Effects of nNOS inhibition on the Escherichia coli and butyrate-producing bacteria in IBS rats with visceral hypersensitivity

doi:10.21203/rs.3.rs-2964008/v1

Download PDF

Research Article

Effects of nNOS inhibition on the Escherichia coli and butyrate-producing bacteria in IBS rats with visceral hypersensitivity

https://doi.org/10.21203/rs.3.rs-2964008/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background:

Irritable bowel syndrome (IBS) is described as a disorder of the microbiota-gut-brain axis, with a distinguishing feature of visceral hypersensitivity. An imbalanced gut microbiota is closely related to the occurrence of IBS. Neuronal nitric oxide synthase (nNOS) may be an essential regulatory factor in stress-induced IBS. However, the relationship between gut microbiota and nNOS expression is still poorly understood. The aim of the present study is to investigate the effects of nNOS inhibition on the changes of Escherichia coli and butyrate-producing bacteria in IBS rats with visceral hypersensitivity.

Method:

Colorectal distention (CRD) combined with restraint stress (RS) was used to generate an IBS rat model with visceral hypersensitivity. L-NAME was administered as an nNOS inhibitor. Abdominal withdrawal reflex (AWR) test was used to evaluate visceral sensitivity in rats. Western blotting and real-time PCR were used to determine expression levels of nNOS in the distal colon of rats. The content of nitric oxide (NO) andnitritein the distal colon of rats was determined using colorimetric methods. Gut microbiota was assessed by fluorescence qPCR. Liquid chromatography-mass spectrometry (LC-MS/MS) was used to quantify butyrate content in the feces and distal colon of rats.

Results:

nNOS inhibiton could attenuate visceral hypersensitivity in stress-induced IBS rats. Gut microbiota was changed after treatment with nNOS inhibiton, which was characterized by a decrease in the abundance of Escherichia coli and an increase in the abundance of butyrate-producing bacteria. Moreover, nNOS inhibiton decreased the contents of NO and nitrite and increased butyrate content in the distal colon of rats. From further Spearman’s correlation analysis, nNOS expression was positively correlated with Escherichia coliand negatively correlated with butyrate-producing bacteria.

Conclusion:

nNOS inhibiton reduced the production of NO and nitrite by down-regulation of expression levels of nNOS, thus regulating the imbalance of gut microbiota,as demonstrated by a decrease in the abundance of Escherichia coli, as well as an increase in the abundance of butyrate-producing bacteria, which contributed to attenuating the visceral hypersensitivity in IBS rats.

neuronal nitric oxide synthase

irritable bowel syndrome

visceral hypersensitivity

Escherichia coli

butyrate-producing bacteria

Irritable bowel syndrome (IBS) is a functional gastrointestinal disorder whose main symptoms include recurrent abdominal pain associated with changes in stool form and/or fecal output frequency[1]. IBS affects approximately 11% of the global population, while its incidence in China is approximately 7.26–11.5%[2, 3]. Although IBS is not a life-threatening condition, it has a substantial impact on the quality of life[4] and social functioning of affected individuals[5, 6]. However, the pathophysiology of IBS is not fully understood.

It is well established that a disrupted communication in the microbiota-gut-brain axis results in visceral hypersensitivity, which is the core pathological alteration underlying the emergence of IBS[7]. In addition, it has been suggested more recently that an imbalanced gut microbiota is closely related to the occurrence of IBS[8, 9]. A series of studies have shown that a significant decrease in microbial diversity associated with a significant decrease in abundance of butyrate-producing bacteria were found in both IBS patients and model rats[10–12]. Moreover, it has been reported that IBS patients have an imbalanced gut microbiota and are more susceptible to intestinal colonization by harmful bacteria, e.g., Escherichia coli, which are considered the etiological factors of visceral sensitivity[13, 14].

Nitric oxide (NO) is a free radical signal-transducing molecule synthesized by NO synthase (NOS) isoenzymes from L-arginine, and plays an essential role in the physiology and pathophysiology of the gastrointestinal tract. Three isoforms of NOS are known, i.e., neuronal NOS (nNOS, NOS1), inducible NOS (iNOS, NOS2) and endothelial NOS (eNOS, NOS3). iNOS is mainly involved in the inflammatory response, while eNOS contributes to blood pressure control and exerts other vasoprotective effects[15, 16]. nNOS is primarily expressed in central and peripheral neurons and regulates synaptic plasticity, blood pressure, and smooth muscle relaxation via the peripheral nitrergic nerve[17]. Among the three NOS isoforms, nNOS is positively associated with external stress[18]. Relevant studies have suggested that nNOS may be an essential regulatory factor in stress-induced IBS[19]. In addition, it was reported that a high expression level of nNOS in the brain and colon of IBS rats, whereas a positive correlation was found between nNOS expression and bowel motility in stress-induced IBS rats.[20]. Clinical studies have also reported increased NO production in plasma and rectal tissues of IBS patients[21, 22].Collectively, these findings suggest that the gut microbiota and nNOS are likely key factors regulating stress-induced IBS with visceral hypersentivity. However, the relationship between gut microbiota and nNOS expression is still poorly understood.

Therefore, the aim of the present study is to investigate the effects of nNOS inhibition on the changes of Escherichia coli and butyrate-producing bacteria in IBS rats with visceral hypersensitivity. A scheme of the study design is proposed in Fig. 1.

2.1. Experimental animals

Experiments involving animals were given previous approval by the Animal Experimentation Ethics Committee of Zhejiang Chinese Medical University, under the approval number #IACUC-20211220-14.

A total of 18 male Sprague-Dawley rats (6–8 weeks old and approximately 260–290 g of body weight;Shanghai SLAC Laboratory Animal Co.,Ltd) were reared in cages in a temperature-controlled room under a 12-h shift of light-dark cycle. Animals had access to food and water ad libitum, and were subjected to the experimental procedures described below after one week of adaptive feeding.

2.2. Model establishment

Rats were randomly divided into three experimental groups (n = 6 per group): i) control group; ii) IBS model group; and iii) nNOS inhibition group.

As previously described[23], a 14-day colorectal distention (CRD) combined with five days of subsequently treatment with restraint stress (RS) was used to establish a rat model of IBS visceral hypersensitivity in both the IBS model group and nNOS inhibition group. Briefly, an 8F balloon catheter was inserted into the rectum to make the balloon site about 2 cm away from the anus, and the catheter was fixed to the rat tail using figure-of-eight fixation. The rats then underwent CRD twice at a pressure of 60 mmHg for 1 min with a 30-min between each distension for 14 days. After CRD, the rats were placed in a specific restraint device, and their limb activities were restricted without affecting their breathing. RS was induced by 2 hours of immobilization for five consecutive days. These experiments were performed between 12:00 p.m. and 14:00 p.m. daily; rats in the control group did not undergo CRD combined with RS.

2.3. Administration of nNOS inhibition

After modeling, rats in the nNOS inhibition group were administered L-NAME (MedChemExpress, Shanghai, China) (100 mg/Kg) intraperitoneally at a dose of 1 mL/Kg dissolved in distilled water 1 hour prior to the CRD; rats in the control group and the IBS model group were administrated intraperitoneally with equal volume distilled water instead of L-NAME.

2.4. Visceral sensitivity measurement

Visceral sensitivity of rats was assessed by the abdominal withdrawal reflex (AWR) test[24, 25]: 0, no behavioral response to CRD; 1, brief head movement only; 2, contraction of abdominal muscles; 3, lifting of the abdomen; 4, arching of the body and lifting of the pelvis. The balloon pressure to which each rat responded by lifting the abdomen (AWR score = 3) was recorded as the pain threshold intensity of CRD. During the measurements, CRD was conducted three times in each rat by two independent evaluators for 30 s and separated by 5 min. The average AWR value was obtained to filter out discrepancies, and considered for downstream statistical analyses.

2.5. Sample collection

Rats were sacrificed by CO₂ gas inhalation; the distal colon was dissected, and the tissue and its contents were immediately collected and frozen at − 80°C for subsequent analysis.

2.6. Determination of NO and nitrite contents

NO and nitrite contents in the distal colon of rats were determined using colorimetric methods. Frozen samples of the distal colon were homogenized in phosphate-buffered saline, and the supernatants were collected after centrifugation. According to the manufacturer’s instructions, NO and nitrite contents in the distal colon of rats were determined using colorimetric assays which were applied by the Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). The absorbance of samples was measured at 550 nm using a Thermo Scientific Varioskan Flash (Thermo Fisher, USA).

2.7. Determination of protein and mRNA expression levels of nNOS

Western blotting and real-time PCR were used to evaluate changes in protein and mRNA expression levels of nNOS in the three experimental groups.

After grinding in liquid nitrogen, 1ml of total protein extraction reagent containing protease inhibitors was added, and proteins were extracted from frozen distal colon tissue after homogenization. Protein content was determined using the BCA protein Quantification kit according to the manufacturer's instructions. Primary antibodies included nNOS (cat. no. 4234S, 1:40; Cell Signaling Technology, Inc, USA) and β‑actin (cat. no. ET1601-4, 1:1,000; Shanghai Ruiyuan Biotechnology, China). The secondary antibodies were included in the Simple Wes Kit (Protein Simple, USA).The Simple Western 12–230 kDa Size-based Assay was employed using a Wes™ system (Protein Simple, USA).

Total RNA was extracted from frozen samples of distal colon tissues following the manufacturer’s instructions. cDNA was synthesized using a TaKaRa reverse transcription kit (TaKaRa Biotechnology Co., Japan) and primers shown in Table 1. Real-time PCR amplifications were carried out in an ABI real-time PCR system (Applied Biosystems, USA).

2.8. Quantitative detection of gut microbiota

Quantitative PCR was used to detect target bacteria in rat fecal samples. Total bacterial DNA was isolated from rat fecal samples, and concentration of DNA samples was determined using micronucleic acid quantification instrument. Primers used in qPCR amplifications are reported in Table 1. Plasmids containing target genes were 10-fold diluted to be used as standards for establishing the qPCR standard curve; plasmids were manufactured by Zhejiang Tianke Biotechnology (Zhejiang, China). PCR mixtures (20 µL final volume) contained 10 µL of SYBR Green qPCR Super-Mix-UDG with Rox (Invitrogen, USA), 0.4 µL of each primer (10 µm), 8.2 µL of DNA-free water, and 10 ng of standard plasmid or DNA template. Thermal cycling steps for qPCR amplifications were conducted according to the manufacturer's instructions in an ABI real-time PCR system 7500 (Applied Biosystems). Primer specificity was confirmed by melting curves and gel electrophoresis. Each gene was surveyed in triplicate for each sample, and its mRNA expression level was compared against the standard curve and a negative control. The efficiency of qPCR amplifications was within the range of 90.3–97.5%.

Table 1

Primer pairs used in the present study.
Target	Nucleotide sequence (5'→ 3')
nNOS	F: AATGGTGGAGGTGCTGGAGGAG
nNOS	R: GTCTGGAGAGGAGCTGATGGAGTAG
GAPDH	F: GGCACAGTCAAGGCTGAGAATG
GAPDH	R: ATGGTGGTGAAGACGCCAGTA
Total bacteria	F: TCCTACGGGAGGCAGCAGT
Total bacteria	R: GGACTACCAGGGTATCTATCCTGTT
Escherichia coli	F: GCGAAGTTAAACACCACGAC
Escherichia coli	R: ACCCGTACCAGCAGTAGATT
Butyrate-producing bacteria	F: GCIGAICATTTCACITGGAAYWSITGGCAYATG
Butyrate-producing bacteria	R: CCTGCCTTTGCAATRTCIACRAANGC

2.9. Determination of butyrate content

Butyrate content in the colon and stool samples was determined by liquid chromatography-mass spectrometry tandem technique (LC-MS/MS). LC-MS/MS analyses were performed using a UPLC system coupled with an AB4000 triple quadrupole mass spectrometer. Chromatographic conditions were as follows: EC-C18 column (4.6 × 50 mm, 2.7 µm; Agilent Technologies, USA); column temperature, 30°C; flow rate, 0.3 mL/min; mobile phase A, 0.05% formic acid; mobile phase B, methanol; post-time, 15 min; injection volume, 10 µL; isometric elution, 80:20. Mass spectrometry conditions were as follows: ion source, positive ion mode; spray voltage, 4500; temperature, 450°C; ion source gas, 1:40 arb; ion source gas, 2:50 arb; curtain gas, 35 arb; collision gas pressure, 7 arb.

2.10. Statistical analysis

Data were expressed as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism 9.3 (GraphPad Inc., San Diego, CA, USA). One-way ANOVA with Tukey's multiple comparisons test was performed for comparison between multiple groups, Spearman's correlation analysis was used for correlation analysis, and differences were considered significant when p values were < 0.05.

3.1. nNOS inhibition attenuated visceral hypersensitivity in stress-induced IBS rats

All rats in all experimental groups survived. However, rats in the IBS model group and nNOS inhibition group showed restlessness, sluggish reaction, watery stool, accompanied by perianal fecal residue, and weight loss. Conversely, rats in the control group were found in good health condition and did not show the above related symptoms.

The nutritional status of rats was evaluated by observing changes in body weight prior to and after modeling. Prior to modeling, no significant difference was found in body weight of rats in the three experimental groups (p = 0.8801; p = 0.7300) (Fig. 2A). After modeling, body weight was significantly reduced in rats of the IBS model group compared with the control group (p < 0.0001), although no significant difference was found when compared to the nNOS inhibition group (p = 0.2810) (Fig. 2B).

Visceral sensitivity in rats of each experimental group was evaluated by determining the balloon pressure required to achieve AWR score 3 as the pain threshold pressure. The pain threshold pressure in the IBS model group (44.67 ± 3.01 mmHg) was markedly lower than that in the control group (66.67 ± 7.86 mmHg) (p < 0.0001), although the difference was not statistically significant when compared with the nNOS inhibition group prior to the L-NAME treatment (46.22 ± 3.11 mmHg) (p = 0.8628) (Fig. 2C). However, after treatment with L-NAME, the pain threshold pressure in the nNOS inhibition group significantly increased, reaching 60.00 ± 4.46 mmHg, which was remarkably higher than that in the IBS model group (p = 0.0004) (Fig. 2D). Taken together, these findings suggest that a IBS rat model with visceral hypersensitivity was successfully established in the IBS model group and nNOS inhibition group, and nNOS inhibition mediated by treatment with L-NAME significantly attenuated visceral sensitivity in IBS rats.

3.2. nNOS inhibiton reduced NO and nitrite contents in IBS rats

Compared with the control group, protein and mRNA expression levels of nNOS in the distal colon of rats in the IBS model group were significantly increased (p < 0.0001; p = 0.0498). In contrast, they were significantly decreased in rats in the nNOS inhibition group after treatment with L-NAME (p < 0.0001; p = 0.0009) (Fig. 3A, B). These findings suggested that protein and mRNA expression levels of nNOS in the distal colon of rats increased significantly after the establishment of the IBS rat model with visceral hypersensitivity, and were substantially attenuated by nNOS inhibition mediated by L-NAME.

NO content in the distal colon of rats in the IBS model group was significantly higher compared to rats in the control group (p = 0.0103), whereas it was markedly reduced in rats in the nNOS inhibition group (p = 0.0002) (Fig. 3C). In addition, nitrite content was markedly elevated in rats in the IBS model group compared with rats in the control group (p = 0.0082). Furthermore, treatment with L-NAME significantly reduced nitrite content in the distal colon of nNOS inhibition group rats (p = 0.0010) (Fig. 3D). Collectively, these observations revealed that higher NO and nitrite levels were found in the distal colon of rats in the IBS visceral hypersensitivity model group, which decreased after treatment with L-NAME .

3.3. nNOS inhibiton regulated the imbalance between Escherichia coli and butyrate-producing bacteria in IBS rats

No significant difference was found in the number of total bacteria in the feces of rats

among the three experimental groups (p = 0.6450; p = 0.9637) (Fig. 4A). The number and relative abundance of butyrate-producing bacteria in the feces of rats in the IBS model group decreased significantly compared with rats in the control group (p = 0.0193; p = 0.0010). Moreover, the number and relative abundance of Escherichia coli in the feces of rats in the IBS model group were found increased compared to those of rats in the control group (p = 0.0450; p = 0.0229). However, after treatment with L-NAME, an opposite trend was observed, the number and relative abundance of butyrate-producing bacteria increased (p = 0.0120; p = 0.0055), whereas the relative abundance of Escherichia coli decreased (p = 0.0282), the number of Escherichia coli showed a downward trend without significant difference (p = 0.0564) (Fig. 4B-E).Overall, a significant decrease in the abundance of butyrate-producing bacteria accompanied by an increase in the abundance of Escherichia coli in IBS rats with visceral hypersensitivity in the model group developed herein, a trend which was reversed by treatment with L-NAME.

From further Spearman’s correlation analysis, nNOS expression had a significant negative correlation with the abundance of butyrate-producing bacteria (p = 0.0067) and a significant positive correlation with the abundance of Escherichia coli (p = 0.0088) (Fig. 4F, G).

Compared with the control group, butyrate content in the feces and distal colon of rats was significantly decreased in rats in the IBS model group (p = 0.0490; p = 0.0471). However, after treatment with L-NAME, butyrate content in the distal colon of rats increased significantly (p = 0.0127), although no significant difference was found in the feces (p = 0.1946) (Fig. 4H, I). These results suggest that butyrate content in the feces and distal colon decreased in rats in the IBS visceral hypersensitivity model, while intervention with L-NAME significantly increased butyrate content in the distal colon of rats.

IBS is a common stress-related functional gastrointestinal disorder with a high incidence rate and poor therapeutic management [4, 26]. The pathophysiology of IBS is multifactorial, although visceral sensitivity is considered a distinguishing feature of IBS which is often triggered or sustained by stress[27]. It is widely known that stress can alter intestinal motility, mucosal transport, and gut barrier function[28–33]. Recent studies suggested that stress can lead to changes in gut microbiota composition and modify pain circuitry, thus contributing to visceral hypersensitivity, which might be described a disorder of the microbiota-gut-brain axis[34–36]. However, the mechanism by which the gut microbiota becomes altered and its role in determining visceral hypersensitivity remain to be further explored. In the present study, we try to comfirm the correlation of nNOS expression and gut microbiota in stress induced IBS rats. Herein, we found that expression level of nNOS increased significantly in IBS rats, and nNOS inhibition could attenuate visceral hypersensitivity through regulation of gut microbiota, reducing NO and nitrite contents and elevating butyrate content in stress-induced IBS rats. These results suggest that nNOS is closely related to gut microbiota,which is involved in the occurrence of visceral hypersensitivity in stress-induced IBS rats.

In recent years, multiple clinical studies have suggested that the gut microbiota might play a role in the pathophysiology of IBS. Bennet et al. reported discrepancies in gut microbiota composition between IBS patients and healthy subjects[37]. Theodorou et al. reported that intervention with probiotics significantly improved visceral hypersensitivity in patients with IBS[38]. Herein, it was found that the relative abundance of butyrate-producing bacteria decreased significantly whereas the relative abundance of Escherichia coli increased in IBS model rats with visceral hypersensitivity. These findings are consistent with the results of previous studies, which suggested that the proportion of dominant bacteria was significant decreased whereas that of harmful bacteria was increased in IBS[13, 39].

It is well known that nNOS has various roles as a neurotransmitter in the gastrointestinal tract. Previous studies have shown that nNOS is a key enzyme for the production of NO in central and peripheral nervous systems[40]. Han et al. reported a significant increase in nNOS expression in organs of the large intestine, adrenal gland, and hypothalamus, as well as suggested that nNOS could be a biomarker of the HPA axis linked to visceral hypersensitivity in IBS[20]. The experimental results discussed herein showed that nNOS protein and mRNA levels increased significantly in IBS rat with visceral hypersensitivity, which was also accompanied by the imbalance of gut microbiota, as demonstrated by an increase in the abundance of pathogenic bacteria, such as Escherichia coli, as well as a decrease in the proportion of obligatory anaerobic bacteria, including butyrate-producing bacteria. After treatment with nNOS inhibitor L-NAME, visceral sensitivity of IBS rats reduced significantly, and an opposite changing trend was observed in the gut microbiota. In particular, L-NAME inhibited the overgrowth of Escherichia coli, while increased the number and relative abundance of butyrate-producing bacteria. Besides that, we performed Spearman’s correlation analysis and found that nNOS expression had a positive correlation with Escherichia coli and a negative correlation with butyrate-producing bacteria.

In addition, the mechanism of the interplay between nNOS and gut microbiota was further explored, which revealed that NO and nitrite contents showed an upward trend, whereas butyrate content showed a downward trend in the distal colon of the IBS rat model with visceral hypersensitivity; conversely, treatment with L-NAME reduced NO and nitrite contents, and increased butyrate content by down-regulating the expression of nNOS. Moreover, it has been confirmed that NO reacts with superoxide radical (O₂^•−) to generate peroxynitrite (ONOO⁻), which can then form nitrate (NO₃⁻) and be used by pathogenic facultative anaerobes such as Escherichia coli, thus outcompeting positive obligate anaerobes that characterize a healthy gut microbiota[41–43]. Unlike obligate anaerobes such as butyrate-producing bacteria, facultative anaerobic bacteria from the family Enterobacteriaceae, such as Escherichia coli, can increase in number by utilizing nitrate to nitrite (NO₂⁻) during anaerobic respiration[44, 45]. Reduced butyrate content will further stimulate nitrate production, promote the growth of Escherichia coli and aggravate the imbalance of the gut microbiota[42].

Herein, it was found that stress-induced up-regulation of nNOS expression could increase the production of NO and nitrite, thus aggravating the imbalance of the gut microbiota, which was demonstrated by an increase in the abundance of Escherichia coli and a decrease in the abundance of butyrate-producing bacteria. These alterations contributed to the emergence of visceral hypersensitivity in IBS rats. Furthermore, it was revealed that nNOS inhibiton L-NAME could reduce visceral hypersensitivity by decreasing the content of NO and nitrite, as well as by inhibiting the overgrowth of Escherichia coli and simultaneously increasing the proportion of butyrate-producing bacteria in IBS rats. Although nNOS might be considered a biomarker for regulating gut microbiota and improving visceral sensitivity in IBS rats, the underlying mechanism still requires to be further studied, ideally in human subjects. A schematic model of the findings of the present study is shown in Fig. 5.

Ethics approval, guidelines and consent to participate

This animal study was approved by the Animal Experiment Ethics Committee of Zhejiang Chinese Medical University with approval number :IACUC-20211220-14. Animal Laboratory Center of Zhejiang Chinese Medical University has been certified by AAALAC. All experiments were performed in accordance with ARRIVE guidelines. All procedures were performed in accordance with the relevant guidelines in the manuscript.

Consent for publication

Not applicable.

Availability of data and materials

All data and materials supporting the findings discussed in the present study are available upon request from the correspondence author.

Competing interests

The authors declare no competing interests.

Funding

This work was funded by the National Science Foundation of China (Grant no. 81970470)；the Zhejiang Provincial Nature Foundation of China (Grant no. LQ21H030001)；the Research Project of Zhejiang Chinese Medical University（Grant no. 2021JKZKTS032B）

Author contributions

Chen Huang and Yue Hu wrote the main text of the manuscript; Sun Shaopeng and Li Heng conducted research experiments; Zhaomeng Zhuang prepared the figures; Bin Lv designed the study and revised the final version of the manuscript.

Acknowledgements

There are no acknowledgments to report.

Authors' information

The First Clinical Medical College of Zhejiang Chinese Medical University, Hangzhou, China

Department of Gastroenterology, The First Affiliated Hospital of Zhejiang Chinese Medical University (Zhejiang Provincial Hospital of Chinese Medicine), Hangzhou, China

Mearin, F., et al., Bowel Disorders. Gastroenterology, 2016.
Canavan, C., J. West, and T. Card, The epidemiology of irritable bowel syndrome. Clin Epidemiol, 2014. 6: p. 71-80.
Li, C.Y. and S.C. Li, Treatment of irritable bowel syndrome in China: a review. World J Gastroenterol, 2015. 21(8): p. 2315-22.
Sun, S., et al., Patients' perspectives on irritable bowel syndrome: a qualitative analysis based on social media in China. Qual Life Res, 2023: p. 1-11.
Buono, J.L., R.T. Carson, and N.M. Flores, Health-related quality of life, work productivity, and indirect costs among patients with irritable bowel syndrome with diarrhea. Health Qual Life Outcomes, 2017. 15(1): p. 35.
Frändemark, Å., et al., Work Productivity and Activity Impairment in Irritable Bowel Syndrome (IBS): A Multifaceted Problem. Am J Gastroenterol, 2018. 113(10): p. 1540-1549.
Ford, A.C., et al., Irritable bowel syndrome. Lancet, 2020. 396(10263): p. 1675-1688.
Vich Vila, A., et al., Gut microbiota composition and functional changes in inflammatory bowel disease and irritable bowel syndrome. Sci Transl Med, 2018. 10(472).
Jeffery, I.B., et al., Differences in Fecal Microbiomes and Metabolomes of People With vs Without Irritable Bowel Syndrome and Bile Acid Malabsorption. Gastroenterology, 2020. 158(4): p. 1016-1028.e8.
Zhou, Y., et al., Bifico relieves irritable bowel syndrome by regulating gut microbiota dysbiosis and inflammatory cytokines. Eur J Nutr, 2023. 62(1): p. 139-155.
Hu, Y., et al., Integrative analysis of the gut microbiome and metabolome in a rat model with stress induced irritable bowel syndrome. Sci Rep, 2021. 11(1): p. 17596.
Pozuelo, M., et al., Reduction of butyrate- and methane-producing microorganisms in patients with Irritable Bowel Syndrome. Sci Rep, 2015. 5: p. 12693.
Pittayanon, R., et al., Gut Microbiota in Patients With Irritable Bowel Syndrome-A Systematic Review. Gastroenterology, 2019. 157(1): p. 97-108.
De Palma, G., et al., Transplantation of fecal microbiota from patients with irritable bowel syndrome alters gut function and behavior in recipient mice. Sci Transl Med, 2017. 9(379).
Xue, Q., et al., Regulation of iNOS on Immune Cells and Its Role in Diseases. Int J Mol Sci, 2018. 19(12).
Xia, N., U. Förstermann, and H. Li, Effects of resveratrol on eNOS in the endothelium and the perivascular adipose tissue. Ann N Y Acad Sci, 2017. 1403(1): p. 132-141.
Förstermann, U. and W.C. Sessa, Nitric oxide synthases: regulation and function. Eur Heart J, 2012. 33(7): p. 829-37, 837a-837d.
Wang, J., et al., An enhanced expression of hypothalamic neuronal nitric oxide synthase in a rat model of simulated transport stress. BMC Vet Res, 2019. 15(1): p. 323.
Jang, D.E., et al., Neuronal Nitric Oxide Synthase Is a Novel Biomarker for the Interstitial Cells of Cajal in Stress-Induced Diarrhea-Dominant Irritable Bowel Syndrome. Dig Dis Sci, 2018. 63(3): p. 619-627.
Han, J.P., et al., Positive Correlation between nNOS and Stress-Activated Bowel Motility Is Confirmed by In Vivo HiBiT System. Cells, 2021. 10(5).
Yazar, A., et al., The urinary 5-hydroxyindole acetic acid and plasma nitric oxide levels in irritable bowel syndrome: a preliminary study. Scott Med J, 2005. 50(1): p. 27-9.
Reinders, C.I., et al., Rectal mucosal nitric oxide in differentiation of inflammatory bowel disease and irritable bowel syndrome. Clin Gastroenterol Hepatol, 2005. 3(8): p. 777-83.
Li, M., et al., Role of dendritic cell-mediated abnormal immune response in visceral hypersensitivity. Int J Clin Exp Med, 2015. 8(8): p. 13243-50.
Al-Chaer, E.D., M. Kawasaki, and P.J. Pasricha, A new model of chronic visceral hypersensitivity in adult rats induced by colon irritation during postnatal development. Gastroenterology, 2000. 119(5): p. 1276-85.
Williams, C.L., et al., Stress-induced changes in intestinal transit in the rat: a model for irritable bowel syndrome. Gastroenterology, 1988. 94(3): p. 611-21.
Halpin, S.J. and A.C. Ford, Prevalence of symptoms meeting criteria for irritable bowel syndrome in inflammatory bowel disease: systematic review and meta-analysis. Am J Gastroenterol, 2012. 107(10): p. 1474-82.
Moloney, R.D., et al., Stress and the Microbiota-Gut-Brain Axis in Visceral Pain: Relevance to Irritable Bowel Syndrome. CNS Neurosci Ther, 2016. 22(2): p. 102-17.
Venkova, K., et al., Exposure of the amygdala to elevated levels of corticosterone alters colonic motility in response to acute psychological stress. Neuropharmacology, 2010. 58(7): p. 1161-7.
Hyland, N.P., E.M. Quigley, and E. Brint, Microbiota-host interactions in irritable bowel syndrome: epithelial barrier, immune regulation and brain-gut interactions. World J Gastroenterol, 2014. 20(27): p. 8859-66.
Vicario, M., et al., Chronic psychosocial stress induces reversible mitochondrial damage and corticotropin-releasing factor receptor type-1 upregulation in the rat intestine and IBS-like gut dysfunction. Psychoneuroendocrinology, 2012. 37(1): p. 65-77.
Piche, T., et al., Impaired intestinal barrier integrity in the colon of patients with irritable bowel syndrome: involvement of soluble mediators. Gut, 2009. 58(2): p. 196-201.
Moloney, R.D., et al., Early-life stress induces visceral hypersensitivity in mice. Neurosci Lett, 2012. 512(2): p. 99-102.
Tramullas, M., T.G. Dinan, and J.F. Cryan, Chronic psychosocial stress induces visceral hyperalgesia in mice. Stress, 2012. 15(3): p. 281-92.
Cryan, J.F. and T.G. Dinan, Mind-altering microorganisms: the impact of the gut microbiota on brain and behaviour. Nat Rev Neurosci, 2012. 13(10): p. 701-12.
Collins, S.M., M. Surette, and P. Bercik, The interplay between the intestinal microbiota and the brain. Nat Rev Microbiol, 2012. 10(11): p. 735-42.
Bailey, M.T. and C.L. Coe, Maternal separation disrupts the integrity of the intestinal microflora in infant rhesus monkeys. Dev Psychobiol, 1999. 35(2): p. 146-55.
Bennet, S.M., L. Ohman, and M. Simren, Gut microbiota as potential orchestrators of irritable bowel syndrome. Gut Liver, 2015. 9(3): p. 318-31.
Theodorou, V., et al., Effect of commensals and probiotics on visceral sensitivity and pain in irritable bowel syndrome. Gut Microbes, 2014. 5(3): p. 430-6.
Zhong, W., et al., Distinct Microbial Populations Exist in the Mucosa-associated Microbiota of Diarrhea Predominant Irritable Bowel Syndrome and Ulcerative Colitis. J Clin Gastroenterol, 2019. 53(9): p. 660-672.
Saur, D., et al., Distinct expression of splice variants of neuronal nitric oxide synthase in the human gastrointestinal tract. Gastroenterology, 2000. 118(5): p. 849-58.
Szabó, C., H. Ischiropoulos, and R. Radi, Peroxynitrite: biochemistry, pathophysiology and development of therapeutics. Nat Rev Drug Discov, 2007. 6(8): p. 662-80.
Byndloss, M.X., et al., Microbiota-activated PPAR-γ signaling inhibits dysbiotic Enterobacteriaceae expansion. Science, 2017. 357(6351): p. 570-575.
Winter, S.E., et al., Host-derived nitrate boosts growth of Escherichia coli in the inflamed gut. Science, 2013. 339(6120): p. 708-11.
Schöneich, C., Methionine oxidation by reactive oxygen species: reaction mechanisms and relevance to Alzheimer's disease. Biochim Biophys Acta, 2005. 1703(2): p. 111-9.
Balagam, B. and D.E. Richardson, The mechanism of carbon dioxide catalysis in the hydrogen peroxide N-oxidation of amines. Inorg Chem, 2008. 47(3): p. 1173-8.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of nNOS inhibition on the Escherichia coli and butyrate-producing bacteria in IBS rats with visceral hypersensitivity

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

2.1. Experimental animals

2.2. Model establishment

2.3. Administration of nNOS inhibition

2.4. Visceral sensitivity measurement

2.5. Sample collection

2.6. Determination of NO and nitrite contents

2.7. Determination of protein and mRNA expression levels of nNOS

2.8. Quantitative detection of gut microbiota

2.9. Determination of butyrate content

2.10. Statistical analysis

3. Results

3.1. nNOS inhibition attenuated visceral hypersensitivity in stress-induced IBS rats

3.2. nNOS inhibiton reduced NO and nitrite contents in IBS rats

3.3. nNOS inhibiton regulated the imbalance between Escherichia coli and butyrate-producing bacteria in IBS rats

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1