The Assessment of cytotoxicity, apoptosis inducing activity and molecular docking of a new ciprofloxacin derivative in human leukemic cells

doi:10.21203/rs.3.rs-2960399/v1

Download PDF

Research Article

The Assessment of cytotoxicity, apoptosis inducing activity and molecular docking of a new ciprofloxacin derivative in human leukemic cells

https://doi.org/10.21203/rs.3.rs-2960399/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 03 Aug, 2023

Read the published version in Journal of Fluorescence →

You are reading this latest preprint version

The fluoroquinolone class of antibiotics includes derivatives of the drug ciprofloxacin. These substances have recently been advocated for the treatment of cancer. In the current study, we examined the cytotoxicity and apoptosis-inducing potential of a novel synthetic ciprofloxacin derivative in the human myeloid leukemia KG1-a cell line. With an IC₅₀ of 25µM, this ciprofloxacin derivative, 7-(4-(2-(benzhydryloxy)-2-oxoethyl) piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4 dihydroquinoline-3- carboxylic acid (4-BHPCP), was an active drug. Through Hoechst 33258 staining and Annexin V/PI double staining experiments, the apoptotic activity of the 4-BHPCP was assessed morphologically. Real-time quantitative PCR was used to assess changes in the expression level of certain apoptosis-related genes, including Bcl-2, Bax, and Survivin (qRT PCR). The results of the qRT PCR analysis demonstrated that 4-BHPCP promotes apoptosis in the KG1-a cell line by down-regulating Survivin and Bcl2, up-regulating Bax, and increasing the Bax/Bcl2 transcripts in a time-dependent manner. These results imply that this novel chemical may be a promising therapy option for acute myeloid leukemia.

Acute myeloid leukemia

Apoptosis

Bcl-2

Cell cycle

Survivin

KG1-a cells

Cancer, a killer on the rise in emerging nations, is the second biggest cause of death in the United States. Apoptotic escape, immortal proliferation, angiogenesis, and other characteristics are common to most, if not all, malignancies despite the variety in the anatomical location and mutations implicated in human cancer [1]. The human body produces malignant white blood cells (WBCs) due to the blood malignancy leukemia. The immune system becomes exposed when these abnormal blood cells attack the bone marrow and blood. The bone marrow's capacity is constrained, and it can also produce platelets and red blood cells. Additionally, these cancerous blood cells have the ability to enter the bloodstream and harm other organs like the liver, kidneys, spleen, brain, and others, leading to the development of additional lethal tumors. Depending on what kind of leukocytes are involved, leukemia is categorized as lymphoblastic or myeloid. Let's say that monocytes and granulocytes are the impacted cells. If lymphocytes are present, the leukemia is labelled lymphocytic (acute lymphocytic Leukemia [ALL]) rather than myeloid (acute myeloid leukemia [AML]) in that situation [2–4].

Quinolones modify the bacterial gyrase's typical actions and inhibit topoisomerase II in human cells, which gives them their antibacterial and anticancer properties. A popular broad-spectrum fluoroquinolone antibiotic called ciprofloxacin has shown anticancer action in many cancer cell lines. In cancer cells, it has been demonstrated to stop the cell cycle, break DNA double strands, and trigger apoptosis [5, 6]. Synthetic broad-spectrum antibiotics called fluoroquinolones inhibit the creation of bacterial DNA. They are the most common class of antimicrobial drugs currently in use worldwide, despite their unintentional discovery. These medications are frequently used in clinical settings to treat eye illnesses, infections of the bone, skin, or soft tissues, and urinary, respiratory, and gastrointestinal conditions [7]. By controlling cytokine production, anti-inflammatory reactions, and defense against LPS-induced liver injury, they further demonstrated immunoregulatory activities [8]. Numerous modules study fluoroquinolones' ability to fight cancer. The fluoroquinolone of the second generation, ciprofloxacin, is efficient against Pseudomonas aeruginosa and other gram-negative bacteria. The medication is widely available and has a good bioavailability [9–11]. Because of its favorable pharmacokinetic characteristics and capacity to accumulate in higher quantities in tissues than in plasma, ciprofloxacin is frequently used to treat respiratory, urinary, and gastrointestinal infections [12]. Moxifloxacin (MFLX) has been shown by Artur Beberok et al. to interact with the proteins Mcl-1 and Microphthalmia-Associated Transcription Factor (MITF) and to inhibit the production of the examined proteins. Also, they demonstrated that MFLX caused apoptosis by activating the intrinsic death pathway and reduced the viability and growth of MDA-MB-231 cells. Also, it was discovered through examination of the cell cycle that MFLX blocked the S and G2/M stages [13]. Ciprofloxacin has demonstrated anticancer efficacy in vitro in cancer cell lines from both humans and animals, including human bladder cancer cell lines, human colorectal cell lines, hamster ovarian cancer cell lines, and human hepatocellular carcinoma cell lines. In low-concentration ciprofloxacin (0.01 mM and 0.1 mM), Artur Beberok and Dorota Wrzesniok et al. demonstrated that the incubation period could be extended to 48 hours and 72 hours and that S-phase melanoma cells cycle stagnation would appear for cell fluorescence image evaluation via mechanisms related to topoisomerase II inhibition [14, 15]. In human non-small cell lung carcinoma, Kloskowski et al. demonstrated that ciprofloxacin caused cell standstill at the G2/M checkpoint [16]. Simultaneously, Hamada H.H. Mohammed et al. demonstrated that ciprofloxacin derivatives could increase the expression of p53 and p21 as well as the expression of cyclin B1 and Cdc2, which were essential proteins for modulating the G2 / M cell cycle in cancer cells of the human non-small cell lung, but were unable to do so without affecting the same protein expression in other normal cells, which displayed dose-dependent G2 [17]. To sum up, ciprofloxacin derivatives caused G2 / M phase arrest by activating the p53 / p21 pathway and increasing the expression of the protein’s cyclin B1 and Cdc2. Ciprofloxacin can so employ a cell cycle-regulating function to have an antiproliferative impact. Fluoroquinolones are currently gaining more and more attention for their role in encouraging cancer cell death. In 2017, Artur Beberok et al. demonstrated that ciprofloxacin caused DNA fragmentation in oligonucleosomes at the highest concentration (1.0 mM), indicating the presence of sub-g1 fragments and strongly indicating that dependent mitochondrial pathways, such as disruption of mitochondrial membrane potential, are responsible for inducing apoptosis [14]. The following year, Artur Beberok et al. discovered that ciprofloxacin treatment induced triple MDA-MB-231 negative human breast cancer cells to undergo apoptosis by stimulating the loss of mitochondrial transmembrane potential via the Bax/Bcl-2-dependent signaling pathway. In this work, oligonucleosomal DNA fragmentation and enhanced p53 expression were found, indicating that the p53-dependent pathway may be responsible for mediating this late apoptotic event [15, 18]. In the current work, we evaluated the cytotoxic and antiproliferative effects of ciprofloxacin derivative on human leukemia KG1-a cells. Apoptosis induction and cell cycle distribution were assessed in the KG1-a cell line using the chemical 7-(4-(2-(benzhydryloxy)-2-oxoethyl) piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4 dihydroquinoline-3-carboxylic acid (4-BHPCP) (Fig. 1A). Our results demonstrated that 4-BHPCP causes leukemia cells to undergo apoptosis via up-regulating Bax and down-regulating Bcl-2 and Survivin.

MATERIALS

From the Pasteur Institute of Iran (Tehran) was provided KG1-a cell line. Fetal bovine serum (FBS) and cell culture media (RPMI 1640) were bought from BioSolutions International (Melbourne, Australia). We bought penicillin and streptomycin from Invitrogen (Grand Island, NY, USA). The caspase-3 test kit and the annexin V-FITC/PI apoptosis detection kit were purchased from BD Biosciences Pharmingen (San Diego, CA, USA). POCH supplied the dimethyl sulfoxide (DMSO) (Gliwice, Poland). Sigma Aldrich provided the following chemicals: Hoechst 33342, 3-(4, 5-Dimethyl-2-thiazolyl)-2, 5-diphenyl-2-H-tetrazolium bromide (MTT), and propidium iodide (PI) (St. Louis, Missouri, USA). Oligo produced qPCR primers (Macrogen, Seoul, South Korea). We bought the RNA isolation kit from SinaClon (Iran). Prime Script RT reagent kit (Takara, Japan) was used for cDNA synthesis and real-time PCR, while AmpliQon provided RealQ Plus 2 Master Mix Green High ROXTM (AmpliQon, Denmark).

PREPARATION OF THE INVESTIGATED CIPROFLOXACIN COMPOUND

A novel N-4-piperazinyl Ciprofloxacin-ester hybrid namely, 7-(4-(2-(benzhydryloxy)-2-oxoethyl) piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4 dihydroquinoline-3-carboxylic acid (4-BHPCP) was synthesized according to the literature and confirmed by ¹H NMR, ¹³C NMR, FT-IR spectral data, as well as elemental analysis [19].

CELL CULTURE

The KG1-a suspension cell line for human acute myeloid leukemia (AML) was grown in RPMI 1640 media with 20% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 g/mL streptomycin at 37°C in a humid environment with 5% CO2.

CELL VIABILITY ASSAY

MTT [3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide] was used for the cell viability experiment. KG1-a cells (1×10⁴ cells/well) were planted on a 96-well plate and exposed to various doses (0-120 µM) of the chemical for 24, 48, and 72 hours to assess the cytotoxic effect of the substance. For 3–4 hours, 20 µl of MTT (5 mg/mL) was added to the medium. Later, the formazan crystals were dissolved by DMSO after the supernatant was removed. Using an ELISA reader, the optical density of the solution was determined at 570 nm (Bio-Tek, USA) [20, 21].

MORPHOLOGICAL EVALUATION OF THE APOPTOTIC CELLS

The morphological signs of apoptosis in treated and untreated cells were assessed using Hoechst staining. Cells were seeded in a 24-well plate for this purpose and treated for 24, 48, and 72 hours (using the IC₅₀ value). The cells were then harvested and washed with cold phosphate-buffered saline (PBS). Then, a final concentration of 100 µg/ml of Hoechst 33258 solution (1 mg/ml ddH2O) was added to the cell suspension, and fluorescence microscopy was used to evaluate the cell morphology (EUM-5000 FLCD, Labex Instrument) [22].

CELL CYCLE ANALYSIS USING FLOWCYTOMETRY

Propidium iodide (PI) from Sigma Aldrich was used to assess the cell cycle after cells (8*10⁵ cells/well in a 12-well plate) were exposed to an IC₅₀ value derived after 24, 48, and 72 h of incubation with 4-BHPCP (St. Louis, MO, USA). By measuring the amount of DNA present in the cell, this approach determines the cell cycle phase. DNA staining was performed using a mixture of RNase and propidium iodide (PI). A minimum of 24 hours were required for the fixation of detached cells in 70% ethanol at -20°C before staining. Cells were cleaned with ethanol before being stained with PI for 30 minutes at room temperature. BD FACSCanto II was used for flow cytometry to analyze stained cells (BD Biosciences, Franklin Lakes, NJ, USA). Using FlowJo v10, the proportion of cells in the G0/G1, S, and G2/M phases was examined (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) [23].

APOPTOSIS DETERMINATION USING ANNEXIN V-FITC/PI

The apoptosis detection kit from BD Biosciences Pharmingen (San Diego, CA, USA) was used in accordance with the manufacturer's instructions to detect apoptosis by flow cytometry (FCM). In a 12-well plate at 37°C and 5% humidified CO2 for 24, 48, and 72 hours, cells (8*10⁵ cells) were IC₅₀ treatment. Following cell collection, cells were suspended in a binding buffer after being rinsed with cold PBS. At 4°C, tagged Annexin V and PI were used for a 30-minute dark staining procedure. The FACS Calibur flow cytometer from Becton Dickinson, Franklin Lakes, New Jersey, USA, was used to examine cells, and FlowJo v10 was used to quantify them (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) [24].

GENE EXPRESSION ANALYSIS

Real-time PCR was used to examine the expression of the BAX, BCL2, and SURVIVIN genes. RNA was extracted according to the manufacturer's instructions using the RNA isolation kit (SinaClon, Iran). The Prime Script TM RT Reagent Kit was used to create the cDNA from 500 ng of total RNA (Takara, Japan). Prime Script RT Reagent Kit (Takara, Japan) and RealQ Plus 2 Master Mix Green High ROX TM AmpliQon were used to perform quantitative real-time PCR (AmpliQon, Denmark). Bax, Bcl-2, and BIRC5 (Survivin) gene expression levels were compared to those of untreated (control) cells and normalized to the housekeeping gene -actin. The comparative Ct technique was used to disrupt each mRNA molecule's degree of expression. The sequences of the qPCR primers, which were created by Oligo (Macrogen, Seoul, South Korea), are displayed in Table 1. The following protocol was used when doing the qPCR: 40 cycles of amplification at 95°C for 30 s, 60–64°C for 30 s, 72°C for 30 s, and a final extension of 72°C for 5 minutes come after one denaturation cycle at 95°C for 5 minutes. The melting curve analysis was used to trace each cycle and evaluate the amplification specificity and primer dimer deficiency. Finally, the LinReg PCR 2017.9 version was used to calculate the average amplification efficiency for each primer. Each experiment was carried out three times [22, 23].

Table 1

Specific primer with the following sequences used in reverse transcription real-time quantitative polymerase chain reactions.
Gene	Forward and reverse primers (5ʹ–3ʹ)	Annealing temp. (°C)	Amplicon size (bp)
β-actin Bax Bcl2 Survivin	F: AGAGCTACGAGCTGCCTGAC R: AGCACTGTGTTGGCGTACAG F: GCAAACTGGTGCTCAAGG R: ACTCCCGCCACAAAGA F: TGGGAAGTTTCAAATCAGC R: GCATTCTTGGACGAGGG F: CCAGTTTCAAAAATTCACCAAG R: GACGACCCCATAGAGGAACATA	60 64 64 64	184 187 297 103
F, forward; R, Reverse

MOLECULAR DOCKING

The Lamarckian hereditary calculation was used for all docking calculations (LGA). Survivin (X-Center: -24.532, Y-Center: 36.317, Z-Center: 64.94) and Bcl2 were where the Grid Box was (X-Center: 47.359, Y-Center: 33.217, Z-Center: -5.437). For both, the number of points in the XYZ dimension were 60*60*60 angstroms for Survivin and 80*80*80 for Bcl2, and the midpoint lattice map of XX was 0.375. Following the conclusion of the docking investigation, the complex conformation with the lowest binding energy was selected for both goals. With the aid of UCSFChimera and Discovery Studio 4.1 Client, interactions between the Bcl2 complex and 4-BHPCP and Survivin were examined.

STATISTICAL ANALYSIS

At least three separate experiments were used to generate the results. Standard deviation and mean were used to express the data. GraphPad Prism 8.2.1 statistical software was used to perform a post hoc Tukey's test following a one-way analysis of variance (ANOVA) to determine the statistical significance of the differences (GraphPad Software Inc., San Diego, USA). When the probability values were less than 0.05, differences were deemed significant.

INHIBITION OF CELL GROWTH AND VIABILITY BY 4-BHPCP

Figure 2 displays the impact of different concentrations (0-120 µM) of 4-BHPCP on the survival of KG1-a cells after 24, 48, and 72 hours of incubation. For KG1-a cells, the 4-BHPCP compound's IC₅₀ was determined to be 25 µM/ml. A dose- and time-dependent inhibition of KG1-a cell growth by the chemical 4-BHPCP was observed. The outcomes showed that a 25 µM dosage of the 4-BHPCP lowered cell viability. Analysis of variance with a p-value of 0.05 was used to confirm the significance of various mean squares.

APOPTOTIC MORPHOLOGICAL CHANGES

Invert and fluorescence microscopy images of the treated cells with 4-BHPCP (at IC₅₀ value) were captured after 24–72 hours (Fig. 3). We noted that although cells grown under control conditions were spherical, those exposed to the test substance had wrinkles and contracted cytoplasm (Fig. 3A). Additionally, we noted using fluorescence microscopy that the viable and control cells were both a uniform blue color. However, the apoptotic cells had fractured chromatins and condensed nuclei that were blue with bright spots (Fig. 3B).

FLOW CYTOMETRIC ASSESSMENT OF CELL CYCLE

Following exposure to 4-BHPCP, the distribution of cells in each cell cycle phase was then examined in this assay using flow cytometry at several time points (24–72 h). The KG1-a cell line had a dose- and time-dependent increase in the sub-G1 population, which is a marker of apoptosis, according to the obtained data (Fig. 4A). Compared to the control cells, the aggregation of treated cells in the Sub-G1 phase on KG1-a increased by 38.2% after 72 hours of treatment. Further evidence that 4-BHPCP could cause S cell cycle arrest in the KG1-a cell line came from an increase in the S cell population. These results demonstrate that 4-BHPCP causes S-cell cycle arrest in the KG1-a cell line after 72 hours of treatment before causing apoptosis (Fig. 4B).

ASSESSMENT OF APOPTOSIS BY FLOWCYTOMETRY

Utilizing FCM together with Annexin V-FITC and PI labeling, cell apoptosis was identified. According to Fig. 5A, the tested compound's IC₅₀ concentration when applied to KG1-a cells caused them to undergo apoptosis in a dose- and time-dependent manner. Following 72 hours, treatment of the KG1-a cells with 4-BHPCP (at IC₅₀ value) caused roughly 11.8% of the cells to undergo apoptosis, according to flow cytometric examination (Fig. 5B).

EVALUATION OF BAX, BCL2, AND SURVIVIN GENES EXPRESSION IN KG1-A CELLS UPON 4-BHPCP EXPOSURE

Real-time PCR was performed to assess the expression of the genes Bax, Bcl2, and Survivin in KG1-a cells before and after exposure to 25 µM of 4-BHPCP. Figure 6A shows that after 72 hours, the treated cells' expression of the pro-apoptotic Bax gene rose considerably. Figure 6B demonstrates that after 72 hours of 4-BHPCP therapy, the anti-apoptotic gene Bcl2 was downregulated. After 72 hours of 4-BHPCP therapy, the expression of the Survivin gene was noticeably decreased (Fig. 6C). As shown in Fig. 6D, our results demonstrated that 4-BHPCP administration led to a progressive, dose- and time-dependent rise in the ratio of Bax/Bcl-2 mRNA levels in the KG1-a cell line.

LIGAND-SURVIVIN AND -BCL2 INTERACTIONS

Auto Dock 4.4.2 carried out the interaction between 4-BHPCP and Bcl2, as well as 4-BHPCP and Survivin. UCSF Chimera and LigPlot tools were used to study the 4-BHPCP-Survivin and 4-BHPCP-Bcl2 complexes. Analysis of the coupling data revealed that the compound of interest (4-BHPCP), along with the amino acids ARG18, LYS23, PRO12, and PHE58, firmly binds to the BIR domain of the Survivin protein (Fig. 6A). THR21 has a crucial function (Fig. 6A, b). Additionally, according to Fig. 6B, 4-BHPCP binds to the homology domain protein (BH3) of Bcl2, where the amino acids GLY104, ALA59, ALA108, PHE112, and PHE63 play a significant role (Fig. 6B, b). The Bcl2 and Survivin protein complex with the 4-BHPCP combination has the highest stable binding energy, with values of -8.4 and − 7.6 kcal, respectively, according to the results of Auto Dock 4.2. This indicates that due to its lower binding energy and inhibition constant (Ki), 4-BHPCP has a higher affinity to interact with Bcl-2 than Survivin (Table 2).

Table 2

The results of binding energy and inhibition constant (Ki) values of 4-BHPCP docked with Bcl2 and Survivin.
Ligand	Target	Binding domain	Free binding energy (Kcal/mol)	Inhibition Constant (µM)	Type of interaction	Important residues involved in the interaction
4-BHPCP	BCL2	A cavity between BH3 and BH1	-8.4	3.29	Mainly hydrogen network	GLY104, ALA59, ALA108, PHE112, and PHE63
4-BHPCP	Survivin	BIR domain	-7.6	6.93	Hydrogen and hydrophobic	ARG18, LYS23, PRO12 PHE58, and THR21

Chemotherapy is currently used to treat leukemia, but this method frequently results in drug resistance and severe systemic toxicity, which ultimately leading to treatment failure [25][26]. To find safer and more effective medications to treat leukemia, numerous studies have been carried out. Ciprofloxacin (CP) is a second-generation fluoroquinolone antibiotic that has received FDA approval and is frequently prescribed to treat infections. It has low negative effects [27]. These antibiotics exhibit decisive anti-tumor action in vitro and in vivo in addition to ciprofloxacin's antibacterial properties, but only at high and non-pharmacological concentrations [28–30]. Previous research has concentrated on the novel CP -analogues' capacity to interrupt the cell cycle and trigger apoptosis, which makes CP and its derivatives stand out as distinct medications [31, 32]. Additionally, numerous cell lines have indicated that ciprofloxacin compounds have cytotoxic effects [33, 34]. Synthetic broad-spectrum antibiotics known as fluoroquinolones are frequently used to treat a variety of diseases. Some of these antibiotics exhibit anticancer action in vivo and in vitro in distinct tumor cell lines [19, 24]. Topoisomerase inhibitors may exert their anticancer effects by preventing the synthesis of mitochondrial DNA, which leads to mitochondrial damage, respiratory chain blockage, and ATP depletion. Lack of energy can cause cell cycle stoppage in the G2/M or S phases, which encourages apoptosis [25, 26]. Compared to conventional topoisomerase II chemotherapies like doxorubicin and etoposide, CP is less vulnerable to efflux-mediated resistance [15]. Somekh et al. demonstrated in 1989 that ciprofloxacin induced a dose-dependent suppression of leukemic cell lines and hematopoietic progenitor cells' ability to form colonies. Two potential pathways for this inhibition were suggested: 1) Using a 200 µM dose of intracellular led to uncoupling of oxidative phosphorylation, as well as energy reduction. 2) Topoisomerase II inhibition: The mechanism behind this action likely has a significant impact on antiproliferative efficacy [35]. Ciprofloxacin as a fluoroquinolone antibiotic can decrease eukaryotic cell proliferation through mitochondrial DNA damage and interact with mitochondrial topoisomerase II isoform. The generation of free radicals may contribute to the cytotoxicity that CP causes in cells. This opens the way to employing CP as a possible anticancer agent due to its pro-apoptotic effects on mammalian tumor cell lines, including human primary (SW480) and metastatic (SW620) colon cancer, metastatic prostate cancer (PC3) cell lines [29]. Hamada. H.H. Mohammed et al. were able to successfully synthesize novel triazole-linked CP chalcone hybrids that had significantly anti-proliferative activity against colon tumor HCT116 cells and leukemia RPMI-8226 cells. Among the synthesized compounds, novel ciprofloxacin hybrids generated new anticancer activities, making them a possible candidate for treating colorectal cancer [36]. Using proteomic analysis, Alicja Chrzanowska et al. evaluated the impact of ciprofloxacin conjugates with fatty acids on various prostate cancer cell types (LNCaP and DU-145) and normal (RWPE-1) cells, as well as their impact on cell lipid metabolism. All the studied conjugates showed cytotoxic potential, with oleic, elaidic, and docosahexaenoic acids having the most potent effects. Compared to the hormone-dependent LNCaP line, the hormone-independent DU145 line was more responsive to derivatives. The most effective mixture is ciprofloxacin conjugated with oleic and elaidic acids. Together, these results support the significance of lipid metabolism in prostate cancer development and point to a focus on potential innovative therapeutic approaches and drug delivery systems[37]. A series of 7-(4-substituted piperazin-1-yl) fluoroquinolone derivatives were synthesized and their anticancer effects on 60 cancer cell lines were tested in a study by Abdel-Aziz et al. The outcomes were contrasted with those of the reference medications 5-fluorouracil, gefitinib, and erlotinib. These substances were more powerful than 5-fluorouracil (mean GI50 = 22.60 µM) and erlotinib (mean GI50 = 7.29 µM), which both had mean GI50 values of 2.63–3.09 µM. Their potency was comparable to gefitinib's as well, with a mean GI50 of 3.24 µM [38]. The ciprofloxacin analog with the 2-chlorophenyl group has stronger anticancer potential than other derivatives against the A549, HL-60, and Hela cell lines, according to research by K. Shou et al. (IC₅₀ values of 0.071, 0.043, and 0.032 µM, respectively). This substance has comparable action against topoisomerase I to irinotecan. Molecular docking studies demonstrated that the appropriate binding of the representative drug to DNA-topo I can support its anticancer activity [39]. Mohammed et al. synthesized N-(substituted carbamoyl methyl) ciprofloxacin derivatives and assessed their antiproliferative activity, impact on cell cycle analysis, and relationship with the expression of p53. The 4-chlorophenyl, 4-methoxyphenyl, 4-methyl phenyl, and cyclohexyl derivatives with IC₅₀ values of 14.8, 24.8, 23.6, and 20.7 µM, respectively, displayed greater activity against human non-small cell lung cancer (A549 cells) than ciprofloxacin, which had an IC₅₀ value of > 100 µM. Its effects, however, were not as great as those of the common medication doxorubicin (IC₅₀ = 1 µM). They also demonstrated that the effect of 4-chlorophenyl derivative on p53 and p21 activation as well as on cyclin B1 and Cdc2 protein inactivation plays a role in the induction of cell cycle arrest in the G2/M phase in A549 cells [17]. Demerci et al. reported the synthesis of thiadiazol-clubbed analogs of piperazinyl quinolones (PQs) with an amidic linker, taking into account the significance of this scaffold. The melanoma cell lines A579, PC3, and SK MEL1 (melanoma) were used to investigate the cytotoxic effect of the produced compounds at a concentration of 10 µM. All substances had negligible or no effect on the examined cell lines [40]. Piplani et al. used the N-Mannich base reaction of N-(benzo[d]thiazol-2-yl) acetamide with norfloxacin or ciprofloxacin in the presence of formalin in alcohol to synthesize benzothiazole-clubbed analogs of piperazinyl quinolones (PQs). The studied compounds with the highest potency against the human lung cancer cell line were 6-nitro benzothiazole derivatives, with GI50 values of 28.8 µg/mL [41]. A 1,3,4-thiadiazole molecule based on ciprofloxacin was synthesized by S.I. Farooqi. Studies using spectroscopy showed that the chemical significantly intercalated and bound to DNA. Moreover, the synthetic substance significantly inhibited human hepatocellular carcinoma (Huh-7) with an IC₅₀ value of 25.75 µM [42]. Levofloxacin and hydroxamic acid histone deacetylase inhibitor hybrids were synthesized by H.Li et al. and evaluated for their antiproliferative efficacy (SAHA). The compounds showed promising anticancer activity against all examined cell lines, including SW620, MGC-803, PC-3, NCIH460, MCF-7, and HepG2 (IC₅₀ = 0.6–15.9 µM), according to the results of biological experiments. In comparison to SAHA (IC₅₀ = 1.7–6.4 µM), the molecule containing six carbon atoms positioned between two carbonyl groups (n = 6) has an IC₅₀ value of 0.6–3.1 µM [43]. Rania Alaaeldin et al. synthesized a novel C7-piperazinyl ciprofloxacin ortho-phenolic chalcone Mannich base derivative known as the CM derivative, which significantly inhibited the activity of both topo I and II enzymes. Additionally, it exhibited antiproliferative properties, inhibited the ability of A549 and HepG2 cancer cell lines to migrate and form colonies, and activated the apoptotic pathway via the caspase 3 signaling cascade. Additionally, the CM derivative activated the RIPK1/RIPK3/MLKL pathway to start necro-apoptosis, a secondary lethal process. To better understand its effectiveness, safety, and mechanism of action, more research against other cancer cell lines is necessary[44]. Numerous in vitro and in vivo investigations have been done on the anticancer effects of Ciprofloxacin. Studies have shown ciprofloxacin reduced cell proliferation in A549 lung cancer cells, HepG2 hepatocellular carcinoma cells, 816f10 melanoma cells, MDA-MB-231 triple-negative breast cancer cells, and PANC-1 pancreatic cancer cells [45, 46]. Studies have revealed that Ciprofloxacin suppresses the proliferation by causing cell cycle arrest and induction of apoptosis in human colon, pancreatic and prostate cancer cell lines in a time and dose dependent manner. [15]. In this work, we evaluated the KG1-a leukemia cell line's response to the 4-BHPCP derivative of ciprofloxacin. Our findings demonstrated that the compound had a significant growth-inhibitory impact on the KG1-a cell line. Because considerable suppression of cell growth and viability occurred at 25 µM of the compound, KG1-a cells were drug-responsive. It may be inferred from prior research and the results of the MTT test used in the current study that 4-BHPCP has both an antiproliferative effect and an apoptosis-inducing activity that are dose- and time-dependent. Induction of apoptosis in 4-BHPCP-treated KG1-a cells over 72 hours was established by morphological studies and the Annexin V/PI double staining assay. Additionally, we investigated the KG1-a cell line's cell cycle before and after exposure to 4-BHPCP, and discovered a considerable rise in sub-G1 peak (sign of apoptosis) and cell cycle arrest at S phase. It was discovered that the anti-proliferative effects of moxifloxacin and ciprofloxacin were mediated via the induction of apoptosis and S-phase arrest in pancreatic cancer cells. When compared to moxifloxacin, ciprofloxacin was more successful at causing apoptosis [24]. Consequently, apoptosis and cell cycle arrest in tumor cells are therapeutic goals in cancer therapy; they destroy cancer cells from the body in a methodically manner using our proven substance, "4-BHPCP." After annexin V/PI labeling, the tested compound's capacity to induce apoptosis was consequently evaluated by FCM. Our findings demonstrated that 4-BHPCP treatment of KG1-a cells boosted the apoptotic rate in a dose- and time-dependent manner. In order to comprehend the mechanism by which this chemical exerts its anticancer effect, we also examined the levels of some genes. The pro-apoptotic gene Bax was expressed more frequently in the KG1-a cell line after treatment with the chemical "4-BHPCP," while anti-apoptotic genes Bcl2 and survival genes were expressed less frequently. As a result, 4-BHPCP treatment dramatically enhanced the Bax/Bcl-2 ratio in KG1-a cells. Our findings demonstrated that KG1-a cells undergo apoptosis when exposed to the novel ciprofloxacin derivative. Additionally, it was discovered to induce Bcl-2 down-regulation, Bax up-regulation, and survival expression, which causes apoptosis. As a result, it can activate the Bax/Bcl-2 dependent pathway, which in turn can stimulate the opening of the transition pores of mitochondrial permeability. In the following stage of the study, using the results of molecular docking analysis, we investigated whether the target compound (4-BHPCP) could interact with the BIR domain of the Survivin protein and the homology domain protein (BH3) of Bcl2 with potential consequences for cell viability and proliferation in an in vitro experimental model. Due to its lower binding energy and inhibition constant (Ki), 4-BHPCP has a higher affinity to interact with Bcl-2 than Survivin. The results of the current work are the first to show that this recently synthesized 4-BHPCP-ciprofloxacin derivative decreases the viability of human leukemia KG1-a cells, produces S-phase cell cycle arrest, and induces apoptosis through overexpression of Bax and downregulation of Bcl-2 and Survivin. The findings of this investigation could offer fresh perceptions of the therapeutic benefits of this brand-new ciprofloxacin derivative in managing acute myelocytic leukemia. To better understand the chemical mechanism behind the antiproliferative effect of this derivative, more investigation is required.

We concluded that the compound 4-BHPCP from ciprofloxacin had an antiproliferative effect and significant apoptosis-inducing activity in the human myeloid leukemia KG1-a cell line. Overexpression Bax and down-regulation Bcl2 and Survivin led to the induction of apoptosis in the cells. Our findings imply that this compound is a strong candidate for more pharmacological studies and for use as an effective chemotherapeutic agent in the treatment of cancer.

The Authors declare no potential conflicts of interest regarding this study.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Author Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Neda Pashapour, Mohammad Javad Dehghan-Nayeri, Majid Mahdavi, Esmaeil Babaei and Mohammad Khalaj-Kondori. The first draft of the manuscript was written by Neda Pashapour and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Ethical Approval

Not applicable.

Data Availability

Not applicable.

Arbiser JL, Bonner MY, Gilbert LC (2017) Targeting the duality of cancer. https://doi.org/10.1038/s41698-017-0026-x. npj Precis Oncol
Shafique S, Tehsin S (2018) Acute lymphoblastic leukemia detection and classification of its subtypes using pretrained deep convolutional neural networks. Technol Cancer Res Treat. https://doi.org/10.1177/1533033818802789
American Society of Hematology (2022) - Hematology.org. https://www.hematology.org/. Accessed 1
Dana-Farber Cancer Institute (2022) - Cancer Treatment and Research in Boston, MA. https://www.dana-farber.org/. Accessed 1
Swedan HK, Kassab AE, Gedawy EM, Elmeligie SE (2023) Design, synthesis, and biological evaluation of novel ciprofloxacin derivatives as potential anticancer agents targeting topoisomerase II enzyme. J Enzyme Inhib Med Chem. https://doi.org/10.1080/14756366.2022.2136172
Eisa MA, Fathy M, El-Din AA, Abu-Rahma G et al (2021) Anti-Proliferative and Pro-Apoptotic Activities of Synthesized 3,4,5 Tri-Methoxy Ciprofloxacin Chalcone Hybrid, through p53 Up-Regulation in HepG2 and MCF7 Cell Lines. Asian Pac J Cancer Prev. https://doi.org/10.31557/APJCP.2021.22.10.3393
Bearson BL, Brunelle BW (2015) Fluoroquinolone induction of phage-mediated gene transfer in multidrug-resistant Salmonella. Int J Antimicrob Agents. https://doi.org/10.1016/j.ijantimicag.2015.04.008
Dalhoff A, Shalit I (2003) Immunomodulatory effects of quinolones. Lancet Infect. Dis
Fallica AN, Barbaraci C, Amata E et al (2021) Nitric Oxide Photo-Donor Hybrids of Ciprofloxacin and Norfloxacin: A Shift in Activity from Antimicrobial to Anticancer Agents. J Med Chem. https://doi.org/10.1021/acs.jmedchem.1c00917
Mohammed HHH, Ali DME, Badr M et al (2022) Synthesis and molecular docking of new N4-piperazinyl ciprofloxacin hybrids as antimicrobial DNA gyrase inhibitors. Mol Divers. https://doi.org/10.1007/s11030-022-10528-z
Zemelman R, Bello H, Dominguez M et al (1993) Activity of imipenem, third-generation cephalosporins, aztreonam and ciprofloxacin against multi-resistant gram-negative bacilli isolated from chilean hospitals. J Antimicrob Chemother. https://doi.org/10.1093/jac/32.3.413
Peloquin CA, Cumbo TJ, Nix DE et al (1989) Evaluation of Intravenous Ciprofloxacin in Patients With Nosocomial Lower Respiratory Tract Infections: Impact of Plasma Concentrations, Organism, Minimum Inhibitory Concentration, and Clinical Condition on Bacterial Eradication. Arch Intern Med. https://doi.org/10.1001/archinte.1989.00390100083020
Beberok A, Rok J, Rzepka Z et al (2022) Interaction between moxifloxacin and Mcl-1 and MITF proteins: the effect on growth inhibition and apoptosis in MDA-MB-231 human triple-negative breast cancer cells. Pharmacol Rep. https://doi.org/10.1007/s43440-022-00407-7
Beberok A, Wrześniok D, Minecka A et al (2018) Ciprofloxacin-mediated induction of S-phase cell cycle arrest and apoptosis in COLO829 melanoma cells. Pharmacol Rep. https://doi.org/10.1016/j.pharep.2017.07.007
Beberok A, Wrześniok D, Rok J et al (2018) Ciprofloxacin triggers the apoptosis of human triple-negative breast cancer MDA-MB-231 cells via the p53/Bax/Bcl-2 signaling pathway. Int J Oncol. https://doi.org/10.3892/ijo.2018.4310
Kloskowski T, Gurtowska N, Olkowska J et al (2012) Ciprofloxacin is a potential topoisomerase II inhibitor for the treatment of NSCLC. Int J Oncol. https://doi.org/10.3892/ijo.2012.1653
Mohammed HHH, Abd El-Hafeez AA, Abbas SH et al (2016) New antiproliferative 7-(4-(N-substituted carbamoylmethyl)piperazin-1-yl) derivatives of ciprofloxacin induce cell cycle arrest at G2/M phase. Bioorg Med Chem. https://doi.org/10.1016/j.bmc.2016.07.070
Gao Y, Shang Q, Li W et al (2020) Antibiotics for cancer treatment: A double-edged sword. J Cancer. https://doi.org/10.7150/jca.47470
Shahbazi A, Mostafavi H, Zarrini G, Mahdavi M (2020) Novel N-4-Piperazinyl Ciprofloxacin-Ester Hybrids: Synthesis, Biological Evaluation, and Molecular Docking Studies. Russ J Gen Chem. https://doi.org/10.1134/S1070363220080265
Alaaeldin R, Nazmy MH, Abdel-Aziz M et al (2020) Cell cycle arrest and apoptotic effect of 7-(4-(n-substituted carbamoylmethyl) piperazin-1-yl) ciprofloxacin-derivative on HCT 116 and A549 cancer cells. Anticancer Res. https://doi.org/10.21873/anticanres.14245
Bahuguna A, Khan I, Bajpai VK, Kang SC (2017) MTT assay to evaluate the cytotoxic potential of a drug. Bangladesh J Pharmacol. https://doi.org/10.3329/bjp.v12i2.30892
Eslami F, Mahdavi M, Babaei E et al (2020) Down-regulation of Survivin and Bcl-2 concomitant with the activation of caspase-3 as a mechanism of apoptotic death in KG1a and K562 cells upon exposure to a derivative from ciprofloxacin family. Toxicol Appl Pharmacol. https://doi.org/10.1016/j.taap.2020.115331
Kloskowski T, Szeliski K, Fekner Z et al (2021) Ciprofloxacin and levofloxacin as potential drugs in genitourinary cancer treatment—the effect of dose–response on 2D and 3D cell cultures. Int J Mol Sci. https://doi.org/10.3390/ijms222111970
Fathy M, Sun S, Zhao QL et al (2020) A New Ciprofloxacin-derivative Inhibits Proliferation and Suppresses the Migration Ability of HeLa Cells. Anticancer Res. https://doi.org/10.21873/anticanres.14505
Shi L, Song Q, Zhang Y et al (2010) Potent antitumor activities of recombinant human PDCD5 protein in combination with chemotherapy drugs in K562 cells. Biochem Biophys Res Commun. https://doi.org/10.1016/j.bbrc.2010.04.068
Zhang J, Gu Y, Chen B (2019) OncoTargets and Therapy Dovepress Mechanisms of drug resistance in acute myeloid leukemia. Onco Targets Ther
Lim EJ, Yoon YJ, Heo J et al (2018) Ciprofloxacin enhances TRAIL-induced apoptosis in lung cancer cells by upregulating the expression and protein stability of death receptors through CHOP expression. Int J Mol Sci. https://doi.org/10.3390/ijms19103187
Al-mahallawi AM, Khowessah OM, Shoukri RA (2017) Enhanced non invasive trans-tympanic delivery of ciprofloxacin through encapsulation into nano-spanlastic vesicles: Fabrication, in-vitro characterization, and comparative ex-vivo permeation studies. Int J Pharm. https://doi.org/10.1016/j.ijpharm.2017.03.005
Chrzanowska A, Roszkowski P, Bielenica A et al (2020) Anticancer and antimicrobial effects of novel ciprofloxacin fatty acids conjugates. Eur J Med Chem. https://doi.org/10.1016/j.ejmech.2019.111810
Gürbay A, Osman M, Favier A, Hincal F (2005) Ciprofloxacin-induced cytotoxicity and apoptosis in HeLa cells. Toxicol Mech Methods. https://doi.org/10.1080/153765291009877
Azéma J, Guidetti B, Dewelle J et al (2009) 7-((4-Substituted)piperazin-1-yl) derivatives of ciprofloxacin: Synthesis and in vitro biological evaluation as potential antitumor agents. Bioorg Med Chem. https://doi.org/10.1016/j.bmc.2009.06.053
Beberok A, Wrześniok D, Minecka A et al (2018) Ciprofloxacin-mediated induction of S-phase cell cycle arrest and apoptosis in COLO829 melanoma cells. Pharmacol Rep. https://doi.org/10.1016/j.pharep.2017.07.007
Abdel-Aziz M, Park SE, Abuo-Rahma GEDAA et al (2013) Novel N-4-piperazinyl-ciprofloxacin-chalcone hybrids: Synthesis, physicochemical properties, anticancer and topoisomerase i and II inhibitory activity. Eur J Med Chem. https://doi.org/10.1016/j.ejmech.2013.08.040
Suresh N, Nagesh HN, Chandra Sekhar KVG et al (2013) Synthesis of novel ciprofloxacin analogues and evaluation of their anti-proliferative effect on human cancer cell lines. Bioorg Med Chem Lett. https://doi.org/10.1016/j.bmcl.2013.09.077
(PDF) IS CIPROFLOXACIN AN ANTI-CANCER, DRUG? A MINIREVIEW. https://www.researchgate.net/publication/305319162_IS_CIPROFLOXACIN_AN_ANTI-CANCER_DRUG_A_MINIREVIEW. Accessed 6 Feb 2023
Mohammed HHH, Abd El-Hafeez AA, Ebeid K et al (2022) New 1,2,3-triazole linked ciprofloxacin-chalcones induce DNA damage by inhibiting human topoisomerase I& II and tubulin polymerization. J Enzyme Inhib Med Chem 37:1346–1363. https://doi.org/10.1080/14756366.2022.2072308
Chrzanowska A, Olejarz W, Kubiak-Tomaszewska G et al (2022) The Effect of Fatty Acids on Ciprofloxacin Cytotoxic Activity in Prostate Cancer Cell Lines—Does Lipid Component Enhance Anticancer Ciprofloxacin Potential? Cancers (Basel). https://doi.org/10.3390/cancers14020409
Abdel-Aziz AAM, El-Azab AS, Alanazi AM et al (2016) Synthesis and potential antitumor activity of 7-(4-substituted piperazin-1-yl)-4-oxoquinolines based on ciprofloxacin and norfloxacin scaffolds: in silico studies. J Enzyme Inhib Med Chem. https://doi.org/10.3109/14756366.2015.1069288
Shou KJ, Li J, Jin Y, Lv YW (2013) Design, synthesis, biological evaluation, and molecular docking studies of quinolone derivatives as potential antitumor topoisomerase I inhibitors. Chem Pharm Bull. https://doi.org/10.1248/cpb.c13-00040
Demirci A, Karayel KG, Tatar E et al (2018) Synthesis and evaluation of novel 1,3,4-thiadiazole–fluoroquinolone hybrids as antibacterial, antituberculosis, and anticancer agents. Turkish J Chem. https://doi.org/10.3906/kim-1710-35
Piplani M, Rajak H, Sharma PC (2017) Synthesis and characterization of N-Mannich based prodrugs of ciprofloxacin and norfloxacin: In vitro anthelmintic and cytotoxic evaluation. J Adv Res. https://doi.org/10.1016/j.jare.2017.06.003
Farooqi SI, Arshad N, Channar PA et al (2018) Synthesis, theoretical, spectroscopic and electrochemical DNA binding investigations of 1, 3, 4-thiadiazole derivatives of ibuprofen and ciprofloxacin: Cancer cell line studies. J Photochem Photobiol B Biol. https://doi.org/10.1016/j.jphotobiol.2018.10.006
Li H, Han X, Li DW (2017) Synthesis and anti-tumor activity of levofloxacin-thiadiazole histone deacetylase inhibitor conjugates. Yaoxue Xuebao. https://doi.org/10.16438/j.0513-4870.2016-l134
Alaaeldin R, Abdel-Rahman IM, Ali FEM et al (2022) Dual Topoisomerase I/II Inhibition-Induced Apoptosis and Necro-Apoptosis in Cancer Cells by a Novel Ciprofloxacin Derivative via RIPK1/RIPK3/MLKL Activation. https://doi.org/10.3390/MOLECULES27227993. Molecules 27:
Gupta P, Gao HL, Ashar YV et al (2019) Ciprofloxacin enhances the chemosensitivity of cancer cells to ABCB1 substrates. Int J Mol Sci. https://doi.org/10.3390/ijms20020268
Ahadi H, Emami S (2020) Modification of 7-piperazinylquinolone antibacterials to promising anticancer lead compounds: Synthesis and in vitro studies. Eur. J. Med. Chem

No competing interests reported.

Download PDF

Journal Publication

published 03 Aug, 2023

Read the published version in Journal of Fluorescence →

Editorial decision: Major revision
20 Jun, 2023
Reviews received at journal
17 Jun, 2023
Reviewers agreed at journal
13 Jun, 2023
Reviewers agreed at journal
30 May, 2023
Reviewers invited by journal
29 May, 2023
Editor assigned by journal
29 May, 2023
Submission checks completed at journal
29 May, 2023
First submitted to journal
20 May, 2023

You are reading this latest preprint version

The Assessment of cytotoxicity, apoptosis inducing activity and molecular docking of a new ciprofloxacin derivative in human leukemic cells

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

PREPARATION OF THE INVESTIGATED CIPROFLOXACIN COMPOUND

CELL CULTURE

CELL VIABILITY ASSAY

MORPHOLOGICAL EVALUATION OF THE APOPTOTIC CELLS

CELL CYCLE ANALYSIS USING FLOWCYTOMETRY

APOPTOSIS DETERMINATION USING ANNEXIN V-FITC/PI

GENE EXPRESSION ANALYSIS

MOLECULAR DOCKING

STATISTICAL ANALYSIS

RESULTS

APOPTOTIC MORPHOLOGICAL CHANGES

FLOW CYTOMETRIC ASSESSMENT OF CELL CYCLE

ASSESSMENT OF APOPTOSIS BY FLOWCYTOMETRY

EVALUATION OF BAX, BCL2, AND SURVIVIN GENES EXPRESSION IN KG1-A CELLS UPON 4-BHPCP EXPOSURE

LIGAND-SURVIVIN AND -BCL2 INTERACTIONS

DISCUSSION

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1