Materials
Commercially pure Ti discs (15 mm in diameter and 2 mm in thickness) and screw Ti rods (2.8 mm in diameter and 6 mm in length) were provided by the Northwest Institute for Nonferrous Metal Research, Xi’an, China. CS (molecular weight 100 kDa and deacetylation degree of 95%) was purchased from Jinke Co. Ltd. (China). β-glycerophosphate disodium salt pentahydrate, calcium acetate momohydrate, APTES, GA, ascorbic acid, dexamethasone, Sirius Red, Alizarin Red and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich Company (USA). Solution RNase Erasol was bought from TIANDZ (China). α-minimal essential medium (α-MEM), fetal bovine serum (FBS), penicillin and streptomycin were obtained from Hyclone (USA). Cell count kit–8 (CCK–8), lactate dehydrogenase (LDH), 3,39-dioctadecyloxacarbocyanineperchlorate (DiO) and BCIP/NBT Alkaline Phosphatase Color Development Kit were provided by Beyotime (China). Phosphate buffered saline (PBS), 4’,6-diamidino–2-phenylindole (DAPI) were purchased from Invitrogen (USA). E. Z. N. A.TM Total RNA Kit I was obtained from OMEGA (USA). PrimeScriptTM RT reagent kit and SYBR Premix ExTM Taq II were purchased from TaKaRa (Japan). Male SD rats (6–8 weeks old) were obtained from the laboratory animal center of the Fourth Military Medical University. The antimiR–138 (CGGCCUGAUUCACAACACCAGCU) and negative control (CAGUACUUUUGUGUAGUACAA) were synthesized from Shanghai Gene Pharma Co., Ltd (China).
Fabrication of the CS-antimiR–138/HA PEM functionalized microporous Ti through LbL
Pure Ti discs were polished with waterproof abrasive paper from 400 to 1500 grids and then ultrasonically cleaned in acetone, ethanol and distilled water for 10 min each. The Ti discs were then treated in the electrolyte containing β-glycerophosphate disodium salt pentahydrate (0.02 M) and calcium acetate monohydrate (0.2 M) at 400 V DC for 5 min. After ultrasonic cleaning and drying, the fabricated MAO Ti samples were sterilized for 30 min by UV irradiation.
CS and HA were dissolved in 0.2 M sodium acetate buffer (pH = 5.5) and deionized water (pH = 5.5), respectively, at the concentration of 1 mg/ml. Both CS and HA were sterilized using a 0.22 μm syringe filter and then treated with Solution RNase Erasol Kit according to the manufacturer’s instruction. Afterwards, 100 μl antimiR–138 (20 mM in RNA-free water) was added into 1 ml final CS solution quickly followed by magnetic stirring for 10 min and incubation for 30 min at room temperature. The N/P ratio (the molar ratio of chitosan amino groups to RNA phosphate groups) in our experiment was 60, calculated with a mass per phosphate of 325 Da for RNA and mass per charge of 163 Da for chitosan (95% deacetylation). The CS-antimiR–138 NPs were then observed using a transmission electron microscope (TEM, JEM–1200EX, JEOL Ltd., Japan).
The CS-antimiR–138/HA PEM coating was then fabricated on MAO Ti via LbL. The dried MAO Ti discs were immersed in a 10 % (v/v) solution of APTES in alcohol in sealed individual containers for 2 h on the shaker. Then the MAO discs were placed in pure alcohol and sonicated for 30 min, which was repeated twice more for a total sonication time of 90 min. Afterwards, the Ti discs were rinsed with deionized water twice to remove residual alcohol and then dried. To link GA to the MAO-APTES surface, the GA solution (2.5 (v/v) in deionized water) was poured over the MAO-APTES samples ensuring complete coverage of the metal coupon. The containers were then sealed for 1 h. Afterwards, the samples were rinsed thoroughly with deionized water for 3 times. The CS dissolved in 0.2 M sodium acetate buffer (10 mg/ml, pH 5.5) was poured over the Ti surface for 20 min. After washing with sodium acetate buffer, the Ti sample was then alternatively dipped into the HA solution and CS-antimiR–138 solution for 10 min each. Every dipping step was followed by two washings with sodium acetate buffer to remove excess materials. The steps were repeated until a desired number of bilayers was obtained.
Characterization of the CS-antimiR–138/HA PEM functionalized microporous Ti
The surface morphology of the prepared Ti samples was observed by field-emission scanning electron microscope (FE-SEM, Hitachi S–4800). In order to assess the miRNA loading, Cy3-labeled miRNAs (Gene Pharma) were used to fabricate the coating. Immediately after fabrication or after 7 days of incubation in α-MEM supplemented with 10% FBS, the Ti samples were observed by a laser scanning confocal microscope layer by layer with an interlayer thickness of 400 nm (Fluo View, Olympus FV1000). The three-dimensional images were reconstructed.
Quantification of the loading and release of miRNA from the CS-antimiR–138/HA PEM functionalized microporous Ti
To measure the miRNA loading amount in each layer of the functionalized surface, 40 μl CS-miRNA nanoparticles were dropped discreetly in the experiment and incubated for 10 min. Then the coated surface was washed twice by 40 μl sodium acetate buffer. Afterwards, the washing solution was carefully collected and quantitatively analyzed by RiboGreen assay according to the manufacturer’s instruction. Finally, the miRNA loading amount in each layer was calculated by subtracting the miRNA amount in the washing solution from that of the original 40 μl CS-miRNA nanoparticles. The total miRNA loading amount in the PEM was calculated by adding the amount in each layer up.
The CS-antimiR–138/HA PEM functionalized microporous Ti samples were incubated in 300 μl PBS (pH = 7.4) at 37 °C in 5% CO2 and 100% humidity for 14 days. At 8, 16, and 24 h, and 2, 3, 4, 6, 8, 10, 12 and 14 days, the extracting solution was replaced with 300 μl of fresh PBS solution. The released miRNA in the collected PBS solution was quantified with RiboGreen assay. As a reference, a standard curve for miRNA concentration was determined with multiple dilution of miRNA in PBS and PBS alone.
Cell culture
Primary rat bone marrow MSCs were obtained from two-week-old Sprague-Dawley rats. The cells were cultured in α-MEM supplemented with 10% FBS and 1% penicillin/streptomycin and incubated in a humidified atmosphere of 5% CO2 at 37 °C. Passages 2–4 were used in this experiments. The MAO surface and tissue culture plate served as control. The medium was replaced twice every week.
Transfection efficiency assay
Here the functionalized Ti samples made of Cy3-labeled miRNAs were used. MSCs of 2.5×104/cm2 were inoculated on the Ti samples placed in the 24 well plates. After 48 h of culture, the transfected cells were harvested by trypsin, washed with PBS and fixed in 1% paraformaldehyde. To clearly observe the internalization of the Cy3-labeled miRNAs to the cells, the cells were fixed with 4% paraformaldehyde and washed in PBS. The cell membrane was stained with DiO. The cell nucleus was highlighted with DAPI. The DiO, DAPI and Cy3 fluorescence signals were then observed by the laser scanning confocal microscope. To measure the miR–138 amount in the cells, RNA in the cells was collected and reverse-transcribed using a PrimeScript RT reagent kit and a specific reverse transcription primer (Shanghai Gene Pharma Co, Ltd) according to the manufacturer’s recommendation. The miR–138 amount was quantified using a real-time polymerase chain reaction (Real-time PCR) system (CFX96™, Bio-Rad, Hercules, CA, USA) with SYBR Premix Ex Taq™ II. U6 small nuclear RNA was used as an endogenous normalization control.
Cell viability and Lactate dehydrogenase activity assay
The CCK–8 assay was employed to evaluate the cell viability according to the manufacturer’s instruction. Briefly, the reaction medium was formed by mixing serum free ɑ-MEM and CCK–8 at a ratio of nine to one. MSCs of 2.5×104/cm2 were inoculated on the Ti samples placed in the 24 well plates. After 24 h of culture, the medium was removed and the Ti samples were washed with PBS twice. Then 400 μl reaction medium was added to each well and incubated at 37 °C for 3 h. The supernatant was transferred to a 96-well plate and the optical density (OD) was determined using a spectrophotometer (Bio-tek) at 450 nm wavelength.
The LDH activity in the culture medium was used as an index of cytotoxicity. After 24 h of culture, the culture medium was collected and centrifuged, and the supernatant was used for the LDH activity assay. The LDH activity was determined spectrophotometrically according to the manufacturer’s instruction.
Cell morphology
MSCs were seeded at a density of 5 x 104 cells/well. After 24 h of culture, the Ti samples with attached cells were gently washed with PBS, fixed in 2.5% glutaraldehyde, dehydrated in a graded ethanol series and freeze-dried. After sputter coating with carbon, the cell morphology was observed by FE-SEM.
In vitro osteogenesis of MSCs
The expression of osteogenisis-related genes was evaluated using the Real-time PCR. The cells were seeded with 5 x 104 cells/well and cultured for 48 h. Then the medium was changed into osteogenic medium containing 10 mM β-glycerophosphate, 50 μg/ml ascorbic acid and 10–7 M dexamethasone. After further culture of 7 and 14 days, the total RNA was isolated using the TRIzol reagent. Then 2 μg RNA from each sample was reversed transcribed into complementary DNA (cDNA) using the PrimeScript RT reagent kit. The expression of osteogenesis-related genes including collagen type I α1 (COL1), runt-related transcription factor 2 (RUNX2), alkaline phosphatase (ALP), bone morphogenetic protein–2 (BMP–2), osterix (OSX) and osteocalcin (OCN) was quantified using Real-time PCR. The PCR reaction was carried out using SYBR Premix Ex TaqTM II on the CFX96TM Real-time PCR System. The relative expression levels for each gene of interest were normalized to that of the housekeeping gene GAPDH. The PCR primers were synthesized as shown in Table 1.
Table 1
Primers used for Real-time PCR
Gene
|
Forward primer sequence (5′-3′)
|
Reverse primer sequence (5′-3′)
|
ALP
|
AACGTGGCCAAGAACATCATCA
|
TGTCCATCTCCAGCCGTGTC
|
BMP-2
|
CAACACCGTGCTCAGCTTCC
|
TTCCCACTCATTTCTGAAAGTTCC
|
COL1
|
GCCTCCCAGAACATCACCTA
|
GCAGGGACTTCTTGAGGTTG
|
OCN
|
GGTGCAGACCTAGCAGACACCA
|
AGGTAGCGCCGGAGTCTATTCA
|
RUNX2
|
CCATAACGGTCTTCACAAATCCT
|
TCTGTCTGTGCCTTCTTGGTTC
|
OSX
|
AAGGCAGTTGGCAATAGTGG
|
TGAATGGGCTTCTTCCTCAG
|
GAPDH
|
GGCACAGTCAAGGCTGAGAATG
|
ATGGTGGTGAAGACGCCAGTA
|
ALP staining
The cell inoculation and culture was the same as in the Real-time PCR assay. After culturing for 7 and 14 days, the cells on the Ti samples were washed with PBS and fixed. ALP was stained with the BCIP/NBT ALP color development kit for 15 min. The samples were washed thoroughly with PBS to acquire the images.
Collagen secretion
The cell inoculation and culture was the same as in the Real-time PCR assay. After culture of 7 and 14 days, the cultures were washed by PBS and fixed by 4% paraformaldehyde. Then the collagen secretion was stained by 0.1wt% Sirius red in saturated picric acid for 18 h. The unbound stain was removed in 0.1 M acetic acid and then the images were collected. To quantitatively assess the collagen secretion, the stain on the samples was eluted in 500 μl destain solution (0.2 M NaOH/methanol 1:1) and the optical density at 540 nm was measured using a spectrophotometer.
ECM mineralized nodule displaying
The cell inoculation and culture was the same as in the Real-time PCR assay. After culturing for 14 and 28 days, the cells were washed twice with PBS and then fixed with 60% isopropanol for 1 min. After rehydrating with distilled water for 2–3 min, the ECM mineralized nodules formed by MSC culture were stained with 1wt% alizarin red for 3 min. After thorough washing with distilled water, the images were taken.
In vivo osseointegration
Implant surgery
The animal experiment was approved by the Animal Research Committee of the Fourth Military Medical University and conducted in accordance with the international standards on animal welfare. Twenty female Sprague Dawley rats, aged 3 months and weighing approximately 250 g, were randomly divided into 5 groups: antimiR–138 group, antimiR-control group, CS group, MAO group and polished Ti (PT) group (n = 8 for each group). The femur model was applied for implantation in this study, and the procedure of the surgery was similar to that described before [39]. Briefly, after anesthesia by pelltobarbitalum natricum, the hind limbs were prepared by shaving and cleaning using ethanol and 10% povidone iodine. Then, an incision was made over the distal side of the knee. Gentle dissection was used to move aside the ligament and patella to expose the intercondylar notch of the distal femur. For placement of the screw implant, dental burs and a surgical motor (OsseoSet 200, Nobel Biocare AB, Gothenburg, Sweden) with a low rotational drill speed (800 rpm) were used to prepare a 2.8 mm cylindrical hole at the intercondylar notch of the femur parallel to the long axis of the bone cooled continuously with sterile saline solution. Implants were inserted into the femoral medullary canal, followed by incision suture. The animals received injection of gentamicin (1 mg/kg) immediately after surgery and for five post-operative days.
Micro-CT evaluation
Specimens (femurs containing implants) were extracted (n = 4 per group) and fixed in 4% paraformaldehyde for 24 h. Then they were scanned by a micro-CT scanner (YXLON International GmbH, Hamburg, Germany). The region of interest (ROI) was defined as 2 mm height from 0.5 µm below the growth plate and 200 µm around the implant surface, and the images were analyzed via VGStudio Max 2.2 (Volume Graphic, Heidelberg, Germany). The bone volume per total volume (BV/TV), the mean trabecular thickness (Tb.Th), the mean trabecular number (Tb.N) and the mean trabecular separation (Tb.Sp) were assessed within the ROI zone.
Van Gieson Staining
After micro-CT scanning, the specimens were dehydrated with graded alcohol, and embedded in methyl methacrylate. Afterwards, thin sections (about 50 µm in thickness) parallel to the long axis of the implants were prepared using a macrocutting and grinding system (SP1600 and SP2600, Leica). Sections were then polished and stained with 1.2% trinitrophenol and 1% acid fuchsin (Van-Gieson staining). Finally, qualitative analysis of bone formation was measured with a standard light microscope (Leica) equipped with a digital image analysis system (Image-Pro Plus software, Media Cybernetics, Silver Spring, USA). Bone-implant contact (BIC) was also determined.
Line-Scanning of the Bone-to-Implant Interface
Line scanning by energy-dispersive X-ray spectroscopy (EDX, Hitachi) was applied for more detailed analysis of the bone-to-implant interface. After being fixed with 4% paraformaldehyde, dehydrated with graded alcohol, and embedded in methyl methacrylate, the bone-to-implant interfaces of the embedded samples were scanned by FE-SEM. The line-profiles of C, O, Ca, P, and Ti elements from the implant side to medullary cavity side were analyzed by EDX.
Statistical analysis
The one-way ANOVA and Turkey post hoc tests were used to determine the level of statistical significance of difference among groups. p < 0.05, 0.01 and 0.001 was set to be significant, highly significant and extremely significant, respectively.