Construction of SaCas9 and sgRNA plasmids.
All plasmids were constructed with standard recombinant DNA cloning techniques. pX601-CMV:SaCas9-U6:sgRNA (pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA) was preserved in our laboratory. tRNAGLN and sgRNA scaffold sequences were generated by Sangon (Shanghai, China) (GGTTCCATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGA
GTTCAAATCTCGGTGGAACCT-GAAACACCGGAGACCACGGCAGGTCTCAGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGA) [17] and, after amplification with the primers tRNAGLN-F: 5′-AGGCATGCTGGGGAGGTACCGGTTCCATGGTGTAATGGTT-3′ Scaf-ITR-R:5′-CTAGGGGTTCCTGCGGCCGCAAAAATCTCGCCAACAAGTTG-3′, were ligated into pX601-CMV:SaCas9-U6:sgRNA, which was digested with KpnI and NotI, with a ClonExpress® II One Step Cloning kit (Vazyme Biotech, China). The constructed vector was then transformed into DH5α competent cells, and transformants containing pX601-CMV:SaCas9-tRNA:sgRNA were identified by sequencing. After subculturing, DNA was extracted. The EF1α promoter was amplified from the pLentiCRISPR V2 vector with the primers EF1α-F: 5′-CCTGCGGCCTCTAGACTCGAGGTGGGCAGAGCGCACATCGC-3′ and EF1α-R: 5-TGGGGCCATGGTGGCACCGGTCCTGTGTTCTGGCGGCAAAC-3′. Then, pX601-CMV:SaCas9-tRNA:sgRNA, which was digested between the XhoI and AgeI sites immediately before the SaCas9 gene, and the promoter were cloned with a ClonExpress® II One Step Cloning kit. Vector transformation, identification and plasmid extraction were performed as described above to obtain pX601-EF1α:SaCas9-tRNA:sgRNA. The P2A-eGFP gene was amplified from th-P2A-eGFP donor with primers P2A-eGFP-F: 5′-CCGGCCAGGCAAAAAAGAAAAAGGCTACTAATTTCTCCT-3′ and P2A-eGFP-R: 5′-ATCTGGAACATCGTATGGGTCTTGTACAGCTCGTC. Then, pX601-EF1α:SaCas9-tRNA:sgRNA was digested with BamHI, and the P2A-eGFP gene was cloned with a ClonExpress® II One Step Cloning kit. Vector transformation, identification and plasmid extraction were performed as described above to obtain pX601-EF1α:SaCas9-eGFP-tRNA:sgRNA. The proposed structures of the vector are shown in Fig. 1A. The complementary oligonucleotides sgMstn1, sgMstn2 and sgMstn3 were annealed to form double-stranded inserts and were ligated into the BbsI digested plasmid. Finally, the plasmids pX601-EF1α:SaCas9-eGFP-tRNA:sgMstn1, pX601-EF1α:SaCas9-eGFP-tRNA:sgMstn2 and pX601-EF1α:SaCas9-eGFP-tRNA:sgMstn3 (denoted psgMstn1, psgMstn2 and psgMstn3) were constructed.
Cell culture and transfection.
NIH/3T3 cells were cultured in Dulbecco's modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and were transfected with polyethylenimine (PEI). Briefly, 5 × 105 NIH/3T3 cells were cultured to 50–60% confluence in six-well plates and transfected with psgMstn1/ psgMstn2/ psgMstn3 and 1 × PEI, and the medium was replaced with DMEM (3% FBS) after 8 h. After 72 h, the cells were subjected to genomic DNA extraction. All cells were cultured at 37 °C and 5% CO2.
AAV vectors for the CRISPR/Cas9 system.
Procedures were carried out as previously described[29]. For the production of rAAV-DJ/8, rAAV9 viruses, HEK293T cells were seeded into 20 dishes (100 ⋅ 10 mm; 5 × 106 cells per dish). After 24 h, the cells were triple-transfected with pX601/psgMstn1, pAAV-DJ/8-RC pAAV9-RC and pHelper according to the instructions provided with the 1 × PEI transfection reagent. After 72 h, the cells were harvested by scraping into medium, centrifuged at 1000 ⋅ g for 10 min and resuspended in 1 mL of 1 × phosphate-buffered saline. The cell suspension was subjected to three freeze–thaw cycles at ˗80 °C and at 37 °C. After fast centrifugation and filtration, the cell debris was cleared. The viral solution was concentrated with PEG 8000 and purified on a cesium chloride density gradient column. After two rounds of ultracentrifugation, the high-density viruses were separated and extracted, and run through dialysis bags for desalting[30]. The titers of the purified rAAV-DJ/8, rAAV9 viruses were determined with a RT-PCR-based method described previously[31]. pX601 was diluted from 109 copies/µL to 103 copies/µL as the standard solution. The primers were ITR-QPCR-F: 5ʹ-CGGCCTCAGTGAGCGA-3ʹ and ITR-QPCR-R: 5ʹ-AGGAACCCCTAGTGATG-3ʹ. The resulting viruses were designated AAV-DJ/8-EF1α:SaCas9-eGFP-tRNA:sgMstn1, AAV9-EF1α:SaCas9-eGFP-tRNA: sgMstn1 and AAV-DJ/8-CN, AAV9-CN (denoted rAAV-DJ/8-sgMstn1, rAAV9-sgMstn1 and rAAV-DJ/8-CN, rAAV9-CN, respectively).
rAAV-DJ/8 transduction in vitro.
Adeno-associated virus (AAV) serotypes differ broadly in transduction efficacy and tissue tropism. Recombinant AAV-DJ vectors provide superior in vitro transduction efficacy to that of any other wild type serotype. Efficient transduction is beneficial for gene editing in the SaCas9 system. After digestion and resuspension of C2C12 cells in logarithmic growth phase, the cells were cultured in DMEM supplemented with 10% FBS in 12-well plates at a seeding density of 1 × 105 and grown overnight. The cells were cultured to 50–60% confluence and infected with ~ 2 × 109 vg and 1 × 1010 vg rAAV-DJ/8-sgMstn1, and control cells were infected with ~ 2 × 109 vg and 1 × 1010 vg rAAV-DJ/8-CN. Then, the medium was replaced with DMEM (3% FBS) after 24 h. Fluorescence was determined, and DNA and protein were extracted at 96 and 120 h.
Mice.
120 C57BL/10 male mice in SPF grade (6 weeks of age) were purchased from the Center of Experimental Animal of Guangdong province (Guangzhou, China) and maintained in a specific-pathogen-free animal facility according to the Guide for the Care and use of Laboratory Animals and the related ethical regulations at Henan Agricultural University. Then, these mice were fed to the age of 8 weeks and were healthy without any abnormalities.
rAAV9 transduction in vivo.
Compared with AAV-DJ, AAV9 is more addicted in muscle tissue; it is conducive to gene editing of muscle cells and is often applied in muscle tissue. In addition, the packaging of different types of AAV allows for broad applicability of the psgMstn1 plasmid. 60 C57BL/10 male mice were divided into four groups, and rAAV9-sgMstn1 and rAAV9-CN were injected into male C57BL/10 mice in two doses. Three points on the thigh muscle in the left thigh in the treatment group were injected with ~ 1 × 1010 vg/1 × 1011 vg of rAAV9-sgMstn1 in 100 µL of phosphate-buffered saline (30 µL/point,N = 15), and the control group were treated similarly with ~ 1 × 1010 vg/1 × 1011 vg of rAAV9-CN in 100 µL of phosphate-buffered saline (30 µL/point, N = 15). After 6, 8 and 10 weeks, the expression of the tissue fluorescence was determined, and the thigh muscles were collected for genomic DNA extraction, western blotting.
Construction of mouse model of muscular atrophy and rAAV9 transduction.
A mouse model of muscular atrophy was constructed as previously described[32]. 40 C57BL/10 male mice were divided into two groups: a DEX treatment group, which received DEX treatment once every other day for 14 days (DEX, Decadron, 0.5 mg/kg of body weight, i.p., N = 30), and a control group, which received saline during the same period (N = 10). DEX and saline injections were simultaneously given each day (9:00–10:00 a.m.). Then, 20 C57BL/10 male mice with significant weight changes were selected from the DEX treatment group, and ~ 1 × 1011 vg of rAAV9-sgMstn1 or rAAV9-CN was injected into the thigh muscle in muscular atrophy model mice (N = 10). Control group mice were injected with saline. After 8 weeks, the thigh muscles were collected for genomic DNA extraction, western blotting and tissue slice experiments. Body weight was measured daily in each week of the experiment.
T7 endonuclease 1 (T7E1) cleavage assay and targeted deep-sequencing analysis.
Genomic DNA was extracted with a Tissue and Cell Culture DNA Midi kit (TianGen, Beijing, China) according to the manufacturer’s instructions. The purified genomic DNA was used as a template to amplify a fragment of the Mstn gene with the following specific primers: MSTN-Test1-F: 5ʹ-CGCCTGGAAACAGCTCCTAA-3ʹ and MSTN-Test1-R: 5ʹ-TCTCATGCTTTAACACTGCCT-3ʹ; MSTN-Test2-F: 5ʹ-TTCTAATGCAAGCGGATGGC-3ʹ and MSTN-Test2-R: 5ʹ-CACACCTACCTTTGGAGTAAGA-3ʹ; and MSTN-Test3-F: 5ʹ-GGATGGCAAGCCCAAATGTT-3ʹ and MSTN-Test3-R: 5ʹ-ACACACCTACCTTTGGAGTAAG-3ʹ. The fragment sizes amplified by these primer sets were 521 bp, 548 bp and 537 bp, respectively. The PCR products were digested with T7 endonuclease 1 (NEB, Boston, USA) and resolved with 1.5% agarose gel electrophoresis. The primers used for tracking of insertions and deletions (indels) by decomposition (TIDE) were the same as the MSTN-Test-F/R primers. Genomic DNA (100 ng) was used for PCR amplification with a High Fidelity 2⋅ PCR Master Mix (NEB). For TIDE analysis, 300 ng of PCR product was purified with a QIAquick PCR Purification Kit (Qiagen, Hilden, Mannheim, Germany) and sent for Sanger sequencing with the forward primer MSTN-Test-F. Indel values were obtained with the TIDE web tool (https://tide.deskgen.com/) as described previously. Targeted deep-sequencing analysis was performed for C2C12 cells and gDNA from mouse muscle with a PCR amplification approach. Briefly, the off-target locus was identified through the website http://www.rgenome.net/cas-offinder/. On-target or off-target locus-specific primers (Table 1) were used to amplify the editing site with Phusion High Fidelity DNA Polymerase. The resultant amplicons were separated on a 1.0% agarose gel. The bands of ~ 150 bp were extracted with a SanPrep DNA Gel Extraction kit. Then, targeted deep-sequencing of DNA products was performed by GENEWIZ Inc. In brief, the libraries were sequenced on the Illumina HiSeq platform (Illumina, Santiago, USA) in paired-end mode with a read length of 150 bp. Primary analysis was performed with built-in software, HiSeq Control Software (HCS), RTA 2.3 plus, and demultiplexing was performed with bcl2fastq 2.17. Finally, the raw data of the targeted sequencing were analyzed by bioinformatics analysts at GENEWIZ Inc. The resulting indel frequencies, sizes and distributions were then plotted with GraphPad Prism.
Protein analysis.
Protein extracts were prepared on ice by homogenization of pieces of frozen tissues or cell pellets in 500 µL of RIPA lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS and 2 mM MgCl2) supplemented with 1:100 protease inhibitor solution (Roche, Basel, Switzerland) by passage through a syringe. With each loose- and tight-fitting piston, the samples received 30 strokes and were then centrifuged at 1000 ⋅ g for 5 min at 4 °C to remove debris. The supernatant (whole cell lysate) was collected. For the isolation of membrane fractions, the supernatant was further centrifuged at 13200 ⋅ g for 20 min at 4 °C, and the pellet was resuspended (2 µL/mg tissue) in sample buffer (2.7 M urea, 3.3% SDS and 0.167 M Tris, pH 6.7). The protein concentration was estimated with a BCA assay. For protein detection, 30 µg of sample was separated with 10% SDS-PAGE and then transferred to a polyvinylidene fluoride membrane. After incubation in 5% nonfat milk for 1 h, the membrane was incubated with rabbit polyclonal anti-MSTN/GAPDH antibody (1:1000, Bioss Antibodies, China, catalogue number: bs-23012R/bs-2188R) overnight at 4 °C. Then membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit (1:2000, Bioss Antibodies, catalogue number: bs-0295G) antibodies for 1 h at room temperature. The target proteins were detected with Luminata™ Crescendo immunoblotting HRP Substrate (Millipore, USA).
Histology and immunofluorescence analyses.
The quadriceps muscles were fixed in para-formaldehyde and embedded in paraffin for further histopathological investigations. Formalin-fixed quadriceps muscles sections were stained to investigate the density and diameter of muscle fibers by hematoxylin and eosin according to a standard protocol[33]. After the staining procedure, the slides were scanned with a microscope. At least five fields at 200⋅ magnification were randomly selected from each section in each group for imaging. The number of fibers was counted in each field, then converted to the number of fibers per mm2. Each section was analyzed to calculate the area of individual muscle fibers (mm2), by selecting the area of every muscle fiber (mm2). All data were obtained and analyzed with Image Pro Plus 6.0 software. For immunostaining, the paraffin sections of muscle tissue were dewaxed as previously described[34], placed in a solution of sodium citrate at 100 °C for 10 minutes and then soaked in hydrogen peroxide. Cross-section samples were immunostained with mouse monoclonal anti-SaCas9 primary antibody (1:200, Epigentek, catalogue number: A-9001) and goat anti-mouse IgG-FITC (1:500, Abcam, catalogue number: ab6785) secondary antibody, and DAPI for nuclei. Muscle sections were imaged with standard fluorescence microscopy.
Muscle weights of mice.
The experimental C57BL/10 male mice were weighed on electronic scales. The body weights of the mice were recorded from weeks 1 to 8. For the measurement of muscle weight, quadriceps and adductor muscles from the left side in the experimental mice were dissected 2 months later, and the average weight was used for each muscle. Ten mice were weighed per group.
Statistical analyses.
Data are expressed as the mean ± standard error of the mean. Unpaired Student’s t-test was used to analyze differences between two groups, and one-way ANOVA analysis of variance with Bonferroni’s post-test was used for multiple group comparisons with Prism 6 (GraphPad). * P values less than 0.05 and greater than 0.01 were considered significant. ** P value less than 0.01 was considered to be of greater significance.