Patients and samples collection
Twenty patients of gastric cancer receiving radical surgery were recruited in this study. The patients had not been treated with any therapies against the cancer before. From them, the cancer and adjacent normal tissues were collected through December 2012 until May 2015 at The First Affiliated Hospital of Jinzhou Medical University hospital. The samples were immediately frozen in liquid nitrogen and then stored at −80°C until use. The study was approved by the Ethics Committee of The First Affiliated Hospital of Jinzhou Medical University and the written informed consents were provided by the recruited patients before using the samples.
Cell culture and transfection
Human gastric cancer cell lines, BGC823 and MGC803, were obtained from Cell Bank of Type Culture Collection (Shanghai, China). The cell lines were cultured using RPMI 1640 medium with 10% fetal bovine serum (FBS; Gibco, NY, USA) at 37°C and 5% CO2.The synthetic mimics of miR-1252 were obtained from GenePharma (Shanghai, China). The sequence of circ_0000190 and PAK3 was obtained by PCR, and then inserted into pcDNA3.0 vectors (Invitrogen, CA, USA) after confirmation. As respective negative controls (NC), the scrambled RNA and empty expression vectors were used in this study. The BGC-823 and MGC803 cells were cultured in 6-well plates for 24h, and transfection was conducted according to the manufacturer’s protocol with lipfectamine 2000 (Invitrogen).
Cell proliferation assay
The BGC-823 and MGC-82C cells were plated in 96-well plates (3 × 103 cells/well). After 24, 48 and 72h of culture, the CCK-8 (Solarbio, Beijing, China) of 10 μL was added into each well and the cells were cultured for another 2h. The absorbance at 450 nm was detected using an ELx808 microplate reader (Bio-Tek, USA). The cell growth was also examined by 5-Ethynyl-20-deoxyuridine (EdU) assay. After culture of designed time points, EdU solution (Beyotime, Nantong, China) was added into each well for another 2h of culture. Then the cells were fixed in 4% PFA and nuclei were counter-stained with DAPI (Beyotime).
Transwell assay
The maintained cells were refreshed with FBS-free medium and then cultured for another 12h. After harvesting, the cells were suspended in serum-free culture medium containing 0.2% BSA at a density of 2×105 cells/mL. The cells of 100 μL were added to the upper chamber pre-coated with Matrigel (BD, CA, USA), while 700 μL complete medium was added to the lower chamber. After 48h incubation at 37°C, the cells in the upper chamber were cleaned, the chambers were fixed in 4% paraformaldehyde and stained in 0.1% crystal violet solution to observe the migrated cells in the lower chamber surface.
Wound-healing assay
With 6-well plates, the primary or transfected BGC-823 and MGC-803 cells were individually seeded. After cultured for 48h, the cell layers were scratched using 100 mL pipette tips, and was photographed. Then the cells were maintained in serum-free RPMI-1640 for 48h and photographed under an inverted microscope. The wound width was at this two time-pointes was measured using Image J software.
Terminal Deoxyribonucleotidyl Transferase (TdT)-mediated dUTP Nick End Labeling (TUNEL) assay
TUNEL assay was used to examine apoptosis in cultured gastric cells and gastric cancer tissues. The cells and the tissues were fixed in 4% PFA, and the tissues were additionally dehydrated with ethanol solution, embedded with paraffin, rehydrated with ethanol solution, and cut into sections of 4 μm thickness. Eventually, the samples were examined on cell apoptosis using One Step TUNEL Apoptosis Assay Kit (Beyotime) by the protocol, and the staining activity was detected using a fluorescence microscopy.
Colony formation
The cells were plated into 6-well plate (2000 cells/well) and cultured for 2 weeks at 37°C. Then the cells were fixed in 4% PFA and stained in 0.1% crystal violet solution. Under a microscope, the colonies were photographed and those with more than 50 cells were counted.
Flow cytometry
The cultured cells were harvested and washed with PBS. After incubation in 100 μg/ml propidium iodide (PI) for 30min at 4°C, the cell cycle was analyzed on cell cycle by flow cytometry. Some of the cells were additionally stained with Annexin V-FITC, and then were examined on cell apoptosis by flow cytometry. All cell analysis was analyzed using a FACScan instrument (Becton Dickinson, CA, USA) and CellQuest software (Becton Dickinson).
Real time PCR (RT-PCR)
Total RNAs from collected cells or tissues were extracted using Trizol reagent (Invitrogen). After spectrophotometric quantification, cDNAs were synthesized on ABI 7500 Real-Time PCR System (Applied Biosystems, CA, USA) using Primescript RT Reagents (TaKaRa, Dalian, China) according to the manufacturer instruction. With the same PCR system, RT-PCR was conducted in triplicate with the synthesized cDNA and purchased GoTaq® qPCR Master Mix kit (Promega, WI, USA). The primers for circ_0000190 were 5’- GCCGAGTGGTAACATGGGAG -3’ (forward) and 5’- AGCAGAGCAAGTGGAAACCA -3’ (reverse); those of GAPDH, 5’-TGTTCGTCATGGGTGTGAAC -3’ (forward) and 5’- ATGGCATGGACTGTGGTCAT -3’ (reverse); miR-1252, 5’- ACACTCCAGCTGGGAGAAGGAAATTGAATTCA -3’ (forward) and 5’- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAAATGAA -3’ (reverse); U6, 5’- CTCGCTTCGGCAGCACA -3’ (forward) and 5’-AACGCTTCACGAATTTGCGT -3’(reverse). The reaction process initiated with a denaturation at 94°C for 30s,and then included 40 cycles of 30s denaturation at 94°C, 20s anneal at 60°C, and 20s elongation at 68°C. GAPHD and U6 were employed as internal controls to calculate the relative levels of interested genes (2-ΔΔCT).
Western blot
Using RIPA lysis buffer (Beyotime, Haimen, China), the harvested cultured cells were lysed and the frozen cancer tissues were homogenized. The cell lysates and homogenates were centrifuged for 10min at 8000 g and 4°C, followed by collection of the supernatants. After protein concentration quantification using BCA assay (Bio-Rad, CA, USA) and subsequent denaturation at 95°C for 5min, the samples were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE), subjected to electrophoresis and transfer to polyvinylidene difluoride (PVDF) membrane (Bio-Rad). Following blocking with 5% bovine serum albumin (BSA) at room termperature for 1h, the blots were incubated overnight at 4°C with primary antibodies against PAK3, caspase-3, cyclin D, p27 and GAPDH (Santa Cruz, CA, USA), and then with HRP-conjugated secondary antibody. The immuno-reactivity was determined by ECL detection reagents (GE healthcare, USA).
Immunohistochemistry (IHC)
The collected xenograft tumor tissues from mice were cut into sections as above mentioned. They were incubated with the primary antibody of Ki-67 (Santa Cruz) at room temperature for 1h, and then with the secondary antibody. Immunoreactivity was visualized using diaminobenzidine (DAB) kit (Beyotime) and photographed under a microscope (Olympus, Japan).
Fluorescence in situ hybridization (FISH)
The cells were cultured on coverslips to exponential phase and then fixed in 4% PFA. The 4 μm sections of gastric cancer tissues fixed in 4% PFA were prepared as above mentioned. The samples received permeabilization with 0.25% Triton X-100 and hybridization in buffer containing biotin-conjugated probes (GenePharma) against circ_0000190. After blocked with 10% normal goat serum in PBS, the samples were incubated with FITC-streptavidin (Invitrogen) overnight at 4°C, washed with TBS, and then counter-stained with DAPI.
Dual-luciferase reporter assays
Circular RNA Interactome (https://circinteracto me.nia.nih.gov) and TargetScan (http://www.target scan.org) were employed to predict the interaction between Circ_0000190, miR-1252 and PAK3. Dual-luciferase reporter assays were used to detect the binding interactions. In brief, the wild sequences of circ_0000190 and PAK3 3’UTR or the corresponding mutants (MUT) were inserted into PsiCHECK-2-Report vectors (Promega), which were subsequently transfected into MCG823 cells using Lipofectamine 2000 (Invitrogen). Co-transfection with either miR-1252 mimics or the NC was conducted. About 48h after transfection, the signals were detected and the luciferase activities were calculated by firefly luciferase intensity against renilla’s.
Athymic nude model experiment
Male BALB/c nude mice of 4-6 weeks old were obtained from Guangdong Medical Laboratory Animal Center (Guangzhou, China). The mice were housed under constant temperature (20-26°C) and relative humidity (40-75%), with a cycle of 12h light/12h dark. The protocols with the mice were approved by the Ethics Committee of The First Affiliated Hospital of Jinzhou Medical University . After an acclimatization of at least 5 days, the mice were subjected to subcutaneous injection at the left flank of 1×107 of BGC-823 cells, which had been transfected with Lv-circ_0000190 or NC and individually responded. Every 7 days, the tumor volume was measured to calculate the size by the formula: 0.5×length×Width2. After 28 days, the mice were sacrificed and the tumor tissues were collected. A part was stored at -80°C and the other stored in 4% PFA until use.
Statistical analysis
All experiments were conducted for at least three independent times, and the data were expressed as mean ± SEM. With SPSS 19.0 (SPSS, IL, USA). Student’s t-test was used to for comparisons of two groups, while one-way analysis of variance (ANOVA) followed by Duncan’s test was conducted to evaluate the difference among multiple groups. P < 0.05 was considered statistically significan