest that the contribution of energy metabolism to osmotic regulation may lead to the decrease of HSP expression in gill of Apostichopus japonicus under low salinity stress. In the study of lwama et al., the mRNA expression levels of HSP60, HSP70 and HSP90 in liver of all groups increased rapidly and then decreased 1 day after pH stress.In the high temperature group, all genes showed an increasing trend on the whole[34]. However, in the high temperature and low salt group, there was no obvious rule of gene expression, so we speculated that it might be the result of the combined effect of high temperature and low salt. Increased levels of HSPs induce cell, tissue, and body tolerance to subsequent stressors, suggesting that it is possible to develop strategies to enhance tolerance to stressors by inducing cellular stress responses .

In conclusion, the gill tissue of P. monodon exhibited significant pathological changes after exposure to single factor stress or combined stress of high temperature and low salt. Physiological indices related to oxidative stress and heat shock protein gene expression were also significantly altered. High temperature stress activated the antioxidant system of P. monodon and increased the expression of HSP10, HSP60, HSP70, and HSP90 genes. On the other hand, low salt stress caused physiological disorders in gill tissue and oxidative stress, while high temperature stress intensified the toxicity of low salinity, affecting the normal physiological functions of the gill and liver of P. monodon. Changes in the activity of antioxidant enzymes may play an important role in avoiding oxidative damage. These findings may serve as a reference for further research on the response mechanism of P. monodon to environmental stress.

Author Contributions: S.J. (Song Jiang)and F.Z. conceived and designed the experiments. W.Y. (Wanli Yang)performed the bioinformatics analysis and prepared the manuscript, the table, and the figures.Q.Y ，H. J. and S.J. (Shigui Jiang) conducted the experiment Y. L.(Yundong Li), S.J. (Song Jiang) , L.Y, and D.K.collected the samples. All authors have read and agreed to the published version of the manuscript.

Funding: This study was funded by the Youth Fund of Hainan Natural Science Foundation (321QN351) Industrial Technology System of Modern Agriculture (CARS-48), Central Public-Interest Scientific Institution Basal Research Fund, South China Sea Fisheries Research Institute, CAFS (2020TD30), Special fund project for scientific and technological innovation and industrial development in Dapeng New Area (KJYF202101-08)，National key research and development plan project (2022YFD2400104), Fangchenggang Science and Technology Plan Project (Fang ke AB22013015), 2022 Provincial Rural Revitalization Strategy Special Fund Seed Industry Revitalization Project (2022-SPY-00-002, 2022-SPY-00-006, 2022-SJS-02-001).

Ethical approval declarations：The present study was approved by the Animal Care and Use Committee of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Approval number SCSFRI2021-0731). All procedures were strictly carried out according to the regulations and guidelines approved by the committee.

Competing interests：The authors declare no competing interests.

Rahi, M. L.; W. Sabbir; K. R. Salin; D. Aziz and D. A. Hurwood . Physiological, biochemical and genetic responses of black tiger shrimp (Penaeus monodon) to differential exposure to white spot syndrome virus and Vibrio parahaemolyticus. 2022, Aquaculture 546: 737337.
Zhou, J.; L. Wang; Y. Xin; W.N. Wang; W.Y. He; A.L. Wang and Y. Liu. Effect of temperature on antioxidant enzyme gene expression and stress protein response in white shrimp, Litopenaeus vannamei. Journal of Thermal Biology 2010, 35(6): 284-289.
Zhang, Y.; L. Wang; X. Ma; T. Guan; W. Shi; C. Zhu; H. Wang and J. Li. Response of antioxidation and immunity to combined influences of ammonia and temperature in red swamp crayfish (Procambarus clarkii). Aquaculture 2023, 563: 738906.
Xu, D.F.; Wang, Y.l.; Sun, .J.; Fang, Z.J. Effect of Temperature-descending Procedures and Storing Parameters on the Preservation Time of Pacific White Shrimp under Waterless Environment. Journal of Guangdong Ocean University 2019, 39(06): 101-107.
Rahi, M. L.; T. Ferdusy, S. W. Ahmed, M. N. Khan, D. Aziz and K. R. Salin. Impact of salinity changes on growth, oxygen consumption and expression pattern of selected candidate genes in the orange mud crab ( Scylla olivacea ). Aquaculture Research 2020, 51(10).
Si, M.R.； Li, Y.D.; Jiang, S.G.; Yang, Q.B.; Jiang, S.; Yang, L.S.; Huang, J.H.; Chen X. and Zhou, F.L. A CSDE1/Unr gene from Penaeus monodon: Molecular characterization, expression and association with tolerance to low salt stress. Aquaculture 2022, 561: 738660.
Wang, S.H. and J.C. Chen. The protective effect of chitin and chitosan against Vibrio alginolyticus in white shrimp Litopenaeus vannamei. Fish & Shellfish Immunology 2005, 19(3): 191-204.
Bechmann, R. K.; M. Arnberg; A. Gomiero; S. Westerlund; E. Lyng; M. Berry; T. Agustsson; T. Jager and L. E. Burridge. Gill damage and delayed mortality of Northern shrimp (Pandalus borealis) after short time exposure to anti-parasitic veterinary medicine containing hydrogen peroxide. Ecotoxicology and Environmental Safety 2019, 180: 473-482.
Xiong,D.L.; Duan,Y.F.; Xu,J.M.; Zhan,A,J.; Chen,C.X.; Zhang.J.S. Physiological responses in gills of Litopenaeus vannamei exposed to the combined stress of temperature and ammonia. Journal of Southern Agriculture 2020, 51(09): 2296-2303.
Chen, Y.; E. Liu; C. Li; C. Pan; X. Zhao; Y. Wang and Q. Ling. Effects of heat stress on histopathology, antioxidant enzymes, and transcriptomic profiles in gills of pikeperch Sander lucioperca. Aquaculture 2021, 534: 736277.
Franco, R.; R. Sánchez-Olea; E. M. Reyes-Reyes and M. I. Panayiotidis. Environmental toxicity, oxidative stress and apoptosis: Ménage à Trois. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 2009, 674(1): 3-22.
Mathew, S.; K. Ashok Kumar; R. Anandan; P. G. Viswanathan Nair and K. Devadasan. Changes in tissue defence system in white spot syndrome virus (WSSV) infected Penaeus monodon. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 2007, 145(3): 315-320.
Wu, Z. H.; You, F; Wang, Y. F. The effects of hypoxia and hyperoxia on nucleus anomaly, SOD, CAT activities and MDA content in juvenile turbot Scophthalmus maximus[J]. Journal of Shanghai Ocean University, 2011, 20(6): 808-813
Ren, H.; Li, J.; Li, J. T. Effects of acute ammonia stresses on antioxidant enzyme activities and GPx gene expression in Exopalaemon carinicauda[J]. Journal of Agro-Environment Science, 2014, 33(4): 647-655.
Sheena; E.M. Lewis; Paul M. Boyle; Karen A. McKinney; Ian S. Young; William Thompson. Total antioxidant capacity of seminal plasma is different in fertile and infertile men[J]. Fertility and Sterility,1995,64(4).
Zhu, M.K.; Yao, C.L. The impact of temperature stress on the oxygenmetabolism and energy metabolism in the hepatopancreas of shrimp Litopenaeus vannamei. Journal of fisheries of china 2015, 39(05): 669-678.
Wang, Y.; Li, J.; He Y.Y.; Duan, Y.F; Zhang, Z; Li, J.T.. Effects of ambient ammonia-N exposure on hemolymph nitrogen metabolism and antioxidantcapacity of Fenneropenaeus chinensis［J］. Journal of Fishery Sciences of China，2017, 24(1)：180-189.
Chen, Q.X.; Chen, S.L.; Sih, Y.; Zhu, L.X.; Yan, S.X. Characterization of Alkaline Phosphatase from Penaeus Penicillatus［J］. Journal of Xiamen University (Natural Science)，1996, 35（2）：257-261.
Ai, C.X.; Zeng, Y.Y. The Effects of Ammonia-N Stress on the Activities of ATPase ACP and AKP in Different Tissues and Organs of Mud Crab Scylla paramamosain［J］. Journal of Xiamen University （Natural Science），2011, 50（4）：772-778.
Ruan, G.; S. Li; N. He; L. Fang and Q. Wang. Short-term adaptability to non-hyperthermal stress: Antioxidant, immune and gut microbial responses in the red swamp crayfish, Procambarus clarkii. Aquaculture 2022, 560: 738497.
Yang, J.; Fu, Z.; Yu, G.; Ma, Z.; Wang, X. Combined Effects of Temperature and Salinity on Antioxidants in the Immune System of the Pearl Oyster Pinctada fucata. Fishes 2022, 7, 260. https://doi.org/10.3390/fishes7050260
Dalvi, R. S.; A. K. Pal; L. R. Tiwari; T. Das and K. Baruah. Thermal tolerance and oxygen consumption rates of the catfish Horabagrus brachysoma (Günther) acclimated to different temperatures. Aquaculture 2009, 295(1): 116-119.
Rupik, W.; Jasik, K.; Bembenek, J.; Widlak, W. The expression patterns of heatshock genes and proteins and their role during vertebrate's development. Comp. Biochem. Physiol. Mol. Integr. Physiol. 2011, 159, 349–366.
Asea, A.; Jean-Pierre, C.; Kaur, P.; Rao, P.; Linhares, I.M.; Skupski, D.; Witkin, S.S. Heat shock protein-containing exosomes in mid-trimester amniotic fluids. J. Reprod.Immunol. 2008, 79, 12–17.
Roberts, R.J.; Agius, C.; Saliba, C.; Bossier, P.; Sung, Y.Y. Heat shock proteins(chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 2010, 33, 789–801.
Lindquist, S.; Graig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1998, 22, 631–677.
Sharma, J.; S. P. Singh and R. Chakrabarti. Effect of temperature on digestive physiology, immune-modulatory parameters, and expression level of Hsp and LDH genes in Catla catla (Hamilton, 1822). Aquaculture 2017, 479: 134-141.
Cheng, J.; H. Li; Z. Huang; F. Zhang; L. Bao; Y. Li; L. Chen; L. Xue; W. Chu and J. Zhang. Expression analysis of the heat shock protein genes and cellular reaction in dojo loach (Misgurnus anguillicaudatus) under the different pathogenic invasion. Fish & Shellfish Immunology 2019, 95: 506-513.
DuBeau, S. F.; F. Pan; G. C. Tremblay and T. M. Bradley. Thermal shock of salmon in vivo induces the heat shock protein hsp 70 and confers protection against osmotic shock. Aquaculture 1998, 168(1): 311-323.
Lif, L.W.; Zhangm, C. Cloning of cytoplasmic heat shock protein 90 (FcHSP90)from Fenneropenaeus chinensis and its expression response to heat shock and hypoxia.CellStress Chaperones 2009, 14, 161–172.
Sharp, V.A.; Miller, D.; Bythell, J.C.; Brown, B.E. Expression of low molecularweight HSP 70 related polypeptides from the symbiotic sea anemone Anemonia viridisForskall in response to heat shock. J. Exp. Mar. Biol. Ecol. 1994, 179, 179–193.
Bao, X.N.; Mu, C.K.; Zhang, C.; Wang, Y.F.; Song, W.W.; Li, R.H.; Wang, C.L. mRNA expression profiles of heat shock proteins of wild and salinity-tolerant swimming crabs, Portunus trituberculatus, subjected to low salinity stress. Genet. Mol. Res. 2014, 13,6837–6847.
Yang, Y.; Xu, W.; Jiang, Q.; Ye, Y.; Tian, J.; Huang, Y.; Du, X.; Li, Y.; Zhao, Y.; Liu, Z. Effects of Low Temperature on Antioxidant and Heat Shock Protein Expression Profiles and Transcriptomic Responses in Crayfish (Cherax destructor). Antioxidants 2022, 11, 1779.
Park, K. and I.-S. Kwak.Salinity and bisphenol A alter cellular homeostasis and immune defense by heat shock proteins in the intertidal crab Macrophthalmus japonicus. Estuarine, Coastal and Shelf Science 2019, 229: 106381.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of temperature and salinity on tissue structure, antioxidant capacity and heat shock protein gene expression of Penaeus monodon

Status:

Version 1

Abstract

Figures

1 Introduction

2 Results

3 Methods

3.1 Experimental materials

3.2 Experiment Management

3.3 Sample collection

3.4 Primer design

3.5 Total RNA isolation and cDNA synthesis

3.6 Measurement and analysis

3.7 Statistical analysis

4 Discussions

4.1 Effects of temperature and salinity stress on tissue structure of P. monodon

4.2 Effects of temperature and salinity stress on antioxidant capacity of P. monodon

4.3 Effects of temperature and salinity stress on heat shock protein gene expression in P. monodon

5 Conclusion

Declarations

References

Additional Declarations

Status:

Version 1