Systematic identification of long noncoding RNAs during three key organogenesis stages in zebrafish

doi:10.21203/rs.3.rs-2980557/v1

Download PDF

Research Article

Systematic identification of long noncoding RNAs during three key organogenesis stages in zebrafish

https://doi.org/10.21203/rs.3.rs-2980557/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Thousands of lncRNAs have been found in zebrafish embryogenesis and adult tissues, but their identification and organogenesis-related function have not elucidated.

Results

In this study, high-throughput sequencing was performed at three different organogenesis stages of zebrafish embryos, which were important for zebrafish muscle development. The three stages were 10 hpf (hours post fertilization) (T1), 24 hpf (T2) and 36 hpf (T3). LncRNA gas5 associated with muscle development was screened out as the next research target by high-throughput sequencing and qPCR validation. The spatiotemporal expression of lncRNA gas5 in zebrafish embryonic muscle development was studied by qPCR and in situ hybridization, and functional analysis was conducted using CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/Cas9, CRISPR/Cas9). The results were as follows: 1) A total of 1486 differentially expressed lncRNAs were identified between 24 hpf (T2) and 10 hpf (T1), among which 843 lncRNAs were upregulated and 643 were downregulated. Compared with 36 hpf (T3) and 24 hpf (T2), a total of 844 differentially expressed lncRNAs were screened, among which 482 lncRNAs were upregulated and 362 lncRNAs were downregulated. Compared with 36 hpf (T3) and 10 hpf (T1), a total of 2137 differentially expressed lncRNAs were screened, among which 1148 lncRNAs were upregulated and 989 lncRNAs were downregulated, including lncRNA gas5, which was selected as the target gene. 2) The result of spatiotemporal expression analysis showed that lncRNA gas5 was expressed in almost all detected embryos of different developmental stages (0, 2, 6, 10, 16, 24, 36, 48, 72, 96 hpf) and detected tissues of adult zebra fish. 3) After lncRNA gas5 knockout using CRISPR/Cas9 technology, the expression levels of detected genes related to muscle development and adjacent to lncRNA gas5 were affected in the knockout group compared with the control group, suggesting that lncRNA gas5 may play a role in embryonic muscle development in zebrafish.

Conclusion

The result of this study provide an experimental basis for further study on the role of lncRNA gas5 in zebrafish embryonic muscle development.

With the increasing development of high-throughput sequencing technology, lncRNAs were largely discovered in the transcriptomes of humans and several model organisms, including zebrafish. Recently, Pauli et al identified 1133 long noncoding RNAs expressed during zebrafish embryogenesis [1]. Another study identified 77 tissue-specific expressed lncRNAs across five investigated adult tissues [2]. In addition, 813 cardiac lincRNA transcripts were identified by performing genome-wide RNA sequencing of zebrafish embryonic hearts, adult hearts and adult muscle [3]. These studies all suggested that lncRNAs play a certain role in embryonic development and tissue formation. The present study focused on the expression profile of three key organogenesis stages (10, 24, 36 hpf). The hundreds of differentially expressed lncRNAs were screened out across three key stages, and lncRNA gas5 was selected as the next research target.

LncRNA gas5 has direct homologs in humans and mice. LncRNA growth arrest -specific transcription 5 (gas5) was first isolated and identified by Schneider et al in 1988 from mouse embryonic fibroblast lines of growth inhibition NIH3T3[4]. According to the literature reports, lncRNA molecules play an important regulatory role in muscle development and muscle-related diseases [5, 6]. LncRNA gas5 is a key regulatory transcript of mammalian muscle growth and cell apoptosis. Studies have found that lncRNA gas5 regulates the expression of PTEN by acting on miR-21, thus controlling the proliferation of myocardial fibroblasts and myocardial fibrosis [7]. Several studies have found that lncRNA gas5 expression is downregulated in some cancer tissues compared to adjacent normal tissue [8–12]. In this study, lncRNA gas5 was screened by high-throughput sequencing, and its expression and function during the muscle development of zebrafish embryos were studied by qPCR, in situ hybridization, CRISPR/Cas9 and other experimental techniques. This study aims to explore the role of lncRNA gas5 in the early embryonic muscle development of zebrafish, and provide experimental basis for further research on its molecular mechanism.

RNA sequencing and transcriptome reassembly

In this study, the transcriptome expression profiles at three key organogenesis stages of zebrafish were investigated using the Illumina high-throughput sequencing platform. The original sequencing data contained joint sequences, low-quality read segments, and sequences with a high N rate, which had a great impact on the subsequent analysis. To ensure the accuracy of the subsequent analysis, the original sequencing data were filtered first. The specific quality control contents are as follows: remove the joint sequence in reads and filter out reads shorter than 15 bp. Low-quality reads were filtered and discarded when the proportion of bases below Q20 was greater than 0.08. The reads that read N with more than 5 bases were filtered and discarded (Fig. 1).

Identification of differentially expressed genes and lncRNAs at three organogenesis stages

Differentially expressed genes (DEGs) and lncRNAs were screened out, and the absolute value of |logFC| >1 and p value < 0.05 were taken as the criteria (Supplementary 1–3). The results showed that a total of 1486 differentially expressed lncRNAs and 5569 DEGs were screened out compared with 24 hpf (T2) and 10 hpf (T1), among which 843 lncRNAs and 4051 DEGs were upregulated and 643 lncRNAs and 1518 DEGs were downregulated (Fig. 2, 3). Compared with 36 hpf (T3) and 24 hpf (T2), a total of 844 differentially expressed lncRNAs and 2827 DEGs were screened, among which 482 lncRNAs and 2003 DEGs were upregulated and 362 lncRNAs and 824 DEGs were downregulated (Fig. 2, 3). Compared with 36 hpf (T3) and 10 hpf (T1), a total of 2137 differentially expressed lncRNAs and 8028 DEGs were screened, among which 1148 lncRNAs and 5180 DEGs were upregulated and 989 lncRNAs and 2848 DEGs were downregulated (Fig. 2, 3).

GO term and KEGG pathway enrichment analysis of DEGs

To identify the function of DEGs, the DEGs were subjected to GO term and KEGG pathway enrichment analysis. GO term analysis showed that the biological functions of DEGs were mainly concentrated in tissue development, single organism development, embryo development, muscle structure development, etc. (Fig. 4, Supplementary table 4–9).

KEGG pathway enrichment analysis showed that DEGs were mainly involved in the Wnt signaling pathway, metabolic pathway, myocardial contraction, MAPK signaling pathway, tight junction, etc. (Fig. 5, Supplementary table 10–15).

qPCR validation

To validate the reliability of sequencing data, the expression profiles of 11 differentially expressed lncRNAs and 8 DEGs were detected using qPCR. The qPCR results showed that the expression trends of DEGs and lncRNAs at three different stages were consistent with the RNA sequencing data, indicating that the sequencing data were very reliable and could be used for subsequent studies (Fig. 6, 7). After comprehensive consideration from many aspects, the lncRNA gas5 was selected as the next research focus.

Bioinformatics analysis of LncRNA gas5

Through online Ensembl database (http://asia.ensembl.org/index.htmL), NCBI (https://www.ncbi.nlm.nih.gov/) and CPAT (http://lilab.research.bcm.edu/cpat/), bioinformatics analysis of lncRNA gas5 found that lncRNA gas5 was located on chromosome 8 of zebrafish with 14 exons and the transcript length was 799 bp, belonging to the long intergenic noncoding RNA (Supplementary figure). Analysis results of CPAT, an online coding capability software, showed that lncRNA gas5 did not have the ability to encode proteins (Fig. S1).

The spatiotemporal expression pattern of lncRNA gas5 at three key organogenesis stages of zebrafish embryos

The temporal and spatial expression of lncRNA gas5 was detected by qPCR and whole embryo in situ hybridization at three key organogenesis stages in zebrafish. qPCR results showed that lncRNA gas5 was universally expressed at three key organogenesis stages of zebrafish embryos (0, 2, 6, 10, 16, 24, 36, 48, 72, 96 hpf), and the expression level was relatively high between 6 and 36 hpf (Fig. 8j). In situ hybridization results showed that lncRNA gas5 showed a generalized expression pattern between 0 and 16 hpf (Fig. 8a-e). However, lncRNA gas5 was mainly expressed in the eyes, brain and spinal cord at 24ཞ48 hpf (Fig. 8f-h). At 72 hpf, lncRNA gas5 was mainly expressed in the head, including the telencephalon, diencephalon, midbrain, posterior brain, cerebellum, and eyes (Fig. 8i).

Expression of lncRNA gas5 in different tissues of adult zebrafish

The expression of lncRNA gas5 in 8 different tissues of adult zebrafish (eye, tail, heart, muscle, liver, kidney, brain and spleen) was detected by qPCR. The results showed that lncRNA gas5 was expressed in all different tissues of adult zebrafish, and the expression level from high to low was as follows: brain > eye > kidney > spleen > muscle > tail > liver > heart (Fig. 9).

LncRNA gas5 functional analysis

Functional analysis of lncRNA gas5 was conducted using CRISPR/Cas9 technology. Zebrafish embryos at the 1–4 cell stage were microinjected with 100 ng/µl sgRNA and 300 ng/µl cas9 protein, and embryos microinjected only with 100 ng/µl cas9 and with nothing injected were regarded as controls. At twenty-four hours after injection, 8 eggs were selected for genomic sequencing to test the knockout effect. Sequencing results showed that compared with zebrafish embryos without injection (NI) and zebrafish embryos only injected with Cas9 protein alone, the genomic DNA sequencing map of zebrafish embryos coinjected with sgRNA and Cas9 showed homogeneous cross-peaks after the target sites, while no cross-peaks appeared in the control groups, indicating that lncRNA gas5 knockout was initially successful (Fig. 10a). When the fish developed into adults, the caudal fin was excised for sequencing to further verify the efficiency of knockout. The caudal fin sequencing results were similar to the 24 hpf embryo sequencing results.

To further verify the knockout results, zebrafish embryos microinjected 24 h later were collected, and the expression level of lncRNA gas5 was detected by qPCR and in situ hybridization. qPCR detection results showed that the expression level of lncRNA gas5 in the knockout group was significantly downregulated compared with that in the control group (Fig. 10b). In situ hybridization results also showed that lncRNA gas5 expression levels in brain, eyes and spinal cord were decreased in the knockout group compared with the control groups (Fig. 10c).

Effect of lncRNA gas5 knockout on embryonic development of zebrafish

After depletion of lncRNA gas5 using CRISPR/Cas9 technology, the mortality and malformation rate of zebrafish embryos were analyzed. The results showed that the normal survival rate of embryos in the NI group was 93%, the mortality rate was 7%, and there was no developmental deformity. In the group microinjected only with cas9, 64% of the embryos did not show any phenotypic abnormalities, 34% of the embryos died, and the remaining 2% of the embryos showed developmental abnormalities to some extent. In the knockout group, 55% of embryos died, 3% were deformed, and only 42% survived normally. In conclusion, the death rate and abnormality rate of embryos in the knockout group were higher than those in control groups (Fig. 11f), which indicated that lncRNA gas5 was involved in embryonic development.

Compared with the control group (Fig. 11a), delayed embryonic development was observed in the knockout group (Fig. 11b), and developmental malformations were also observed to some extent, including enlargement of yolk extension (Fig. 11c), small or absent eyes (Fig. 11d), nonseparation of two otoliths, etc. (Fig. 11e).

Effect of lncRNA gas5 knockout on the expression of genes related to embryonic muscle development in zebrafish

After lncRNA gas5 was knocked out with CRISPR/Cas9 technology, qPCR was used to test the expression level of 11 genes (mef2ca, nkx2.5, myhc4, srfa, igf2a, myod1, myog, myf5, pax3a, pax7a, myf6) related to embryonic muscle development in zebrafish. The results showed that the expression levels of mef2ca, igf2a, myod1, myog, myf5, pax3a and pax7a in the knockout group were significantly decreased compared with those in the control group. The expression level of myhc4 was significantly increased compared with that in the control group. The expression levels of nkx2.5, srfa and myf6 showed no significant diffefrence compared with the control group (Fig. 12). In summary, lncRNA gas5 depletion affected the expression level of some muscle-related genes, which indicated that it may play a certain role in muscle development. However, the specific function needs further study.

Effect of lncRNA gas5 knockout on the expression of its neighboring genes

According to relevant studies, lncRNAs can affect the expression of their neighboring genes through signaling, guiding, isolating or scaffold molecules [13–17]. LncRNAs located upstream and downstream of coding proteins may interact with promoters or other cis-acting elements of co-expressed genes to regulate gene expression at the transcriptional or post-transcriptional level. Therefore, after lncRNA gas5 was knocked out using CRISPR/Cas9 technology, qPCR was used to detect the expression of its five neighboring genes (tor3a, osbpl9, calr, si:ch211-198n5 + 11, rpe65b) (Fig. 13, Supplementary table 16). The results showed that the expression level of tor3a in the knockout group was significantly decreased compared with that in the control group. The expression levels of osbpl9 and calr were significantly increased compared with the control group. The expression levels of si:ch211-198n5 + 11 and rpe65b showed no significant change compared with the control group.

Zebrafish husbandry and embryo collection

The AB wild-type zebrafish (Danio rerio) used in this study were purchased from the Institute of Hydrobiology, Chinese Academy of Science (Wuhan, China). The experimental fish were bred and maintained in the standard zebrafish breeding system of our laboratory, with a photoperiod of 14 h light/10 h dark in a closed loop aquaculture system according to standard procedures [18]. They were fed twice a day with live brine shrimp. All animal processing was approved by the Institutional Animal Care and Use Committee of Henan Normal University.

On the night before the zebrafish embryos were collected, one female and one male were placed overnight on each side of the baffle in incubation tanks. The baffles were removed in the morning on the second day. Embryos were collected after the end of spawning, and embryos were cultured in E3 medium (5 mmol/L NaCl, 0.17 mmol/L KCl, 0.33 mmol/L CaCl₂, and 0.33 mmol/L MgSO₄, pH 7.2) at 28°C. Embryos were harvested according to the experimental requirement, and different stages of embryonic development of zebrafish were described according to a previous report[19].

RNA isolation and whole transcriptome sequencing

RNA was isolated from the 3 key different organogenesis stages (10, 24 and 36 hpf) using the TRIzol method. The concentration and purity of total RNA were detected by NanoDrop 2000. High-throughput sequencing was performed after the library was constructed, and strict quality inspection should be carried out on the constructed library. After qualification, sequencing was performed using the Illumina HiSeq platform. Differentially expressed genes and lncRNAs were screened out by the difference multiple | logFC | > 1 and significant p value < 0.05 as the selection criteria.

qPCR detection

To validate the reliability of sequencing data, the expression profiles of 8 DEGs (smtnl1, tor3a, osbpl9, calr, rpe65b, si:ch211-198n5 + 11, tnni1al, pvalb4) and 11 differentially expressed lncRNAs (LOC108179067, LOC108179796, LOC108192140, CH73-21G5.5, LOC101885256, LOC100536039, LOC101884451, LOC101884456, LOC103910859, LOC103909205, LncRNA gas5) were detected using qPCR. In addition, to detect the effects of lncRNA gas5 knockout on the expression of genes related to embryonic muscle development and genes adjacent to lncRNA gas5, the PCR was also performed. All primer sequences are in the supplementary table 17. The reference gene used in this study is eukaryotic translation elongation factor 1 alpha 1 (eef1a1), which is used to homogenize the initial concentration difference of samples [20]. The reaction system was as follows: 1 µL cDNA, 5 µL MonAmpTM SYBR Green qPCR Mix, 0.4 µL each primer (20 µM) and 3.2 µL nuclease-free water. The PCR conditions were as follows: 10 min at 95°C, followed by 45 cycles at 95°C for 15 s, 60°C for 60 s, and a cooling stage at 4°C. The 2 ^−ΔΔCt method was used to analyze expression levels.

The temporal and spatial expression pattern of lncRNA gas5

To further investigate the function of lncRNA gas5, the spatiotemporal expression pattern of lncRNA gas5 was detected by qPCR and in situ hybridization respectively. The prepared RNA was reverse-transcribed into cDNA using HiFiScript cDNA Synthesis Kit (Cwbiotich, China), and the prepared cDNA was diluted 5 times and used as template for qPCR detection using MonAmpTM SYBR Green qPCR Mix (Monad, China). The reaction system and PCR condition were the same as above. The primers of PCR and the probe are presented in supplementary table 17.

The spatial expression of lncRNA gas5 was detected by in situ hybridization. The PCR fragments were cloned into a pGEM-T easy vector and sequenced to verify whether the fragment was ligated to the vector. The antisense and sense probes were transcribed by SP6 or T7 to generate the DIG-labeled probe using the linearized vector, including PCR target fragments as a template. Whole-mount in situ hybridization was performed as previously described[21].

LncRNA gas5 knockout by CRISPR/Cas9

CRISPR‒Cas9 sgRNAs were designed by using the online software CRISPRscan (https://www.crisprscan.org/?page=sequence). LncRNA gas5 has a total of 14 exons, and the target site is located in the sixth exon with a sequence of 20 bp base: GGGATCAAGCTGTATGGAGA. The detection primer sequence was as follows: F (5'-3'): CTGAAGCACCATAAACCAAT, R (5'-3'): TAGGCAATAAGCCAGAACAA, and the amplified product length was 438 bp.

Several previous transcriptome studies have identified more than 3000 lncRNAs in zebrafish embryogenesis stages and adult tissues [1–3]. However, the function of most lncRNAs remains largely unknown. Recently, a number of studies have demonstrated that lncRNAs are related to cardiovascular development [22, 23], heart development [24, 25] and neurodevelopment [26, 27]. Genes preferentially expressed in one of the stages could be of high relevance to stage-specific developmental and molecular events [28]. The morphology of zebrafish changed greatly across 10, 24 and 36 hpf, the rudiments of the primary organs become visible the tail bud becomes more prominent at segmentation stages (10-24hpf)[29], and embryos at these three stages were key organogenesis stages. And sequenced was performed to obtain genes associated with specific organogenesis processes, and our interest focused on lncRNA gas5.

LncRNA gas5 has homologs in humans and mice [30], and some studies have demonstrated that it plays an important regulatory role in muscle development and proliferation in myocardial and muscle-related diseases [5–7]. In addition, several studies on lncRNA gas5 have focused on tumor biology, and most of the research results show that the relative expression of lncRNA gas5 in tumor tissues decreased, indicating that lncRNA gas5 has certain anticancer effects. LncRNA gas5 was also found to inhibit the activation of cardiac fibroblasts. However, relative research in zebrafish is very limited. Only one report demonstrated that the depletion of lncRNA gas5 expression resulted in significantly increased expression of its neighboring gene osbpl9 (encoding lipid-binding protein) [31], suggesting that lncRNA gas5 may play a cis-regulatory role. There is no relevant study on the role of lncRNA gas5 in the muscle development of zebrafish.

Skeletal muscle is an important muscle type that plays an important role in the life activities of organisms. All skeletal muscle is derived from the corresponding region of the head mesoderm or somatic mesoderm [32, 33]. In addition, cardiac muscle and smooth muscle are also important muscle types [1]. Skeletal muscle is an indispensable tissue in animals [34, 35]. There are three kinds of muscle tissue in zebrafish: cardiac muscle, skeletal muscle and smooth muscle. The development process of zebrafish skeletal muscle is mainly the differentiation of myogenic ganglion cells into myoblasts and the fusion of myoblasts into muscle tubes, which further grow and differentiate into multinucleated muscle fibers under the interaction of a series of signaling pathway molecules and myogenic regulatory factors [36, 37]. Myogenic regulatory factors (MRFs) play an important role in skeletal muscle differentiation [38] and are essential in promoting muscle cell differentiation. The MRF family includes four transcription factors: myogenic differentiation antigen (myod), myf5, myogenin (myog and mrf4. In skeletal muscle development, transcription factors paired box 3 (pax3), transcription factors paired box 7 (pax7) and MRFs constitute an important regulatory network [39, 40]. Myocyte enhancer factor-2 (MEF2) is a family of MADS frame transcription factors, including MEF2A, MEF2B, MEF2C and MEF2D. MEF2 and MRF gene families can interact directly to synergistically regulate muscle growth and differentiation through transcriptional activation of the myog gene. Mef2 expression after myog can promote myogenic differentiation [41, 42]. MEF2 itself does not have the ability to regulate muscle differentiation but plays an important role in assisting MRFs. In present study, the expression of 10 genes related to embryonic muscle development of zebrafish (mef2ca, nkx2.5, myhc4, srfa, myod1, myog, myf5, pax3a, pax7a, myf6) was detected by qPCR after the knockout of lncRNA gas5, The results showed that the expression levels of mef2ca, myod1, myog, myf5, pax3a and pax7a in the knockout group were significantly decreased compared with those in the control group, while the expression level of myhc4 was significantly increased compared with that in the control group, suggesting that the lncRNA gas5 may play a role in zebrafish muscle development. It was reported that mef2ca played an important role in myocardial differentiation of zebrafish [43]. Nkx2.5 is expressed in zebrafish cardiomyocytes and is involved in the regulation of ventricular formation [44]. Myhc4 is expected to be localized to the myosin complex with actin filament-binding activity. Srfa was expressed in paraxial cells, the digestive system and muscle tissue. As myogenic regulatory factors, myod1, myog, myf5 and myf6 participate in muscle growth and development [45–48]. Pax3a and pax7a are expressed in muscle and regulate muscle growth and development. It is speculated that lncRNA gas5 may be involved in embryonic muscle development in zebrafish.

According to relevant studies, lncRNAs usually play a certain role by regulating their neighboring genes. Therefore, after lncRNA gas5 was knocked out using CRISPR/Cas9 technology, qPCR was used to detect the expression of its five neighboring genes (tor3a, osbpl9, calr, si:ch211-198n5 + 11, rpe65b). The results showed that the expression level of tor3a was significantly decreased compared with that in the control group, and the expression levels of osbpl9 and calr were significantly increased compared with those in the control group. These results are consistent with previous results [31], and the expression levels of si:ch211-198n5 + 11 and rpe65b were not significantly changed compared with those in the control group. The experimental results indicated that lncRNA gas5 may have a cis-regulatory effect on the embryonic development of zebrafish, but further experimental studies are needed to verify how lncRNA gas5 affects zebrafish embryonic muscle development by regulating these key genes related to muscle development and to reveal the mechanism of action.

DEGs

Differentially expressed genes

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes. qPCR:Quantitative real-time polymerase chain reaction.

Authors’ contributions

C. Zhou performed all experiments and wrote the main manuscript text in this study. M. Li and Y. Sun conducted some experiments in this study. Yousef Sultan provide assistance in language grammar checking. X. Li provided research instruction throughout the study and reviewed the manuscript. All authors reviewed the manuscript.

Acknowledgments

Not applicable

Funding

This research was supported by the Key Research Project of Henan University in China (Grant No. 19zx011).

Code availability

Not applicable

Data availability

RNA-seq data sets in our study are available in the National Center for Biotechnology Information Gene Expression Omnibus under the accession number GSE235668.

Ethics approval and consent to participate

Fish were handled in accordance with guidelines in the China Law for Animal Health Protection and Instructions for Granting Permits for Animal Experimentation for Scientific Purposes (Ethics approval No. SCXK (YU) 2005-0001). All methods are reported in accordance with ARRIVE guidelines for the reporting of animal experiments. All experiments were approved by the Institutional Animal Care and Use Committee of Henan Normal University.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interest

The authors declare no competing interests.

Pauli A, Valen E, Lin MF, Garber M, Vastenhouw NL, Levin JZ, Fan L, Sandelin A, Rinn JL, Regev A et al. Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis. Genome Res. 2012; 22(3):577-591.
Kaushik K, Leonard VE, Kv S, Lalwani MK, Jalali S, Patowary A, Joshi A, Scaria V, Sivasubbu S. Dynamic expression of long non-coding RNAs (lncRNAs) in adult zebrafish. PLoS One. 2013; 8(12):e83616.
Wang L, Ma X, Xu X, Zhang Y. Systematic identification and characterization of cardiac long intergenic noncoding RNAs in zebrafish. Sci Rep. 2017; 7(1):1250.
Schneider C, King RM, Philipson L. Genes specifically expressed at growth arrest of mammalian cells. Cell. 1988; 54(6):787-793.
Cabianca DS, Casa V, Bodega B, Xynos A, Ginelli E, Tanaka Y, Gabellini D. A long ncRNA links copy number variation to a polycomb/trithorax epigenetic switch in FSHD muscular dystrophy. Cell. 2012; 149(4):819-831.
Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, Tramontano A, Bozzoni I. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011; 147(2):358-369.
Tao H, Zhang JG, Qin RH, Dai C, Shi P, Yang JJ, Deng ZY, Shi KH. LncRNA GAS5 controls cardiac fibroblast activation and fibrosis by targeting miR-21 via PTEN/MMP-2 signaling pathway. Toxicology. 2017; 386:11-18.
Tu ZQ, Li RJ, Mei JZ, Li XH. Down-regulation of long non-coding RNA GAS5 is associated with the prognosis of hepatocellular carcinoma. Int J Clin Exp Pathol. 2014; 7(7):4303-4309.
Wang K, Li J, Xiong G, He G, Guan X, Yang K, Bai Y. Negative regulation of lncRNA GAS5 by miR-196a inhibits esophageal squamous cell carcinoma growth. Biochem Biophys Res Commun. 2018; 495(1):1151-1157.
Li W, Zhao W, Lu Z, Zhang W, Yang X. Long Noncoding RNA GAS5 Promotes Proliferation, Migration, and Invasion by Regulation of miR-301a in Esophageal Cancer. Oncol Res. 2018; 26(8):1285-1294.
Sun M, Jin FY, Xia R, Kong R, Li JH, Xu TP, Liu YW, Zhang EB, Liu XH, De W. Decreased expression of long noncoding RNA GAS5 indicates a poor prognosis and promotes cell proliferation in gastric cancer. BMC Cancer. 2014; 14:319.
Li Q, Ma G, Sun S, Xu Y, Wang B. Polymorphism in the promoter region of lncRNA GAS5 is functionally associated with the risk of gastric cancer. Clin Res Hepatol Gastroenterol. 2018; 42(5):478-482.
St Laurent G, Wahlestedt C, Kapranov P. The Landscape of long noncoding RNA classification. Trends Genet. 2015; 31(5):239-251.
Rinn JL, Chang HY. Genome regulation by long noncoding RNAs. Annu Rev Biochem. 2012; 81:145-166.
Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, Snyder M. The transcriptional landscape of the yeast genome defined by RNA sequencing. Science. 2008; 320(5881):1344-1349.
Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, Oyama R, Ravasi T, Lenhard B, Wells C et al. The transcriptional landscape of the mammalian genome. Science. 2005; 309(5740):1559-1563.
Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler PF, Hertel J, Hackermüller J, Hofacker IL et al. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science. 2007; 316(5830):1484-1488.
Westerfield M: The zebrafish book: a guide for the laboratory use of the zebrafish(Danio rerio). USA: University of Oregon press; 1995.
Kimmel C, Ballard W, K, SR, , Ullmann B, Schilling T. Stages of Embryonic Development of the Zebrafish. Dev Dyn. 1995; 203:1238-1246.
McCurley AT, Callard GV. Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol Biol. 2008; 9:102.
Thisse C, Thisse B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat Protoc. 2008; 3(1):59-69.
Li K, Blum Y, Verma A, Liu Z, Pramanik K, Leigh NR, Chun CZ, Samant GV, Zhao B, Garnaas MK et al. A noncoding antisense RNA in tie-1 locus regulates tie-1 function in vivo. Blood. 2010; 115(1):133-139.
Chowdhury TA, Koceja C, Eisa-Beygi S, Kleinstiver BP, Kumar SN, Lin CW, Li K, Prabhudesai S, Joung JK, Ramchandran R. Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly. Arterioscler Thromb Vasc Biol. 2018; 38(7):1562-1575.
Grote P, Wittler L, Hendrix D, Koch F, Währisch S, Beisaw A, Macura K, Bläss G, Kellis M, Werber M et al. The tissue-specific lncRNA Fendrr is an essential regulator of heart and body wall development in the mouse. Dev Cell. 2013; 24(2):206-214.
Kurian L, Aguirre A, Sancho-Martinez I, Benner C, Hishida T, Nguyen TB, Reddy P, Nivet E, Krause MN, Nelles DA et al. Identification of novel long noncoding RNAs underlying vertebrate cardiovascular development. Circulation. 2015; 131(14):1278-1290.
Sarangdhar MA, Chaubey D, Bhatt A, Km M, Kumar M, Ranjan S, Pillai B. A Novel Long Non-coding RNA, durga Modulates Dendrite Density and Expression of kalirin in Zebrafish. Front Mol Neurosci. 2017; 10:95.
Lin N, Chang KY, Li Z, Gates K, Rana ZA, Dang J, Zhang D, Han T, Yang CS, Cunningham TJ et al. An evolutionarily conserved long noncoding RNA TUNA controls pluripotency and neural lineage commitment. Mol Cell. 2014; 53(6):1005-1019.
Yang H, Zhou Y, Gu J, Xie S, Xu Y, Zhu G, Wang L, Huang J, Ma H, Yao J. Deep mRNA sequencing analysis to capture the transcriptome landscape of zebrafish embryos and larvae. PLoS One. 2013; 8(5):e64058.
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995; 203(3):253-310.
Coccia EM, Cicala C, Charlesworth A, Ciccarelli C, Rossi GB, Philipson L, Sorrentino V. Regulation and expression of a growth arrest-specific gene (gas5) during growth, differentiation, and development. Mol Cell Biol. 1992; 12(8):3514-3521.
Goudarzi M, Berg K, Pieper LM, Schier AF. Individual long non-coding RNAs have no overt functions in zebrafish embryogenesis, viability and fertility. Elife. 2019; 8.
Gros J, Manceau M, Thomé V, Marcelle C. A common somitic origin for embryonic muscle progenitors and satellite cells. Nature. 2005; 435(7044):954-958.
Asakura A, Rudnicki MA. Side population cells from diverse adult tissues are capable of in vitro hematopoietic differentiation. Exp Hematol. 2002; 30(11):1339-1345.
Chen R, Jiang T, She Y, Xie S, Zhou S, Li C, Ou J, Liu Y. Comprehensive analysis of lncRNAs and mRNAs with associated co-expression and ceRNA networks in C2C12 myoblasts and myotubes. Gene. 2018; 647:164-173.
Li Y, Chen X, Sun H, Wang H. Long non-coding RNAs in the regulation of skeletal myogenesis and muscle diseases. Cancer Lett. 2018; 417:58-64.
Chargé SB, Rudnicki MA. Cellular and molecular regulation of muscle regeneration. Physiol Rev. 2004; 84(1):209-238.
Gros J, Scaal M, Marcelle C. A two-step mechanism for myotome formation in chick. Dev Cell. 2004; 6(6):875-882.
Mohammadabadi M, Bordbar F, Jensen J, Du M, Guo W. Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals. Animals (Basel). 2021; 11(3).
Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P. Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. Embo j. 1991; 10(5):1135-1147.
Jostes RF, Hui TE, James AC, Cross FT, Schwartz JL, Rotmensch J, Atcher RW, Evans HH, Mencl J, Bakale G et al. In vitro exposure of mammalian cells to radon: dosimetric considerations. Radiat Res. 1991; 127(2):211-219.
Spitz F, Demignon J, Porteu A, Kahn A, Concordet JP, Daegelen D, Maire P. Expression of myogenin during embryogenesis is controlled by Six/sine oculis homeoproteins through a conserved MEF3 binding site. Proc Natl Acad Sci U S A. 1998; 95(24):14220-14225.
Relaix F, Buckingham M. From insect eye to vertebrate muscle: redeployment of a regulatory network. Genes Dev. 1999; 13(24):3171-3178.
Hinits Y, Pan L, Walker C, Dowd J, Moens CB, Hughes SM. Zebrafish Mef2ca and Mef2cb are essential for both first and second heart field cardiomyocyte differentiation. Dev Biol. 2012; 369(2):199-210.
Colombo S, de Sena-Tomás C, George V, Werdich AA, Kapur S, MacRae CA, Targoff KL. Nkx genes establish second heart field cardiomyocyte progenitors at the arterial pole and pattern the venous pole through Isl1 repression. Development. 2018; 145(3).
Osborn DP, Li K, Hinits Y, Hughes SM. Cdkn1c drives muscle differentiation through a positive feedback loop with Myod. Dev Biol. 2011; 350(2):464-475.
Ganassi M, Badodi S, Ortuste Quiroga HP, Zammit PS, Hinits Y, Hughes SM. Myogenin promotes myocyte fusion to balance fibre number and size. Nat Commun. 2018; 9(1):4232.
Lin CY, Lee HC, Chen HC, Hsieh CC, Tsai HJ. Normal function of Myf5 during gastrulation is required for pharyngeal arch cartilage development in zebrafish embryos. Zebrafish. 2013; 10(4):486-499.
Wang YH, Li CK, Lee GH, Tsay HJ, Tsai HJ, Chen YH. Inactivation of zebrafish mrf4 leads to myofibril misalignment and motor axon growth disorganization. Dev Dyn. 2008; 237(4):1043-1050.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Systematic identification of long noncoding RNAs during three key organogenesis stages in zebrafish

Status:

Version 1

Abstract

Background

Results

Conclusion

Figures

Background

Results

RNA sequencing and transcriptome reassembly

Identification of differentially expressed genes and lncRNAs at three organogenesis stages

GO term and KEGG pathway enrichment analysis of DEGs

qPCR validation

Methods

Zebrafish husbandry and embryo collection

RNA isolation and whole transcriptome sequencing

qPCR detection

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1