Co-infection of porcine astrovirus and other porcine viruses in diarrheic pigs in Haryana, India

doi:10.21203/rs.3.rs-2967858/v1

Download PDF

Research Article

Co-infection of porcine astrovirus and other porcine viruses in diarrheic pigs in Haryana, India

https://doi.org/10.21203/rs.3.rs-2967858/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Sep, 2023

Read the published version in Archives of Virology →

You are reading this latest preprint version

In this study, 306 rectal swabs from diarrheal pigs of various ages (0–3 weeks, 3–6 weeks, and > 6 weeks) were collected from 54 piggery units in different climatic zones in Haryana, India. These samples were tested for the presence of porcine astrovirus (PAstV), porcine circovirus 2 (PCV-2), porcine rotavirus A (PRV-A), and classical swine fever virus (CSFv) by reverse transcription-polymerase chain reaction (RT-PCR). Out of the 306 samples tested, 153 (50%), 108 (35.3%), 32 (10.6%), and 3 (0.9%) were detected positive for PAstV, PCV-2, PRV-A, and CSFv, respectively. Mixed infections were found in 77 samples, whereas 135 had only one virus, and 70 and 7 samples had two and more than 2 viruses, respectively. PAstV was more prevalent (55.31%) in pigs aged 3–6 weeks. PCV-2 was more predominant (36.53%) in pigs aged 0–3 weeks, whereas PRV-A was more common in pigs aged 3–6 weeks (11.3%). CSFv was observed in the age group of 0–3 weeks (1.92%). Phylogenetic analysis revealed the circulation of lineage − 2 and − 4 of PAstV in this region. Thus, it can be concluded that the one or more than one virus is circulating in piggery units in Haryana, India.

Diarrhea in pigs results from a multitude of factors, including viral, bacterial, and parasitic infections. Among the viral causes, porcine astrovirus (PAstV), porcine rotavirus A (PRV-A), porcine circovirus 2 (PCV-2), transmissible gastroenteritis virus (TGEV), and porcine epidemic diarrhea virus (PEDV) are the most common viral pathogens that cause diarrhea in pigs [1, 2, 3]. Diarrhea negatively affects the productivity and profitability in pig industry throughout the world.

Astroviruses have a distinctive five-to-six-pointed star-like morphology (“Astron” means star in Greek) [4]. These viruses have been associated with mild to severe gastroenteritis and are also responsible for extra-intestinal manifestations, such as interstitial nephritis and growth retardation in young chickens, fatal hepatitis in ducks [5], and visceral gout in goslings [6]. Porcine astrovirus (PAstV) belongs to the genus Mammastrovirus and is a non-enveloped, positive-sense, single-stranded RNA virus with 6.4–7.3 kb in size [7]. It is ubiquitously distributed and has five distinct lineages (PAstV 1–5) [8].

Rotaviruses are pervasive etiological agents of diarrhea in piglets and other animal species, including humans. This virus is classified under family Reoviridae and genus Rotavirus. PRV-A, non-enveloped virus, comprises a segmented double-stranded RNA genome. Among the rotaviruses, Group A rotaviruses are frequently detected in pigs aged 1–4 weeks [9]. The fecal-oral route represents the primary mode of rotavirus transmission, and rotavirus-induced diarrhea in pigs and humans is associated with villous atrophy, which leads to malabsorption [10].

Porcine circovirus (PCV) is a small, non-enveloped, icosahedral, single-stranded DNA virus that belongs to the genus Circovirus [11]. PCV-2 has been linked to various disease syndromes in pigs, including post-weaning multisystemic wasting syndrome (PMWS). The clinical presentations of PMWS include dyspnea, debility, lymphadenopathy, icterus, and diarrhea, among others [12].

Co-infection with more than one porcine virus is common. Co-infection of PAstV with other enteric viruses has been reported previously [1, 3, 7, 13, 14]. It is important to undertake surveillance studies to ascertain the circulation of different enteric viruses in animals, and to develop and adopt proper prevention and control measures. Previous reports in India have described co-infection with porcine astrovirus and PRV-A [15]; PCV-2, porcine parvovirus, and CSFv [16]; PCV-2, porcine parvovirus, and African swine fever virus [17]. To date, no studies in India have simultaneously detected the presence of porcine astrovirus, porcine circovirus 2, or porcine rotavirus A in piggery units. To address this knowledge gap, the present study was conducted to investigate the presence of these viruses, as well as the classical swine fever virus, in diarrheic pigs from various piggery units in Haryana, India.

Samples

Haryana, located in northern India, is situated between latitudes 27°39′ to 30°35′ N and longitudes 74 °27′ to 77 °36′ E. The study was conducted between March 2021 and March 2022, in which 306 rectal swab samples were collected from diarrheic pigs originating from 54 piggery units distributed across 19 districts within three zones of Haryana, India (Table 1). Each piggery unit was the source of 1–11 rectal swab samples, which were obtained using sterile swabs in phosphate-buffered saline (PBS) with antibiotic antimycotic solution (100X) (Sigma-Aldrich). The age range of the pigs sampled was: 156 individuals between 0–3 weeks, 141 between 3–6 weeks, and nine older than six weeks. Upon collection, the samples were kept on ice during transportation to the laboratory, where the swabs were disposed, and the fluid was stored at -80°C.

Table 1

Samples collected from different piggery units in Haryana
Zone*	District	Number of piggery units sampled	Number of samples collected
Dry sub-humid zone (15)	Ambala	01	03
Dry sub-humid zone (15)	Yamunanagar	02	12
Semi-arid zone (211)	Kurukshetra	02	17
	Karnal	06	36
	Kaithal	02	07
	Jind	02	18
	Panipat	02	08
	Sonipat	04	27
	Rohtak	04	30
	Jhajjar	04	31
	Gurugram	02	09
	Rewari	04	13
	Mahendargarh	03	06
	Faridabad	02	09
Arid zone (80)	Sirsa	02	07
	Fatehabad	04	10
	Hisar	03	29
	Bhiwani	02	11
	Charkhi dadri	03	23
	Total	54	306
*Figures in parenthesis indicate number of samples collected from the indicated zone

RT-PCR

Total RNA from the samples was extracted using Qiagen Viral RNA kit (Qiagen, Germany) and the extraction was done in accordance with the manufacturer's instructions. Prior to extraction, the rectal swab samples were subjected to centrifugation, and the resulting supernatant was carefully collected in a volume of 140 µl. To this, 560 µl lysis buffer and 5.6 µl of carrier RNA were added, followed by an incubation period of 10 min. Subsequently, 560 µl of ethanol was added, and the mixture was centrifuged again. The resulting mixture was then transferred to a QIamp Mini column, subjected to a series of washes, and eluted with 40 µL of elution buffer. For cDNA synthesis, the Revert Aid first strand cDNA synthesis kit from Thermo Scientific was employed using random hexamers following the manufacturer’s protocol. Amplification of virus-specific genes was achieved using a variety of primer sets, as detailed in Table 2.

Table 2

Primer sets used in the study
Virus	Gene	Primer set	Amplicon size	Reference
PAstV	Polymerase	F 5’CGKTAYGATGGKACKATHCC3’	420 bp	[18]
	Polymerase	R 5’GGYTTKACCCACATNCCRAA3’	420 bp	[18]
	RdRp/Capsid	F 5’ TGACATTTTGTGGATTTACAGTT 3’ R 5’ CACCCAGGGCTGACCA 3’	799 bp	[19]
PRV-A	VP 6	F-5’AAAGATGCTAGGGACAAAATTG 3’	309 bp	[20]
PRV-A	VP 6	R- 5’ CCGCACCTTCGGATATACTG 3’	309 bp	[20]
PCV-2	PCV-2	F- 5’ CGGATATTGTAGTCCTGGTCG 3’	492 bp	[21]
PCV-2	PCV-2	R- 5’ CCGCACCTTCGGATATACTG 3’	492 bp	[21]
CSF	e2	F- 5’AAGTTCTTCCTGTTGTCTAG 3’	1047 bp	This study
CSF	e2	R- 5GCTTGGTTGGTTTAGAGTC 3’	1047 bp	This study
PAstV = Porcine astrovirus; PRV-A = Porcine rotavirus A; PCV-2 = Porcine circovirus; CSF = Classical swine fever virus

For amplification of polymerase gene of PAstV, the reaction mix comprised of 25 µl of Sapphire master mix, 1.6 µl each of forward and reverse primers of the polymerase gene of PAstV, 18.8 µl of nuclease-free water (NFW), and 3 µl of cDNA, with a total volume of 50 µl. The amplification process consisted of an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 51°C for 35 s, extension at 72°C for 45 s, and a final extension step at 72°C for 7 min. PCR products were analyzed by gel electrophoresis, and a specific band of 420 bp was observed in positive cases. The positive control used in this study was obtained from the Department of Veterinary Microbiology of the university.

For amplification of RdRp/Capsid region of PAstV, the reaction mix consisted of 25 µl of Sapphire master mix, 1.4 µl each of the forward and reverse primers of partial RdRp/partial capsid gene of PAstV, 19.8 µl of NFW and 2.4 µl of cDNA for a total volume of 50 µl. The amplification steps consisted of initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 35 s, and extension at 72°C for 1 min, and a final extension step at 72°C for 7 min. The PCR products were subjected to gel electrophoresis, and a specific band of 799 bp was observed in the positive case.

The PCR reaction mixture for amplification of capsid gene of PCV-2 comprised 25 µl of Sapphire master mix, 1.2 µl of each forward and reverse primer targeting the capsid gene of PCV-2, 19.1 µl of NFW, and 3.5 µl of cDNA, resulting in a total volume of 50 µl. PCR amplification for PCV-2 began with an initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 35 s, and extension at 72°C for 1 min, with a final extension step at 72°C for 7 min. The PCR products were subsequently analyzed by gel electrophoresis, where bands of 492 bp were observed in positive samples. As a positive control, a field sample that tested positive for PCV-2 and was verified by sequencing was included in the analysis.

The PCR reaction mixture for amplification of VP 6 gene of porcine rotavirus A was composed of 25 µl of Sapphire master mix, 1 µl each of forward and reverse primers specific for the VP 6 gene of PRV-A, 19.5 µl of NFW, and 3.5 µl of cDNA template, making a total volume of 50 µl. Amplification was carried out using an initial denaturation step at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 30 s. This was followed by a final extension step at 72°C for 7 min. The amplified PCR products were analyzed through gel electrophoresis, and in positive cases, a distinct band of 309 bp was observed.

For amplification of E2 gene of CSFv, the reaction mix consisted of 25 µl of Sapphire master mix, 1 µl each of the forward and reverse primer of E2 gene of CSFv, 19.5 µl of nuclease free water (NFW) and 3.5 µl of cDNA for a total volume of 50 µl. Amplification steps were: initial denaturation at 95℃ for 5 min, followed by 35 cycles of denaturation at 95℃ for 45 s, annealing at 55 ℃ for 1 min, and extension at 72℃ for 1 min 30 s, and a step of final extension at 72℃ for 7 min. The PCR products were gel electrophoresed and band of 1047 bp was observed in positive case. A lapinized classical swine fever virus vaccine was used as positive control.

Sequencing

The PCR products from the virus-positive samples were subjected to Sanger sequencing (AgriGenome Pvt. Ltd., India). Raw sequence data with both the forward and reverse primers were analyzed, and manual trimming of low-quality score sequences was performed simultaneously. Virus identity was confirmed by aligning nucleotide sequences and conducting BLAST analysis. Nucleotide sequences were deposited in the NCBI for Biotechnology Information GenBank database. Previously published nucleotide sequences of respective viruses from different countries were retrieved from NCBI GenBank database (Tables S1-S4), and Clustal W (pairwise and multiple alignment) in MEGA 7.0.26 software was used for alignment. A phylogenetic tree was constructed using the neighbor-joining method with 1000 bootstrap value.

Occurrence of tested viruses

Porcine astrovirus was detected in 153 samples (50.0%), while PCV-2 was detected in 108 samples (35.2%) by RT-PCR. PRV-A was found positive in 32 samples (10.6%), while CSFv was detected in only three samples (0.9%). Among the 306 samples tested, 94 (30.71%) did not show the presence of any of the viruses tested by RT-PCR.

Out of the 306 diarrheic samples examined, only one virus was found in 135 samples. Two viruses were detected in 70 samples, while only seven samples were found to be positive for more than two viruses (Table 3). PAstV alone was detected in 81 samples, while PCV-2 alone was detected in 47 samples. PRV-A alone and CSFv alone were detected in 6 and 1 sample, respectively. PAstV was found to be coexisting with PCV-2, PRV-A, or CSFv in 50, 14, and 1 sample, respectively (Table 3). The combination of PCV-2 and PRV-A was observed in five samples. Furthermore, the combination of PAstV, PCV-2, and PRV-A was detected in six samples, whereas the combination of PAstV, CSFv, and PRV-A was detected in only one sample (Table 3).

Table 3

Detection of pathogens alone or in combination
Infection	No. (%) of samples positive for the indicated viruses
No tested virus detected	94 (30.7%)
PAstV alone	81 (26.0%)
PCV-2 alone	47 (15.3%)
PRV-A alone	06 (1.9%)
CSFv alone	01 (0.3%)
PAstV + PCV-2	50 (16.3%)
PAstV + PRV-A	14 (4.5%)
PCV-2 + PRV-A	05 (1.6%)
PAstV + CSFv	01 (0.3%)
PAstV + PCV-2 + PRV-A	06 (1.9%)
PAstV + CSFv + PRV-A	01 (0.3%)
PAstV = Porcine astrovirus; PRV-A = Porcine rotavirus A; PCV-2 = Porcine circovirus; CSF = Classical swine fever virus

Age-wise distribution of the tested viruses

The prevalence of porcine astrovirus was highest among pigs aged 3–6 weeks, with a detection rate of 55.3%, followed by 46.8% in piglets aged 0–3 weeks (Table 4). The positivity rate for PCV-2 was comparable between pigs aged 0–3 weeks and 3–6 weeks, at 36.5% and 36.2%, respectively. No samples from pigs older than six weeks were found to be positive for PCV-2. The positivity of PRV-A was found to be consistent across all three age groups. CSFv was detected in only three samples, all of which belonged to the 0–3 weeks age group (Table 4). The presence of multiple viruses, specifically two or more, was identified in pigs aged 0–3 weeks and 3–6 weeks.

Table 4

Occurrence of tested viruses in different age groups of pigs
Age group	No. of samples tested	No. (%) of samples positive for indicated virus				No. (%) of samples positive for two or more viruses	No. (%) of samples negative for all viruses
Age group	No. of samples tested	PAstV	PCV-2	PRV-A	CSFv	No. (%) of samples positive for two or more viruses	No. (%) of samples negative for all viruses
0–3 week	156	73 (46.8%)	57 (36.5%)	15 (9.6%)	03 (1.9%)	36 (23.1%)	48 (30.8%)
3–6 week	141	78 (55.3%)	51 (36.2%)	16 (11.3%)	-	41 (29.1%)	40 (28.4%)
> 6 week	09	02 (22.2%)	-	01 (11.1%)	-	-	06 (66.7%)
Total	306	153 (50.0%)	108 (35.3%)	32 (10.6%)	3 (0.9%)	77 (25.2%)	94 (30.7%)
PAstV = Porcine astrovirus; PRV-A = Porcine rotavirus A; PCV-2 = Porcine circovirus; CSF = Classical swine fever virus

Spatial distribution

The samples were obtained from three distinct climatic zones: dry sub-humid, semi-arid, and arid zones. The detection rate of PAstV was the highest in the semi-arid (50.7%) and arid (50%) zones, with a slightly lower rate in the dry sub-humid zone (40%; Table 5). Conversely, PCV-2 was more frequently detected in the dry sub-humid zone (80%), followed by the arid and semi-arid zones. The prevalence of PRV-A was higher in the arid zone (17.5%) than in the dry sub-humid and semi-arid zones. The detection of two or more viruses was most frequent in the dry sub-humid zone (40%), followed by the arid and semi-arid zones with rates of 27.5% and 23.22%, respectively (Table 5).

Table 5

Occurrence of tested viruses in different zones in Haryana
Zone	Number of pigs sampled	No. (%) of samples positive for indicated virus				No. (%) of samples positive for two or more viruses	No. (%) of samples negative for all viruses
Zone	Number of pigs sampled	PAstV	PCV-2	PRV-A	CSFv	No. (%) of samples positive for two or more viruses	No. (%) of samples negative for all viruses
Dry sub- humid	15	06 (40%)	12 (80%)	1 (6.6%)	-	06 (40.00%)	02 (13.3%)
Semi-arid	211	107 (50.7%)	65 (30.8%)	17 (8.1%)	02 (0.9%)	49 (23.2%)	73 (34.6%)
Arid	80	40 (50%)	31 (38.7%)	14 (17.5%)	01 (1.2%)	22 (27.5%)	19 (23.8%)
Total	306	153 (50%)	108 (35.3%)	32 (10.5%)	3 (0.9%)	77 (25.2%)	94 (30.7%)
PAstV = Porcine astrovirus; PRV-A = Porcine rotavirus A; PCV-2 = Porcine circovirus; CSF = Classical swine fever virus

Occurrence of tested viruses based on piggery unit

Rectal swab samples were collected from 54 distinct piggery units, of which three units showed no evidence of the targeted viruses by RT-PCR. The results indicated that 12 units were positive only for PAstV, whereas five units were positive only for PCV-2. No piggery unit was detected positive for PRV-A or CSFv alone. The combination of PAstV and PRV-A was observed in only two units. Additionally, in 18 piggery units, the samples tested positive for either PAstV or PCV-2 or a combination of both (Table 6 and Fig. 1). Notably, 12 piggery units were found to have all three targeted viruses (PAstV, PCV-2, and PRV-A).

Table 6

Number of piggery units showing the presence of tested virus(es)
Infection	No. (%) of piggery units positive for indicated virus(es)
No tested virus detected	03 (5.6%)
PAstV alone	12 (22.2%)
PCV-2 alone	05 (9.3%)
PAstV + PRV-A	02 (3.7%)
PAstV + PCV-2 + PRV-A	12 (22.2%)
*PAstV/ PCV-2 / PAstV + PCV-2	18 (33.3%)
*PAstV/ CSFv/ PAstV + CSFv	01 (1.9%)
**PAstV/ PCV-2/ PRV-A/ CSFv	01 (1.9%)
PAstV = Porcine astrovirus; PRV-A = Porcine rotavirus A; PCV-2 = Porcine circovirus; CSF = Classical swine fever virus
*Indicates that samples from a piggery unit were positive either for one virus or a combination of two viruses.
**Indicates that samples from a piggery unit were positive for all four tested viruses individually

Sequencing and phylogenetic analysis

The nucleotide sequences of partial polymerase and partial capsid were obtained. The details of the nucleotide sequences submitted to the NCBI database and their accession numbers are mentioned in Table 7. The phylogenetic analysis using capsid nucleotide sequences of PAstV was performed, with other representative strains from NCBI database. Based on capsid gene phylogeny, two major clades were formed (Fig. 2). Majority of the sequences of this study clustered in one clade along with previously published sequences of PAstV-4 used for comparison. Only one PAstV strain (OP381852) of this study clustered with previously published sequences of PAstV-2; these sequences were in a separate cluster from PAstV-4. The nucleotide sequences of both PAstV-2 and PAstV-4 detected in this study shared 50% nucleotide identity with each other. PAstV-4 strains of this study showed 63 to 96.7% nucleotide identity among themselves while PAstV-4 strains from our study showed 64 to 96.7% nucleotide identity with strains from other countries. PAstV-2 strain of this study showed 64 to 82% nucleotide identity with previously published PAstV-2 strains from India. PAstV strains from this study were clustered together with PAstV-4 reference strain (KX060809) from China. The PAstV-4 strains of this study (OP381829, OP3818230, OP381857, OP381859, OP381835, OP381836, OP381823, OP381831, OP381844, OP381846 and OP381824) shared a conserved region from position 1 to 317 with minor changes. The remaining length of the amplified sequence (from 318 to 533) showed variability. The other PAstV strains of this study showed variability through the length of the amplified region of capsid gene within the same lineage.

Table 7

Accession number of detected viruses
Virus	Accession number
PAstV	OP381823, OP381824, OP381826, OP381828- OP381830, OP381832, OP381834-OP381850, OP381852- OP381855, OP381857-OP381862
PCV-2	OP441380
PRV-A	OP573222-OP573224
CSFv	OP407829

Three PRV-A positive samples were sequenced. Two major clades were formed. The PRV-A strains of this study were in the same clade as the previously published sequences from Uttar Pradesh (India), Mozambique and Thailand (Fig. 3).

While subjecting PCV-2 sequences for phylogenetic analysis, two major clades were detected. The sequence of this study showed similarity with sequences obtained from India, Spain and China. The other clade was further subdivided in two different sub-clades. The sequences from Korea and Japan were in the same sub-clade and the other sub-clade had sequences from Japan, USA, Korea, China, and India (Fig. 4).

One positive sample of CSFv was sequenced and used for phylogenetic analysis. Two major clades were formed and the CSFv strain of this study (OP407829) showed similarity with sequences from Korea and Uttar Pradesh and Haryana states of India. Another clade had sequences from other states of Haryana as well as other countries including Germany, Spain, Korea, China, Vietnam, and Mongolia (Fig. 5).

The objective of the current investigation was to detect and characterize enteric viruses in diarrheic pigs. In this study, a total of 306 rectal swabs were collected and subjected to RT-PCR to test for the presence of four viruses. Our findings corroborate those of previous studies that have reported the detection of enteric viruses in diarrheic pigs [1, 3, 7, 13, 14, 15, 16, 22].

Porcine astrovirus in this study was detected in 55.3% of samples, with more positivity in pigs of 3–6 weeks of age and in semi-arid zones. Kour [23] and Xiao [24] also reported a higher occurrence of PAstV in pigs aged < 6 weeks. Piglets are more susceptible because they do not have a well-developed immune system and are at high risk of contracting the disease [25]. Phylogenetic analysis based on the partial capsid gene confirmed the circulation of PAstV-2 and − 4 in this state. The majority of PAstV strains in our study belonged to lineage 4, with the exception of one that belonged to lineage 2. These findings are in agreement with those of Kattoor [15], who also reported the circulation of PAstV − 2 and − 4 lineages, with lineage 4 being predominant. Likewise, Lee [26] in South Korea and Kumthip [27] in Thailand documented higher frequency of PAstV-4 than PAstV-2. However, predominance of lineage 2 has been reported in China [7, 28, 29]. The presence of lineages 5, 4 and 1 has also been reported in China [30, 31, 32].

In this study, PCV-2 was detected in 35.2% of samples, with occurrence in pigs of 0–6 weeks of age and in the dry sub-humid zone. This virus was not detected in pigs of more than 6 weeks of age. Afolabi [33] and Shi [14] reported prevalence rates of 15.93% and 14.45% in swine herds, respectively. Though four types of porcine circovirus (PCV-1, -2 -3 and − 4) have been reported, we used primers specific for PCV-2. The circulation of other porcine circoviruses cannot be ruled out. Of these four types, porcine circovirus 2 has been reported to be the primary cause of many syndromes known as porcine circovirus-associated disease (PCVAD) [34]. The PCVAD is an emerging disease and its incidence has increased dramatically in recent years in many of the swine producing countries.

We observed an 11.3% occurrence of PRV-A with more detection in pigs aged 3–6-weeks of age. Marthaler [35] reported a high prevalence of 62% porcine rotavirus A in the age group of 3–8 weeks of age. Porcine rotavirus is the leading cause of diarrhea in piglets and can cause heavy economic losses. In addition, classical swine fever virus (CSFv) was identified in the studied piggery units. This enveloped virus with a single-stranded positive-sense RNA belongs to the genus Pestivirus and is highly contagious, leading to economic losses in various parts of the world [36]. Classical swine fever is a notifiable disease by the World Organisation of Animal Health (OIE), posing a considerable threat to the swine industry due to its ability to cause high mortality in pigs of all ages, as well as immune suppression, reduced growth, and reproductive losses. The identification of the virus in the three units in this study is of paramount significance, underscoring the importance of prompt detection and control measures to prevent the spread of the disease [37].

In the current study, 94 samples (30.71%) tested negative for all the targeted viruses. It is important to note that the possibility of other enteric viruses being present in these samples cannot be completely ruled out. Indeed, other studies have reported the detection of additional enteric viruses such as PEDV and porcine kobuvirus (PKoV) in diarrheic pig [3, 7, 16, 17, 24]. Therefore, further investigation is necessary to identify other potential viral agents that may be associated with diarrhea in pigs in this region.

The present study revealed the detection of multiple viruses in a combination of two or three viruses. Notably, 17 out of all piggery units, tested positive for one virus and 34 piggery units tested positive for one virus alone or combination of two or more viruses. The detection of multiple viruses in piggery units is supported by Valko [2] who also detected co-infection of various enteric viruses including porcine astrovirus, porcine circovirus 2 and porcine rotavirus A in piggery units in Hungary. Shi [14] tested 753 stool samples for 11 viral pathogens in China and reported the presence of viruses alone or in combination. However, the impact of these combinations of viruses on pig performance is not fully understood. The presence of multiple viruses in a piggery unit may exacerbate disease severity and duration through additive or synergistic effects, leading to decreased feed conversion efficiency, malabsorption, and poor growth in piglets. Ultimately, this may result in a lower body weight at the marketing age and significant economic losses for farmers. Further research is needed to better understand the interactions among these viruses and their potential negative effects on pig health and productivity. Kennedy [38] induced lesions of post-weaning multisystemic wasting syndrome (PMWS) in pigs by inoculating them with PCV-2 alone. The authors reported that concurrent experimental infection with porcine parvovirus increased the severity of lesions.

The detection of the tested viruses, either alone or in combination, in most of the piggery units in Haryana is a significant finding. This observation highlights the potential impact of these viruses on pig health and production, particularly when they co-circulate. In Haryana, where biosecurity measures in piggery units are not stringent, the possibility of fecal-oral transmission of these viruses cannot be ruled out. This is particularly concerning for young piglets who are more susceptible to infection and may continue to suffer from the disease if infected at a young age. It is important to conduct further studies to determine the duration for which these viruses persist in piggery units, which will help in understanding the transmission dynamics and epidemiology of these viruses. Overall, this study underscores the importance of implementing strict biosecurity measures in piggery units to prevent and control the spread of these viruses, which has a significant impact on pig health and production.

The aim of this study was the detection and characterization of diarrheal porcine enteric viruses. This study found the presence of four viruses in rectal swabs of the pigs: porcine astrovirus (PAstV), porcine circovirus-2 (PCV-2), porcine rotavirus A (PRV-A) and classical swine fever virus (CSFv). This study also found that multiple viruses were detected in combinations of two or three viruses. The detection of multiple viruses in a piggery may affect viral virulence and contribute to the development of diarrhea in affected animals.

Author contributions

The whole study was designed and conceptualized by NJ, RG, PK and Parveen Kumar. The sample collection was done by Vaishali, MK and Vivek. The protocols were standardized by Vaishali, NB, PK and Parveen Kumar. The phylogenetic analysis was performed by Vaishali, RG, MK, PK and NJ. The first draft of the manuscript was written by Vaishali and NJ. All the authors reviewed and edited the final version of the manuscript and approved it.

Ethics approval

The study was approved by the Institutional Animal Ethics Committee (IAEC) vide Proceedings no. VCC/IAEC630-51 dated 25 March, 2021 of Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana, India. All methods were performed in accordance with the relevant guidelines and regulations of IAEC.

Acknowledgments

The authors express their gratitude to the field veterinary officers of Department of Animal Husbandry and Dairying, Government of Haryana, India for their help in sample collection.

Conflict of interest

The authors declare that they have no conflict of interest.

Zhou W, Ullman K, Chowdry V, Reining M, Benyeda Z, Baule C, Juremalm M, Wallgren P, Schwarz L, Zhou E, Pina Pedrero S, Hennig-Pauka I, Segales J, Liu L (2016) Molecular investigations on the prevalence and viral load of enteric viruses in pigs from five European countries. Vet Microbiol 182:75-81. https://doi.org/10.1016/j.vetmic.2015.10.019
Valko A, Marosi A, Cságola A, Farkas R, Ronai Z, Dan A (2019) Frequency of diarrhoea-associated viruses in swine of various ages in Hungary. Acta Vet Hung 67(1):140-150. https://doi.org/10.1556/004.2019.016
Werid GM, Ibrahim YM, Chen H, Fu L, Wang Y (2022) Molecular detection and genetic characterization of potential zoonotic swine enteric viruses in Northern China. Pathogens 11(4):417
Madeley CR, Cosgrove BP (1975) 28 nm particles in faeces in infantile gastroenteritis. Lancet 6:451–452. https://doi.org/10.1016/S0140-6736(75)90858-2
Chen L, Xu Q, Zhang R, Li J, Xie Z, Wang Y, Zhu Y, Jiang S (2012) Complete genome sequence of a duck astrovirus discovered in eastern China. J Virol 86(24):13833-13834. https://doi.org/10.1128/JVI.02637-12
Zhang Q, Cao Y, Wang J, Fu G, Sun M, Zhang L, Meng LI, Cui G, Huang YU, Hu X, Su J (2018) Isolation and characterization of an astrovirus causing fatal visceral gout in domestic goslings. Emerg Microbes Infect 7(1):1-11. https://doi.org/10.1038/s41426-018-0074-5
Su M, Qi S, Yang D, Guo D, Yin B, Sun D (2020) Coinfection and genetic characterization of porcine astrovirus in diarrheic piglets in China from 2015 to 2018. Front Vet Sci 7:462. https://doi.org/10.3389/fvets.2020.00462
Boros A, Albert M, Pankovics P, Biro H, Pesavento PA, Phan TG, Delwart E, Reuter G (2017) Outbreaks of neuroinvasive astrovirus associated with encephalomyelitis, weakness, and paralysis among weaned pigs, Hungary. Emerg Infect Dis 23(12):1982. doi: 10.3201/eid2312.170804
Bohl EH (1979) Rotaviral diarrhea in pigs: brief review. J Am Vet Med Assoc 174(6):613-615.
Kapikian AZ (2001) A rotavirus vaccine for prevention of severe diarrhoea of infants and young children: development, utilization and withdrawal. In: Novartis Foundation Symposium, Chichester; New York; John Wiley, pp 153-179. https://doi.org/10.1002/0470846534.ch10
Allan GM, McNeilly F, Ellis J, Krakowka S, Meehan B, McNair I, Walker I, Kennedy S (2000) Experimental infection of colostrum deprived piglets with porcine circovirus 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) potentiates PCV2 replication. Arch Virol 145:2421-2429. https://doi.org/10.1007/s007050070031
Sairam R, Krishna BD, Krithiga K, Sajitha IS, Priya PM, Ravishankar C, Abraham MJ (2019) Molecular and pathological studies of post-weaning multi-systemic wasting syndrome among piglets in Kerala, India. Explor Anim Med Res 9(2):137-144.
Zhang Q, Hu R, Tang X, Wu C, He Q, Zhao Z, Chen H, Wu B (2013) Occurrence and investigation of enteric viral infections in pigs with diarrhea in China. Arch Virol 158:1631-1636. https://doi.org/10.1007/s00705-013-1659-x
Shi Y, Li B, Tao J, Cheng J, Liu H (2021) The complex co-infections of multiple porcine diarrhea viruses in local area based on the luminex xTAG multiplex detection method. Front Vet Sci 8:602866. https://doi.org/10.3389/fvets.2021.602866
Kattoor JJ, Malik YS, Saurabh S, Sircar S, Vinodhkumar OR, Bora DP, Dhama K, Ghosh S, Banyai K, Nadia T, Abdel-Moneim AS, Vlasova AN, Kobayashi N, Singh RK (2019) First report and genetic characterization of porcine astroviruses of lineage 4 and 2 in diarrheic pigs in India. Transbound Emerg Dis 66(1):47-53. https://doi.org/10.1111/tbed.13058
Rajkhowa S, Choudhury M, Pegu SR, Sarma DK, Gupta VK (2022) Development of a novel one‐step triplex PCR assay for the simultaneous detection of porcine circovirus type 2, porcine parvovirus and classical swine fever virus in a single tube. Letters Appl Microbiol 75(2):338-344. https://doi.org/10.1111/lam.13732
Pegu SR, Deb R, Das PJ, Sengar GS, Yadav AK, Rajkhowa S, Paul S, Gupta VK (2022) Development of multiplex PCR assay for simultaneous detection of African swine fever, porcine circo and porcine parvo viral infection from clinical samples. Anim Biotechnol 1-8. https://doi.org/10.1080/10495398.2022.2053698
Chu DKW, Poon LLM, Guan Y, Peiris JSM (2008) Novel astroviruses in insectivorous bats. J Virol 82(18):9107-9114. https://doi.org/10.1128/JVI.00857-08
Reuter G, Pankovics P, Boros A (2011) Identification of a novel astrovirus in a domestic pig in Hungary. Arch Virol 156(1):125-128. https://doi.org/10.1007/s00705-010-0827-5
Song DS, Kang BK, Oh JS, Ha GW, Yang JS, Moon HJ, Jang YS, Park BK (2006) Multiplex reverse transcription-PCR for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group A rotavirus. J Vet Diagn Invest 18(3):278-281. doi: 10.1177/104063870601800309.
Anoopraj R, John JK, Sethi M, Somvanshi R, Saikumar G (2014) Isolation and identification of porcine circovirus 2 from cases of respiratory disease and postweaning multisystemic wasting syndrome in pigs. Adv Anim Vet Sci 2:365-368. http://dx.doi.org/10.14737/journal.aavs/2014/2.6.365.368
Mor SK, Chander Y, Marthaler D, Patnayak DP, Goyal SM (2012) Detection and molecular characterization of porcine astrovirus strains associated with swine diarrhea. J Vet Diagn Invest 24(6):1064-1067. DOI: 10.1177/1040638712458781
Kour R, Kumar P, Jindal N, Minhas SK, Kumar R, Gupta AK, Malik A (2021) Molecular detection and characterization reveals circulation of multiple genotypes of porcine astrovirus in Haryana, India. Arch Virol 166:2847–2852. https://doi.org/10.1007/s00705-021-05195-8
Xiao CT, Giménez-Lirola LG, Gerber PF, Jiang YH, Halbur PG, Opriessnig T (2013) Identification and characterization of novel porcine astroviruses (PAstVs) with high prevalence and frequent co-infection of individual pigs with multiple PAstV types. J Gen Virol 94:570–582. https://doi.org/10.1099/vir.0.048744-0
Campbell JM, Crenshaw JD, Polo J (2013) The biological stress of early weaned piglets. J Anim Sci Biotech 4(1):19. https://doi.org/10.1186/2049-1891-4-19
Lee MH, Jeoung HY, Park HR, Lim JA, Song JY, An DJ (2013) Phylogenetic analysis of porcine astrovirus in domestic pigs and wild boars in South Korea. Virus Genes 46:175-181. https://doi.org/10.1007/s11262-012-0816-8
Kumthip K, Khamrin P, Saikruang W, Kongkaew A, Vachirachewin R, Ushijima H, Maneekarn N (2018) Detection and genetic characterization of porcine astroviruses in piglets with and without diarrhea in Thailand. Arch Virol 163:1823-1829. https://doi.org/10.1007/s00705-018-3806-x
Lan D, Ji W, Shan T, Cui L, Yang Z, Yuan C, Hua X (2011) Molecular characterization of a porcine astrovirus strain in China. Arch Virol 156:1869-1875. https://doi.org/10.1007/s00705-011-1050-8
Cai Y, Yin W, Zhou Y, Li B, Ai L, Pan M, Guo W (2016) Molecular detection of porcine astrovirus in Sichuan province, China. Virol J 13:1-5. https://doi.org/10.1186/s12985-015-0462-6
Xiao CT, Luo Z, Lv SL, Opriessnig T, Li RC, Yu XL (2017) Identification and characterization of multiple porcine astrovirus genotypes in Hunan province, China. Arch Virol 162:943-952. https://doi.org/10.1007/s00705-016-3185-0
Zhao C, Chen C, Li Y, Dong S, Tan K, Tian Y, Zhang L, Huang J, Zhang L (2019) Genomic characterization of a novel recombinant porcine astrovirus isolated in northeastern China. Arch Virol 164: 1469-1473. https://doi.org/10.1007/s00705-019-04162-8
Shan T, Wang C, Tong W, Zheng H, Hua X, Yang S, Guo Y, Zhang W, Tong G (2012) Complete genome of a novel porcine astrovirus. J Virol 86(24):13820-13821. https://doi.org/10.1128/JVI.02598-12
Afolabi KO, Iweriebor BC, Obi LC, Okoh AI (2017) Molecular detection of porcine circovirus type 2 in swine herds of Eastern Cape Province South Africa. BMC Microbiol 17:1-10. https://doi.org/10.1186/s12866-017-1121-4
Gillespie J, Opriessnig T, Meng XJ, Pelzer K, Buechner‐Maxwell V (2009) Porcine circovirus type 2 and porcine circovirus‐associated disease. J Vet Intern Med 23(6):1151-1163. https://doi.org/10.1111/j.1939-1676.2009.0389.x
Marthaler D, Homwong N, Rossow K, Culhane M, Goyal S, Collins J, Matthijnssens J, Ciarlet M (2014) Rapid detection and high occurrence of porcine rotavirus A, B, and C by RT-qPCR in diagnostic samples. J Virol Methods 209:30-34. doi: 10.1016/j.jviromet.2014.08.018
Ganges L, Crooke HR, Bohórquez JA, Postel A, Sakoda Y, Becher P, Ruggli N (2020) Classical swine fever virus: The past, present and future. Virus Res 289:198151. https://doi.org/10.1016/j.virusres.2020.198151
Singh VK, Rajak KK, Kumar A, Yadav SK (2018) Classical swine fever in India: Current status and future perspective. Trop Anim Hlth Prod 50:1181-1191. https://doi.org/10.1007/s11250-018-1608-5
Kennedy S, Moffett D, McNeilly F, Meehan B, Ellis J, Krakowka S, Allan GM (2000) Reproduction of lesions of postweaning multisystemic wasting syndrome by infection of conventional pigs with porcine circovirus type 2 alone or in combination with porcine parvovirus. J Comp Pathol 122(1):9-24. https://doi.org/10.1053/jcpa.1999.0337

22052023VaishaliSupplementarydata.docx

Download PDF

Journal Publication

published 07 Sep, 2023

Read the published version in Archives of Virology →

Editorial decision: Major Revision
06 Jun, 2023
Reviewers agreed at journal
28 May, 2023
Reviewers invited by journal
28 May, 2023
Editor assigned by journal
24 May, 2023
First submitted to journal
22 May, 2023

You are reading this latest preprint version

Co-infection of porcine astrovirus and other porcine viruses in diarrheic pigs in Haryana, India

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Samples

RT-PCR

Sequencing

Results

Occurrence of tested viruses

Age-wise distribution of the tested viruses

Spatial distribution

Occurrence of tested viruses based on piggery unit

Sequencing and phylogenetic analysis

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1