Effects of Clostridium autoethanogenum protein on growth performance, intestine and liver health of turbot Scophthalmus maximus during grow-out phase

doi:10.21203/rs.3.rs-2949989/v1

Download PDF

Research Article

Effects of Clostridium autoethanogenum protein on growth performance, intestine and liver health of turbot Scophthalmus maximus during grow-out phase

https://doi.org/10.21203/rs.3.rs-2949989/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 31 May, 2024

Read the published version in Aquaculture Reports →

Version 1

posted

You are reading this latest preprint version

Clostridium autoethanogenum protein (CAP) is an emerging protein source with several key advantages and it has investigated on juvenile turbot (9.13 g). However, it was indicated that fish growth stage is a decisive factor for CAP performance and the influence of CAP on turbot intestine health has not been reported. Thus, it is worth investigating the effects of CAP on turbot extensively. In the present study, a 67-day feeding experiment was conducted to evaluate the effects of CAP on turbot in the grow-out phase from growth performance, intestine and liver health. Six hundred and thirty turbot with an initial body weight of about 150 g were randomly divided into 6 groups, which were fed with fishmeal-based control diet or diet with CAP to replace 15%, 30%, 45%, 60% and 75% of fishmeal protein in control diet, respectively. From growth and feed utilization, the substitution level of CAP should no more than 30%, which was less than previous reported on juvenile turbot. The palatability of the feed was linearly reduced. Although CAP did not induce enteritis, it decreased the intestine villi height in middle and intestine villi density in distal intestine. Except for decreasing the size of hepatocytes by CAP at 45% or higher substitution levels, no other abnormality observed in liver histology. However, dietary CAP reduced the triglyceride and cholesterol levels in the plasma at 30% or higher levels and linearly down-regulated genes related to lipogenesis in liver. The genes related lipid transportation and oxidation were up-regulated by CAP at the substitution levels of 15–60%. The present work confirmed the safety of CAP in fish feed and suggested more work should be conducted before it widely used in aquafeed.

Clostridium autoethanogenum

Scophthalmus maximus

intestine

liver

lipid metabolism

Turbot is one of the most important mariculture species in China and Europe (Guan et al. 2018; Fernández-González et al. 2023). Like other carnivorous fish production, turbot aquaculture traditionally relied on fishmeal as primary protein source and hampered by its high price and short supply (Campbell et al. 2022). Feed source diversification and new feed ingredient development are the key for turbot production sustainability.

Bacterial-based microbial proteins are emerging alternative protein sources with the advantage of extremely less of land occupation and water consumption (Sillman et al. 2019). Clostridium autoethanogenum protein (CAP) has recently drawn attention of aquaculture nutrition industry due to several promising advantages (Wang et al. 2022). The production of CAP accompanies with the converting industrial waste gas into ethanol, which means that CAP could be produced ecologically (Xu et al. 2023). From nutritional view, the contents of crude protein and most essential amino acids in CAP are higher than fishmeal, except arginine and histidine (Wang et al. 2022). Moreover, no toxic genes found in the complete genome sequence of C. autoethanogenum indicated that CAP has low risk potential (Norman et al. 2018). Recently, CAP was proved to successfully replace certain amount of fishmeal in the feed of black sea bream Acanthopagrus schlegelii (Chen et al. 2020), largemouth bass Micropterus salmoides (Lu et al. 2021; Ma et al. 2022; Yang et al. 2022a, b, 2023; Zhu et al. 2022), large yellow croaker Larimichthys crocea (Zhang et al. 2022; Wu et al. 2022), pearl gentian grouper (Huang et al. 2023), pufferfish Takifugu obscurus (Cui et al. 2022) or soybean meal in the feed of grass carp Ctenopharygodon Idella (Fan et al. 2022; Xue et al. 2023), Jian carp Cyprinus carpio var. Jian (Li et al. 2021) and tilapia Oreochromis niloticus (Maulu et al. 2021a, b).

In turbot with body weight of 9.13 g, CAP was proved to replace 45% of fishmeal protein (Zheng et al. 2022). Researches on L. crocea and M. salmoides showed that fish size is one of the key factors decided the optimal dietary level of CAP within the same fish species. For example, Zhang et al. (2022) proved that CAP could replace 15% of fishmeal for L. crocea with initial weight of 11.86g, higher dietary CAP (30% and 45%) reduced the growth and humoral immunity. But for the L. crocea with initial weight of 189.9 g, CAP can replace up to 30% of dietary fishmeal protein without negative effects on the growth performance, intestinal healthy condition and flesh quality (Wu et al. 2022). The situation in M. salmoides was different from L. crocea. More than 75% of fishmeal could be replaced by CAP for smaller M. salmoides (initial weight of 17.75 g) from the views of the growth and digestibility (Zhu et al. 2022) but less than 50% of fishmeal substitution level of CAP was rational for larger M. salmoides with initial weight of 110 g (Yang et al. 2023). The above research suggested that CAP should be further evaluated by larger turbot.

In addition, negative effects of CAP have been reported on fish intestine. It was observed that CAP at high dietary level decreased height of intestinal mucosal fold in L. crocea (Lu et al. 2021), M. salmoides (Yang et al. 2022b), pearl gentian grouper (Huang et al. 2023) and induced lymphocytic infiltration in O. niloticus (Maulu et al. 2021a). Fish intestine in an important organ not only for nutrients digestion and absorption but also for mucosal barrier function and healthy condition of intestine significantly influence the success of fish aquaculture (Zhang et al. 2020). Previous work on CAP in turbot lack the evaluation of intestine and it is worthy examining the effects of CAP on the turbot intestine healthy condition.

In the present study, turbot at grow-out phase with initial weight of 150 g were used to investigate CAP in turbot feed. Present work would supplement information for CAP utilization in turbot aquaculture industry.

2.1 Feed ingredients and diet formulation

A basic feed with crude protein of 48% and crude lipid content of 12% was formulated using fish meal as the main protein source and fish oil, soybean oil and soybean lecithin as the main lipid source. This diet was used as the control diet and named as CAP0. Another five isonitrogenous and isolipid diets were prepared by replacing 15%, 30%, 45%, 60% and 75% of fishmeal protein with CAP and named as CAP15, CAP30, CAP45, CAP60 and CAP75, respectively (Table 1). All ingredients except fish oil and soybean oil were grounded (less than 75 µm), mixed, extruded and pelletized into particles with diameter of 4 mm. Then, a mixture of fish oil and soybean oil were sprayed on particle surface. During the feed preparation, twin-screw extruder (TSE65, Yanggong Machine Co. Ltd, Yangzhou, China) and vacuum oil injection (SD1000KG, Zhengjiang L&B Machine Co., Ltd., Hangzhou, China) were applied. The feeds were stored under − 20 ℃.

Table 1

Formulation and proximate composition of experimental diets
	Experimental diet^a
	CAP0	CAP15	CAP30	CAP45	CAP60	CAP75
Ingredients (g/100g in dry matter)
Fish meal^b	62	52.7	43.4	34.1	24.8	15.5
Clostridium ethanolicum protein^c	0	7.5	15.0	22.5	30.0	37.5
Wheat meal	24.5	24.5	24.5	24.5	24.5	24.5
Fish oil	1.7	2.6	3.5	4.4	5.3	6.2
Soybean oil	1.7	1.7	1.7	1.7	1.7	1.7
Soybean lecithin	2	2	2	2	2	2
Premix^d	1	1	1	1	1	1
Monocalcium phosphate	1	1	1	1	1	1
Choline chloride	0.5	0.5	0.5	0.5	0.5	0.5
Calcium propionate	0.1	0.1	0.1	0.1	0.1	0.1
Ethoxyquinine	0.1	0.1	0.1	0.1	0.1	0.1
Carboxymethylcellulose	5.4	6.3	7.2	8.1	9.0	9.9
Proximate composition (% in dry matter)
Crude protein	48.24	48.25	48.23	48.23	48.22	48.22
Crude lipid	11.68	11.62	11.75	11.73	11.75	11.77
^a CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75% level in basal diet, respectively.
^b steam dried fish meal from COPENCA Group, Lima, Peru; crude protein content of 72.72% and crude lipid content of 9.65% (in dry matter).
^c from Beijing Shoulang Biotechnology Co., Ltd., Beijing, China; crude protein content of 90.40% and crude lipid content of 1.36% (in dry matter).
^d Premix formula (mg/kg diet): Vitamin A, 20; Vitamin D3, 10; Vitamin K3, 20; Vitamin C, 600; inositol, 150; niacin acid, 80; calcium pantothenate, 40; Vitamin B2, 15; Vitamin B6, 15; Vitamin B1, 10; folic acid, 10; Vitamin B12, 8; Biotin, 2; wheat middling, 220; FeSO₄·H₂O, 300; MgSO₄·7H₂O, 1200; ZnSO₄·H2O, 200; NaCl, 100; MnSO₄·H₂O, 25; CuSO₄·5H₂O, 30; CoCl₂·6H₂O, 5; Na₂SeO₃, 5; KIO, 3; Antioxidant, 50; Mold inhibitor, 200; Zeolite powder, 6682.

2.2 Experimental procedures

The apparently healthy turbot from same batch with similar weight were purchased from a commercial farm in Haiyang, China and were transferred to the indoor recirculating aquaculture system equipped with a sand filter, bio-filter, ultraviolet germicidal lamp, protein separator, oxygen supply system and temperature regulation system (Shanghai Haisheng Biological Experimental Co., LTD, Shanghai, China) in Marine Science and Technology Innovation Center of Shandong University. After two weeks of acclimation, 630 turbot with an initial body weight of 150 ± 2.5 g were randomly assigned to 18 tanks. Each tank was filled with 300L seawater. During the acclimation and 67 days of feeding period, the water temperature was kept at 15℃, dissolved oxygen 7.5–8.5, and pH 7.9–8.2. The turbot from three tanks were assigned to one diet and were fed to apparent satiation twice daily at 6:00 and 18:00. The uneaten feed was removed from the tank and dried at 70 ℃ to constant weight.

2.3 Sampling

After 67 days of feeding, turbot from each tank were anesthetized with eugenol (1:10000 diluted with seawater; Shanghai Reagent Co., Shanghai, China) and weighted. Three fish were randomly selected from each tank and directly placed in a sealed pocket and stored at -20 ℃ for whole body composition analysis. Blood samples were collected from the tail veins of another 10 fish. The plasma was obtained by centrifuging (4000×g for 10 min at 4℃) and immediately sored at -80 ℃ until use. These 10 fish were killed with a hammer blow to the head and individually weighted. And then their intestines and livers were removed and individually weighed. The middle intestine (MI), distal intestine (DI) and liver were sampled and fixed in 10% neutral formalin for 24 hours and then transferred to 70% alcohol for long-term storage for subsequent histological analysis. The liver was also sampled and placed in RNAlater ™ Solution (AM7024, Thermo Fisher Scientific Inc. Shanghai, China) and then stored at -80 ℃ for gene expression analysis. The remaining livers of fish in one tank were pooled together and stored at -80 ℃ for lipid content determination.

2.4 Chemical analysis

The moisture of whole fish was determined by the weight difference before and after 105°C drying. The dry fish were used for subsequent crude protein and crude lipid content determination. The crude protein and crude lipid content of ingredients, feeds and fish were analyzed by Kjeldahl nitrogen determinator (K9804; Shandong Haineng Instrument Co. Ltd, Dezhou, China) and petroleum ether extraction system (SZC-101; Shanghai Xianjian Instrument Co. Ltd, Shanghai, China), respectively. The amino acid profile of the feed (Table 2 and Table S1) was analyzed according to standard method (GB/T 18246 − 2019 Determination of amino acids in feeds). Liver lipid was isolated, purified and determined by soaking freeze-dried liver tissue to constant weight using a mixture of chloroform and methanol (2:1) (FOLCH et al. 1957). Plasma high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein (LDL-C), triglyceride (TG) and total cholesterol (TC) contents were determined using experimental kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China) with catalog No. A112-2-1, A113-2-1, A110-2-1 and A111-2-1, respectively.

Table 2

Amino acids profiles of the experimental diets (g/100g protein) *
	Experimental diet						Turbot amino acids requirements
	CAP0	CAP15	CAP30	CAP45	CAP60	CAP75	Kaushik (1998)	Peres and Oliva-Teles (2008)
Arginine	6.07	5.80	5.52	5.25	4.97	4.69	4.8	4.22
Lysine	7.48	7.86	8.24	8.62	9.00	9.38	5.0	5.00
Histidine	3.06	2.91	2.76	2.62	2.47	2.32	1.5	1.28
Isoleucine	4.04	4.36	4.68	4.99	5.31	5.63	2.6	2.59
Leucine	7.72	7.70	7.68	7.66	7.64	7.62	4.6	4.47
Valine	4.99	5.20	5.42	5.64	5.85	6.07	2.9	2.47
Methionine	2.90	2.86	2.83	2.79	2.75	2.72	2.7^a	1.68
Cystine	0.57	0.60	0.63	0.67	0.70	0.74	2.7^a	n.d.
Phenylalanine	5.23	5.04	4.85	4.66	4.47	4.28	5.3^b	2.54
Tyrosine	3.16	3.21	3.27	3.32	3.37	3.42	5.3^b	1.90
Threonine	4.20	4.27	4.35	4.43	4.51	4.59	2.9	2.37
Tryptophan	1.12	1.07	1.03	0.98	0.94	0.89	0.6	n.d.
^* CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75% level in basal diet, respectively.
^a Methionine + Cystine
^b Phenylalanine + Tyrosine

2.5 Histology examination

The fixed intestinal and liver samples were cut into small tissue blocks (about 50 mm³), dehydrated in ethanol, equilibrated in xylene and embedded in paraffin. Then sections of 5 µm were cut and stained with hematoxylin and eosin. The slides were observed and recorded using a Nikon Eclipse Ci-L microscope (Nikon, Tokyo, Japan). For each tissue sample from one fish, three slides were examined. For intestine sample, the healthy condition were evaluated from the aspects including height and fusion of mucosal fold, width and cellular infiltration of lamina propria and submucosa, vacuolization and nucleus position of enterocyte (Gu et al. 2017a, b). The mucosal fold density was measured by the total numbers of mucosal fold in 100 µm. For liver sample, the healthy condition was evaluated from the hepatocyte morphology, steatosis severity and inflammatory cell infiltration. For each slide of liver, at least 30 hepatocytes were randomly selected to measure the diameter.

2.6 RNA extraction and expression analysis

Total RNA was extracted from liver tissue samples using Takara RNAiso Plus (Code No. 9108, Takara Bio Inc., Beijing, China). The purity and integrity of the RNA were detected using a microspectrophotometer (Nano Drop 5000, Beijing Baitaike Biotechnology Co., Ltd., Beijign, China) and agarose gel electrophoresis. RNA sample with the OD260/OD280 ratio between 1.9–2.1 and with clear and single band in agarose gel was used for further analysis. Then, 1 µg of total RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (Code No. RR037A, Takara Bio Inc., Beijing, China). The cDNA was stored at -80 ℃.

Primer-BLAST was used to design specific primers for target genes related to lipid metabolism (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). All primers were purchased from Shanghai Sangon Bioengineering Co., Ltd. (Shanghai, China) and listed in Table 3. The optimal normalization gene was identified from six candidates by NormFinder (https://moma.dk/normfinder-software). TB Green® Premix Ex Taq™ II (Code No. RR820A, Takara Bio Inc., Beijing, China) was used for real-time quantitative reaction of five target genes. Relative quantitative analysis (2^−∆∆Ct) of the expression levels of five target genes with ribosomal protein S4 gene as the housekeeping gene were expressed as fold change.

Table 3

Primer sequences used for real-time PCR
Gene	Forward sequence (5′ − 3′)	Reverse sequence (5′ − 3′)	Accession	Tm (℃)	Amplification efficiency (%)
RPS4*	CAACATCTTCGTCATCGGCAAGG	ATTGAACCAGCCTCAGTGTTTAGC	XM_035608277.1	60	99.4
RPL17*	ACCAGTGCGTCCCCTTCA	CTCATCTTCGGAGCCTTGTTC	DQ848879	60	104.1
GAPDH*	CGCCCATAGCCCAGTCATAGC	TGGCAGAGGGAGGTGGAGAG	XM_047333056.1	60	103.2
ACTB*	GTAGGTGATGAAGCCCAGAGCA	CTGGGTCATCTTCTCCCTGT	EU686692.1	60	97.6
UBQ*	GCGTGGTGGCATCATTGAGC	CTTCTTCTTGCGGCAGTTGACAG	FE946708.1	60	102.2
B2M*	CTCTGGCTGTTTTCGTCTGCT	TCCTTTCCGTTCTCTCCCG	DQ848854.1	60	103.3
LPL	GTATGGAACCAACGCAGAGAAGG	GTGGTGATGAGGAACGACAGAGTG	JQ690822.1	61	99.4
CPT1	AGCAGTGGCAAGAACAAGCAGT	GGAGCAGGGATTTGGCGTAACG	Y18387.1	62	100.4
FAS	ATCCACAGAGCCACCATCCTACC	CCAGAATGCTCACCTTACCACTCAC	XM_035612875.2	62	100.3
Apo-B100	CGGTGGTGCAGGTGAAGAAGATG	ACTCGGCGTATTTGGTGAAGATGG	XM_035617339.2	61	99.1
MTP	CGGTGGTGCAGGTGAAGAAGATG	ACTCGGCGTATTTGGTGAAGATGG	KJ909201.1	61	101.2
* candidate housekeeping genes and RPS4 was selected based on NormFinder and used for gene relative expression calculation. RPS4: ribosomal protein S4; RPL17: Ribosomal Protein L17; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; B2M: Beta-2-microglobulin; ACTB: beta-actin; UBQ: Ubiquitin; LPL: lipoprotein lipase; CPT1: carnitine palmitoyl transferase Ⅰ; FAS: fatty acid synthetase; Apo-B100: apolipoprotein-B-100; MTP: microsomal triglyceride transfer protein;

2.7 Calculations

Weight gain (WG, %) = 100× (final weight- initial weight)/ initial weight

Intestinal somatic index (ISI, %) = 100× (intestine weight/ body weight)

Hepatosomatic index (HSI, %) = 100× (liver weight/ body weight)

Feed intake (FI, %/ day) = 100× total feed consumption/ ((final weight + initial weight)/2)/ days

Feed efficiency ratio (FER, %) = 100× (weight gain/ feed consumption)

Protein efficiency ratio (PER, %) = 100× (weight gain/ protein consumption)

2.9 Statistical analysis

IBM SPSS Statistics 26 was used for data analysis. One-way ANOVA and Duncan's multiple comparisons were applied to compare the differences among the mean of treatment groups (P < 0.05). In addition, the linear and/or quadratic trend was determined using orthogonal polynomial contrast.

3.1 Growth performance, feed utilization and proximate composition

It was observed linearly decreases of WG, FI, FER, PER, HSI but a linearly increase of ISI (P < 0.05, Table 4). Quadratic responses of these six parameters were also observed (P < 0.05). Compared with the control group, WG and HSI in CAP45, CAP60 and CAP75 groups were significantly decreased, but ISI in these three groups was significantly increased (P < 0.05). There were no significant differences in FI, FER and PER between the any CAP group and the control group (P > 0.05).

Table 4

Effects of *Clostridium ethanolicum* protein on the growth and feed utilization of turbot*.
Diets	Parameters
Diets	WG (%)	FI (%/d)	FER (%)	PER (%)	ISI (%)	HSI (%)
CAP0	55.7 ± 3.5^bc	0.65 ± 0.04	1.00 ± 0.06^abc	2.22 ± 0.14^ab	3.01 ± 0.08^a	1.61 ± 0.03^c
CAP15	63.0 ± 2.7^c	0.68 ± 0.00	1.05 ± 0.04^bc	2.39 ± 0.10^b	2.93 ± 0.06^a	1.65 ± 0.18^c
CAP30	54.2 ± 6.7^b	0.65 ± 0.11	1.13 ± 0.09^c	2.48 ± 0.17^b	3.09 ± 0.14^a	1.45 ± 0.11^bc
CAP45	36.9 ± 1.7^a	0.56 ± 0.05	0.84 ± 0.10^a	2.00 ± 0.05^a	3.48 ± 0.04^b	1.16 ± 0.05^a
CAP60	36.9 ± 5.8^a	0.56 ± 0.02	0.89 ± 0.09^ab	2.03 ± 0.20^a	3.43 ± 0.35^b	1.23 ± 0.21^ab
CAP75	40.7 ± 4.6^a	0.52 ± 0.11	0.86 ± 0.13^a	1.93 ± 0.28^a	3.49 ± 0.04^b	1.27 ± 0.15^ab
P value
ANOVA	0.000	0.087	0.008	0.009	0.002	0.003
Linear trend	0.000	0.004	0.015	0.015	0.000	0.001
Quadratic trend	0.001	0.015	0.040	0.004	0.001	0.002
Turbot were fed with diets with different levels of Clostridium ethanolicum* protein (CAP) for 67 days. Data are represented as mean ± S.D. (n = 3). Different letters indicated significant differences (P < 0.05). WG, weight gain; FI, feed intake; FER, feed efficiency ratio; PER, protein efficiency ratio; ISI, intestinal somatic index; HSI, hepatosomatic index; CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75%, respectively.

It was observed a linearly decrease and quadratic response of protein content (P < 0.05, Table 5) and the crude protein content of CAP15 and CAP75 groups was significantly lowered compared with control (P < 0.05). For crude lipid content, only CAP30 group showed significantly higher value compared with control (P < 0.05) but the crude lipid content of other groups was not significantly different (P > 0.05). Dietary CAP did not significantly influence the moisture content (P > 0.05).

Table 5

Effects of *Clostridium ethanolicum* protein on whole body composition of turbot*.
Diets	Whole body composition (% in wet weight)
Diets	Crude protein	Crude lipid	Moisture
CAP0	14.5 ± 0.2^c	4.56 ± 0.21^a	76.9 ± 0.5
CAP15	14.4 ± 0.4^bc	4.93 ± 0.72^ab	76.8 ± 0.1
CAP30	13.8 ± 0.3^ab	5.47 ± 0.48^b	77.0 ± 0.3
CAP45	14.1 ± 0.7^bc	4.29 ± 0.38^a	77.5 ± 1.1
CAP60	14.1 ± 0.2^bc	4.58 ± 0.03^a	77.2 ± 0.1
CAP75	13.2 ± 0.1^a	4.31 ± 0.28^a	77.7 ± 0.9
P value
ANOVA	0.013	0.034	0.477
Linear trend	0.003	0.199	0.199
Quadratic trend	0.013	0.146	0.146
* Turbot were fed with diets with different levels of Clostridium ethanolicum protein (CAP) for 67 days. Data are represented as mean ± S.D. (n = 3). Different letters indicated significant differences (P < 0.05). CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75%, respectively.

3.2 Intestinal and liver histology

In the intestine, significant histological change was only observed on the mucosal fold height in MI and all CAP groups showed significantly lower of mucosal fold height compared with control group (P < 0.05, Fig. 1 and Table 6). A quadratic response of this parameter could be observed. In DI, it was observed a linearly decrease and quadratic response of mucosal fold density (P < 0.05, Fig. 1), but this parameter in any CAP group was not significantly changed compared with control (P > 0.05).

Table 6

Histopathological analysis of middle intestine and distal intestinal in turbot fed diets with increasing levels of *Clostridium ethanolicum* protein for 67 days *.
Items	Experiment diets						P value
Items	CAP0	CAP15	CAP30	CAP45	CAP60	CAP75	ANOVA	Linear trend	Quadratic trend
Middle Intestine
MF height	8.0 ± 0.0^b	6.2 ± 0.6^a	6.2 ± 0.8^a	6.5 ± 0.5^a	6.7 ± 0.6^a	6.2 ± 1.0^a	0.034	0.079	0.049
MF fusion	4.3 ± 0.6	4.5 ± 0.5	4.2 ± 0.3	5.0 ± 0.5	4.7 ± 0.3	4.8 ± 0.3	0.230	0.085	0.239
LP width	6.6 ± 0.4	6.8 ± 0.9	6.8 ± 0.1	6.9 ± 0.4	6.6 ± 0.6	6.3 ± 0.6	0.796	0.456	0.289
LP cellular infiltration	4.7 ± 0.3	4.8 ± 0.8	5.3 ± 0.8	5.6 ± 0.4	4.5 ± 0.4	4.4 ± 0.1	0.083	0.586	0.052
SM width	3.3 ± 1.4	3.6 ± 0.1	2.8 ± 0.4	3.2 ± 0.2	2.4 ± 0.4	2.3 ± 0.7	0.241	0.021	0.067
SM cellular infiltration	5.1 ± 0.1	4.8 ± 0.8	5.3 ± 0.7	5.3 ± 0.3	5.2 ± 0.1	6.2 ± 0.1	0.051	0.014	0.014
ENT vacuolization	6.2 ± 0.6	6.7 ± 1.4	6.3 ± 0.9	5.2 ± 0.3	5.3 ± 0.0	5.3 ± 0.0	0.131	0.018	0.068
ENT nucleus position	2.2 ± 0.1	2.3 ± 0.1	2.1 ± 0.1	2.3 ± 0.1	2.2 ± 0.3	2.2 ± 0.1	0.458	0.779	0.847
Distal Intestine
MF height	5.5 ± 0.5	6.2 ± 1.3	5.8 ± 0.6	5.3 ± 0.3	5.5 ± 1.0	5.5 ± 0.9	0.826	0.503	0.764
MF fusion	6.0 ± 0.5	4.7 ± 0.6	4.8 ± 0.8	5.3 ± 0.3	5.0 ± 0.0	5.2 ± 0.3	0.055	0.369	0.140
LP width	6.9 ± 0.4	6.6 ± 0.2	6.4 ± 0.1	6.5 ± 0.5	6.8 ± 0.3	6.9 ± 0.1	0.238	0.728	0.031
LP cellular infiltration	4.8 ± 0.3	4.6 ± 0.5	5.2 ± 0.8	4.9 ± 0.6	4.5 ± 0.5	5.3 ± 0.5	0.419	0.400	0.672
SM width	2.8 ± 0.6	3.2 ± 0.5	3.7 ± 0.5	3.4 ± 0.5	3.4 ± 0.4	3.4 ± 0.6	0.522	0.261	0.173
SM cellular infiltration	4.3 ± 0.0	4.4 ± 0.1	4.0 ± 0.0	4.4 ± 0.1	4.0 ± 0.3	4.3 ± 0.4	0.126	0.516	0.781
ENT vacuolization	5.2 ± 0.7	5.3 ± 0.6	5.5 ± 0.3	5.3 ± 0.5	5.3 ± 0.3	5.0 ± 0.3	0.846	0.537	0.435
ENT nucleus position	3.9 ± 0.6	3.5 ± 0.3	2.9 ± 0.9	3.1 ± 0.3	2.4 ± 0.5	3.0 ± 0.4	0.086	0.016	0.021
* Data are represented as mean ± S.D. (n = 3). Different letters indicated significant differences (P < 0.05). CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75%, respectively. MF, mucosal fold; LP, lamina propria; SM, submucosa; ENT, enterocyte.

There were no obvious histopathologic changes in the liver in all groups (Fig. 2). However, it was observed a linearly decrease and quadratic response of hepatocytes diameter (P < 0.05), which was significantly decreased in CAP45, CAP60 and CAP75 groups compared with control (P < 0.05).

3.3 Lipid metabolisms

There was no significantly influence of CAP on liver lipid content except that this parameter was the significantly decreased in CAP45 group compared with control (P < 0.05, Table 7). However, CAP significantly influenced the TG, TC and LDL-C in plasma. It was observed linearly decreases and quadratic responses of these three parameters, which were significantly lowered in CAP30, CAP45, CAP60 and CAP75 groups compared with control (P < 0.05).

Table 7

Effects of *Clostridium ethanolicum* protein on the plasma lipid profiles and liver lipid content of turbot*.
Diets	Plasma parameters				Liver lipid content (% in dry weight)
Diets	TG (mmol/L)	TC (mmol/L)	HDL-C (mmol/L)	LDL-C (mmol/L)	Liver lipid content (% in dry weight)
CAP0	4.27 ± 0.67^b	4.01 ± 0.80^b	0.30 ± 0.04	3.39 ± 0.83^c	29.0 ± 2.9^b
CAP15	3.22 ± 0.89^b	4.04 ± 0.30^b	0.46 ± 0.08	2.86 ± 0.37^bc	28.4 ± 2.1^b
CAP30	1.37 ± 0.37^a	2.80 ± 0.17^a	0.42 ± 0.09	1.89 ± 0.26^ab	29.3 ± 2.0^b
CAP45	1.37 ± 1.00^a	2.37 ± 0.75^a	0.36 ± 0.04	1.66 ± 1.01^ab	23.0 ± 1.0^a
CAP60	0.80 ± 0.11^a	2.07 ± 0.24^a	0.37 ± 0.19	1.29 ± 0.23^a	28.7 ± 0.8^b
CAP75	0.89 ± 0.34^a	2.21 ± 1.11^a	0.46 ± 0.08	1.36 ± 0.88^a	27.9 ± 0.8^b
P value
ANOVA	0.000	0.008	0.343	0.012	0.008
Linear trend	0.000	0.000	0.354	0.000	0.423
Quadratic trend	0.000	0.001	0.628	0.000	0.318
* Turbot were fed diets with different levels of Clostridium ethanolicum protein (CAP) for 67 days. Data are represented as mean ± S.D. (n = 3). Different letters indicated significant differences (P < 0.05). CAP0, fishmeal-based basal diet without Clostridium ethanolicum protein; CAP15-CAP75, Clostridium ethanolicum protein replaced fishmeal at 15%, 30%, 45%, 60% and 75%, respectively.

The expressions of Apo-B100, MTP and CPT1 showed quadratic response, with CAP45 group at the peak (P < 0.05, Fig. 2). The expressions of Apo-B100, MTP and CPT1 in CAP15, CAP30, CAP45 and CAP60 groups were significantly increased compared with control (P < 0.05). The LPL expression of CAP45 group was also significantly higher than control, but CAP15 group showed significantly lower LPL expression (P < 0.05). It was observed a linearly decrease for the expression of FAS (P < 0.05). The expression of FAS of CAP15 group was significantly higher than control but this parameter of other CAP groups was significantly decreased (P < 0.05).

The present work proved that CAP could replace no more than 30% of fishmeal for turbot at grow-out phase. This substitution level was less than previous report on juvenile turbot, who could grow well even when CAP replaced up to 45% of fishmeal (Zheng et al. 2022). This difference suggested that smaller fish could tolerate higher dietary level of CAP. Similar observation was also reported from M. salmoides (Yang et al. 2022a, 2023; Zhu et al. 2022). In both turbot trials, the FI linearly decreased with the increasing of dietary CAP. The same phenomenon was also observed on M. salmoides (Yang et al. 2022a), L. crocea (Wu et al. 2022) and pearl gentian grouper (Huang et al. 2023).These works indicated that low palatability of CAP should be concerned, especially in carnivorous fish feed. Different with feed intake, the feed and protein efficiency were inconsistent from two turbot trails. In the present work, CAP significantly decreased the feed and protein efficiency, which was not influenced on juvenile turbot. Different ability of feed and dietary protein similariton of turbot from different growth phases could contribute to the different fishmeal substitution levels in two works.

Compared with soybean meal (Gu et al. 2016) and corn gluten meal (Bai et al. 2019) induced enteritis to turbot, there is no typical inflammatory histological changes by caused by CAP. The present work conformed the safety of CAP. However, the mucosal fold height in MI and density in DI were significantly reduced by CAP, which was similar with L. crocea (Lu et al. 2021), M. salmoides (Yang et al. 2022b) and pearl gentian grouper (Huang et al. 2023). This disadvantage could be attributed to excessive isoleucine and valine brought by CAP. As seen in Table 2, the dietary contents of lysine, isoleucine and valine significantly increased with increase of CAP and reached up to about two times higher than turbot requirements in CAP75 diet. Although excessive lysine was proved to be safe for tambaqui Colossoma macropomum from growth and intestinal morphohistology (da Silva Liebl et al. 2022), excessive concentrations of isoleucine and valine were proved to be harmful for fish intestine health. Specifically, excessive levels of isoleucine increased the expression of inflammation-related cytokines and the levels of malonaldehyde and protein carbonyl in the intestine of C. carpio (Zhao et al. 2014). In hybrid catfish, excessive isoleucine decreased the activities of lysozyme, acid phosphatase, alkaline phosphatase and the contents of C3, C4 and IgM in the intestine, increased the levels of reactive oxygen species, malonaldehyde and protein carbonyl and induce the apoptotic (Zhao et al. 2021). For excessive valine, Luo et al. (2014) proved that it impaired the intestine barrier function of C. Idella from the views of immune status and tight junction. The present work suggested the dietary levels of CAP should be controlled to avoid excessive levels of certain amino acids in the diet.

The present work together with previous work on juvenile turbot (Zheng et al. 2022) and M. salmoides (Ma et al. 2022) proved that CAP disturbed the fish lipid metabolisms. Dietary CAP decreased the plasma triglyceride and cholesterol levels in all three works. One possible reason is that linearly decrease of feed consumption by CAP reduced the lipid intake. Lack of substances rich in fishmeal, such as cholesterol (Wang et al. 2022) and taurine (Cui et al. 2022), could be other reasons, and these two nutrients are vital to the lipid metabolism (Sampath et al. 2020; Meng et al. 2022). The present work did not completely confirm the previous report on juvenile turbot that CAP increased hepatocyte size, liver lipid content, lipogenesis-related genes expression and decreased expression of genes for lipid oxidant and transportation. However, our work was consistent with M. salmoides (Ma et al. 2022) that CAP decreased the lipogenesis and when the substitution level of CAP to fishmeal was about 50%, CAP increased the lipolysis. Further work should be conducted for the CAP on liver, especially the lipid metabolisms.

In conclusion, CAP could replace up to 30% of fishmeal for turbot at growth-out phase. CAP is a relative safe protein source but would negatively influence the feed intake, intestine absorption area and lipid metabolism, which should be overcame by controlling its dietary level and by supplementation of fishmeal-rich substances.

Acknowledgements

The authors are grateful to Miss Jiayi Chen and Mr. Gaohong Liu for their help during the sampling.

Author contributions

Conceptualization & Fund: Nan Bai, Min Gu; Formal analysis: Nan Bai, Qing Li; Methodology: Nan Bai, Qing Li, Zezheng Qi, Wanzhen Deng; Resources: Shihui Pan; Writing - review and editing: Nan Bai, Qing Li, Min Gu;

Funding

This work was supported by Shandong Provincial Natural Science Foundation (Grand No. ZR2022MC097 and ZR202111140103); National Key R&D Program of China (Grant No. 2019YFD0900200); National Science Foundation of China (Grant No. 31702363 and 31502174); China Postdoctoral Science Foundation (Grant No. 2018M632678); Function Laboratory for Marine Fisheries Science and Food Production Processes, P. R. China (Grant No. 2019-ST-A01); Key Laboratory of Mariculture (KLM), Ministry of Education, Ocean University of China (Grant No. KLM2018001); and Young Scholars Program of Shandong University, Weihai (Grant No. 2016WHWLJH04 and 2018WHWLJH).

Data Availability

All data generated or analyzed during this study are included in this published article.

Competing Interests

The authors declare no conflict of interest.

Ethics approval

The Ethical Scientific Committee for Animal Experimentation of Shandong University approved the fish manipulation and sampling techniques, which complied with the European directive 2010/63/UE.

Consent to participate

Not applicable.

Consent to publish

All authors agree to the content of paper for publication.

Bai N, Gu M, Liu M, et al (2019) Corn gluten meal induces enteritis and decreases intestinal immunity and antioxidant capacity in turbot (Scophthalmus maximus) at high supplementation levels. PLoS One 14:e0213867. https://doi.org/10.1371/journal.pone.0213867
Campbell KB, McLean E, Barrows FT (2022) In Pursuit of Fish-Free Feeds: A Multi-Species Evaluation. Fishes 7:336. https://doi.org/10.3390/fishes7060336
Chen Y, Sagada G, Xu B, et al (2020) Partial replacement of fishmeal with Clostridium autoethanogenum single-cell protein in the diet for juvenile black sea bream (Acanthopagrus schlegelii). Aquac Res 51:1000–1011. https://doi.org/10.1111/are.14446
Cui X, Ma Q, Duan M, et al (2022) Effects of fishmeal replacement by Clostridium autoethanogenum protein on the growth, digestibility, serum free amino acid and gene expression related to protein metabolism of obscure pufferfish (Takifugu obscurus). Anim Feed Sci Technol 292:115445. https://doi.org/10.1016/j.anifeedsci.2022.115445
da Silva Liebl AR, Cáo MA, dos Santos Nascimento M, et al (2022) Dietary lysine requirements of Colossoma macropomum (Cuvier, 1818) based on growth performance, hepatic and intestinal morphohistology and hematology. Vet. Res. Commun. 46:9–25
Fan Z, Li C, Wu D, et al (2022) Evaluation of four novel protein sources as alternatives to soybean meal for two specifications of cage-farmed grass carp (Ctenopharyngodon idellus) deeds: Effect on growth performance, flesh quality, and expressions of muscle-related genes. Front Mar Sci 9:1–15. https://doi.org/10.3389/fmars.2022.935651
Fernández-González R, Pérez‐Pérez MI, Correia‐da‐Silva J (2023) Production strategies, productivity changes and innovation: An analysis of European turbot aquaculture from 2009 to 2020. Rev Aquac 15:610–624. https://doi.org/10.1111/raq.12747
FOLCH J, LEES M, SLOANE STANLEY GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509. https://doi.org/10.1016/s0021-9258(18)64849-5
Gu M, Bai N, Kortner TM (2017a) Taurocholate supplementation attenuates the changes in growth performance, feed utilization, lipid digestion, liver abnormality and sterol metabolism in turbot (Scophthalmus maximus) fed high level of plant protein. Aquaculture 468:597–604. https://doi.org/10.1016/j.aquaculture.2016.11.022
Gu M, Bai N, Xu B, et al (2017b) Protective effect of glutamine and arginine against soybean meal-induced enteritis in the juvenile turbot (Scophthalmus maximus). Fish Shellfish Immunol 70:95–105. https://doi.org/10.1016/j.fsi.2017.08.048
Gu M, Bai N, Zhang Y, Krogdahl Å (2016) Soybean meal induces enteritis in turbot Scophthalmus maximus at high supplementation levels. Aquaculture 464:286–295. https://doi.org/10.1016/j.aquaculture.2016.06.035
Guan C, Ding Y, Ma A, et al (2018) Flatfish Farming. In: Aquaculture in China. John Wiley & Sons Ltd, Chichester, UK, pp 309–328
Huang B, Shi M, Pang A, et al (2023) Effects of Fishmeal Replacement by Clostridium Autoethanogenum Protein Meal on Cholesterol Bile Acid Metabolism, Antioxidant Capacity, Hepatic and Intestinal Health of Pearl Gentian Grouper (Epinephelus Fuscoguttatus ♀ × Epinephelus Lanceolatus ♂). Animals 13:. https://doi.org/10.3390/ani13061090
Kaushik S (1998) Whole body amino acid composition of European seabass (Dicentrarchus labrax), gilthead seabream (Sparus aurata) and turbot (Psetta maxima) with an estimation of their IAA requirement profiles. Aquat Living Resour 11:355–358. https://doi.org/10.1016/S0990-7440(98)80007-7
Li M, Liang H, Xie J, et al (2021) Diet supplemented with a novel Clostridium autoethanogenum protein have a positive effect on the growth performance, antioxidant status and immunity in juvenile Jian carp (Cyprinus carpio var. Jian). Aquac Reports 19:100572. https://doi.org/10.1016/j.aqrep.2020.100572
Lu Q, Xi L, Liu Y, et al (2021) Effects of Dietary Inclusion of Clostridium autoethanogenum Protein on the Growth Performance and Liver Health of Largemouth Bass (Micropterus salmoides). Front Mar Sci 8:. https://doi.org/10.3389/fmars.2021.764964
Luo J, Feng L, Jiang W, et al (2014) The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine. Fish Shellfish Immunol 40:197–207. https://doi.org/10.1016/j.fsi.2014.07.003
Ma S, Liang X, Chen P, et al (2022) A new single-cell protein from Clostridium autoethanogenum as a functional protein for largemouth bass (Micropterus salmoides). Anim Nutr 10:99–110. https://doi.org/10.1016/j.aninu.2022.04.005
Maulu S, Hualiang L, Ke J, et al (2021a) Dietary Clostridium autoethanogenum protein modulates intestinal absorption, antioxidant status, and immune response in GIFT (Oreochromis niloticus) juveniles. Aquac Res 52:5787–5799. https://doi.org/10.1111/are.15454
Maulu S, Liang H, Ge X, et al (2021b) Effect of dietary Clostridium autoethanogenum protein on growth, body composition, plasma parameters and hepatic genes expression related to growth and AMPK/TOR/PI3K signaling pathway of the genetically improved farmed tilapia (GIFT: Oreochromis niloticus. Anim Feed Sci Technol 276:114914. https://doi.org/10.1016/j.anifeedsci.2021.114914
Meng X, Bi Q, Cao L, et al (2022) Evaluation of Necessity of Cholesterol Supplementation in Diets of Two Marine Teleosts, Turbot (Scophthalmus maximus) and Tiger Puffer (Takifugu rubripes): Effects on Growth and Lipid Metabolism. Aquac Nutr. https://doi.org/10.1155/2022/4160991
Norman ROJ, Millat T, Winzer K, et al (2018) Progress towards platform chemical production using clostridium autoethanogenum. Biochem Soc Trans 46:523–535. https://doi.org/10.1042/BST20170259
Peres H, Oliva-Teles A (2008) Lysine requirement and efficiency of lysine utilization in turbot (Scophthalmus maximus) juveniles. Aquaculture 275:283–290. https://doi.org/10.1016/j.aquaculture.2007.12.015
Sampath WWHA, Rathnayake RMDS, Yang M, et al (2020) Roles of dietary taurine in fish nutrition. Mar. Life Sci. Technol. 2:360–375
Sillman J, Nygren L, Kahiluoto H, et al (2019) Bacterial protein for food and feed generated via renewable energy and direct air capture of CO2: Can it reduce land and water use? Glob Food Sec 22:25–32. https://doi.org/10.1016/j.gfs.2019.09.007
Wang J, Chen L, Xu J, et al (2022) C1 gas protein: A potential protein substitute for advancing aquaculture sustainability. Rev Aquac 1–3. https://doi.org/10.1111/raq.12707
Wu Y, Tian S, Yuan J, et al (2022) Effects of Clostridium autoethanogenum protein as substitute for dietary fishmeal on the growth, feed utilization, intestinal health and muscle quality of large yellow croaker Larimichthys crocea. Aquaculture 561:738591. https://doi.org/10.1016/j.aquaculture.2022.738591
Xu J, Wang J, Ma C, et al (2023) Embracing a low-carbon future by the production and marketing of C1 gas protein. Biotechnol Adv 63:108096. https://doi.org/10.1016/j.biotechadv.2023.108096
Xue R, Li H, Liu S, et al (2023) Substitution of soybean meal with Clostridium autoethanogenum protein in grass carp (Ctenopharygodon idella) diets: Effects on growth performance, feed utilization, muscle nutritional value and sensory characteristics. Anim Feed Sci Technol 295:115547. https://doi.org/10.1016/j.anifeedsci.2022.115547
Yang P, Li X, Song B, et al (2023) The potential of Clostridium autoethanogenum, a new single cell protein, in substituting fish meal in the diet of largemouth bass (Micropterus salmoides): Growth, feed utilization and intestinal histology. Aquac Fish 8:67–75. https://doi.org/10.1016/j.aaf.2021.03.003
Yang P, Li X, Yao W, et al (2022a) Dietary Effect of Clostridium autoethanogenum Protein on Growth, Intestinal Histology and Flesh Lipid Metabolism of Largemouth Bass (Micropterus salmoides) Based on Metabolomics. Metabolites 12:. https://doi.org/10.3390/metabo12111088
Yang P, Yao W, Wang Y, et al (2022b) Dietary effects of fish meal substitution with Clostridium autoethanogenum on flesh quality and metabolomics of largemouth bass (Micropterus salmoides). Aquac Reports 23:. https://doi.org/10.1016/j.aqrep.2022.101012
Zhang H, Ran C, Teame T, et al (2020) Research progress on gut health of farmers teleost fish: a viewpoint concerning the intestinal mucosal barrier and the impact of its damage. Rev Fish Biol Fish 30:569–586. https://doi.org/10.1007/s11160-020-09614-y
Zhang J, Dong Y, Song K, et al (2022) Substituting Fish Meal with a Bacteria Protein (Clostridium autoethanogenum Protein) Derived from Industrial-Scale Gas Fermentation: Effects on Growth and Gut Health of Juvenile Large Yellow Croakers (Larimichthys crocea). Fishes 7:. https://doi.org/10.3390/fishes7050228
Zhao J, Feng L, Liu Y, et al (2014) Effect of dietary isoleucine on the immunity, antioxidant status, tight junctions and microflora in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Fish Shellfish Immunol 41:663–673. https://doi.org/10.1016/j.fsi.2014.10.002
Zhao Y, Yan M, Jiang Q, et al (2021) Isoleucine improved growth performance, and intestinal immunological and physical barrier function of hybrid catfish Pelteobagrus vachelli × Leiocassis longirostris. Fish Shellfish Immunol 109:20–33. https://doi.org/10.1016/j.fsi.2020.09.035
Zheng J, Zhang W, Dan Z, et al (2022) Replacement of dietary fish meal with Clostridium autoethanogenum meal on growth performance, intestinal amino acids transporters, protein metabolism and hepatic lipid metabolism of juvenile turbot (Scophthalmus maximus L.). Front Physiol 13:1–19. https://doi.org/10.3389/fphys.2022.981750
Zhu S, Gao W, Wen Z, et al (2022) Partial substitution of fish meal by Clostridium autoethanogenum protein in the diets of juvenile largemouth bass (Micropterus salmoides). Aquac Reports 22:. https://doi.org/10.1016/j.aqrep.2021.100938

No competing interests reported.

CAPhealthmanuscriptTableS1.docx

Download PDF

Journal Publication

published 31 May, 2024

Read the published version in Aquaculture Reports →

Version 1

posted

You are reading this latest preprint version

Effects of Clostridium autoethanogenum protein on growth performance, intestine and liver health of turbot Scophthalmus maximus during grow-out phase

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Feed ingredients and diet formulation

2.2 Experimental procedures

2.3 Sampling

2.4 Chemical analysis

2.5 Histology examination

2.6 RNA extraction and expression analysis

2.7 Calculations

2.9 Statistical analysis

3. Results

3.1 Growth performance, feed utilization and proximate composition

3.2 Intestinal and liver histology

3.3 Lipid metabolisms

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1