A primate-specific (CCG) repeat in DISP2 is subject to natural selection in human and harbors divergent genotypes in late-onset neurocognitive disorder.

doi:10.21203/rs.3.rs-2991406/v1

Download PDF

Research Article

A primate-specific (CCG) repeat in DISP2 is subject to natural selection in human and harbors divergent genotypes in late-onset neurocognitive disorder.

https://doi.org/10.21203/rs.3.rs-2991406/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 02 Apr, 2024

Read the published version in Molecular Neurobiology →

You are reading this latest preprint version

(CCG)-repeats are predominantly enriched in genic regions, mutation hotspots for C to T truncating substitutions, and involved in various neurological and neurodevelopmental disorders. However, intact blocks of this class of STRs are widely overlooked with respect to their link with natural selection. The human DISP2 (dispatched RND transporter family member 2) has the highest level of expression in the brain, and contains a (CCG)-repeat, which is in the top 1 percent of STRs with respect to length. Here we sequenced this STR in a sample of 448 Iranian individuals, consisting of late-onset neurocognitive disorder (NCD) (N = 203) and controls (N = 245). The region spanning the (CCG)-repeat was highly mutated, resulting in several CCG residues. However, an 8-repeat of the (CCG)-repeat was predominantly abundant (frequency = 0.92) across the two groups. While the overall distribution of genotypes was not different between the two groups (p > 0.05), we detected four genotypes in the NCD group only (2% of the NCD genotypes, Mid-p = 0.02), consisting of allele lengths that were not detected in the control group. The patients harboring those genotypes received the diagnoses of probable Alzheimer’s disease and vascular dementia. We also found six genotypes in the control group only (2.5% of the control genotypes, Mid p = 0.01). We report a potential novel locus for late-onset NCD and indication of natural selection at this locus in human. These findings reinforce the hypothesis that a collection of rare alleles and genotypes in a number of genes may contribute to a divergent genotype compartment in the pathogenesis of late-onset NCD.

DISP2

(CCG) repeat

short tandem repeat

late-onset NCD

natural selection

Alzheimer&rsquo

s disease

vascular dementia

An increasing wealth of evidence supports vast implications of short tandem repeats (STRs) in evolutionary, biological, and pathological terms [1–10]. However, STRs remain underappreciated in comparison to single nucleotide substitutions [11, 12], partly because of the hardship in accurate allele calling with the currently available methods. CG-rich STRs are particularly prone to difficulty in PCR amplification and sequencing, and the data available in large genome databases, such as gnomAD (https://gnomad.broadinstitute.org/) are frequently inconclusive in respect of allele and genotype frequency information.

In the category of CG-rich STRs, CCG/CGG repeats are overrepresented in genic regions of the human genome, and are mainly attended because of their involvement in neurological disorders [13–16]. The human DISP2 (Dispatched RNA Transporter Family Member 2), also known as C15orf36, DISPB, HsT16908, KIAA1742, LINC00594, is located at chromosome 15q15.1, and has only one protein-coding transcript, which contains an annotated (CCG)-repeat of 8-repeats in the interval between + 1 to + 60 of the transcription start site (TSS) (Transcript: ENST00000267889.5 DISP2-201). This (CCG)-repeat is in the top 1 percentile of (CCG)-repeats with respect to length [17]. Amongst various human tissues, DISP2 is maximally expressed in the brain. In fact, based on several databases, DISP2 is exceptionally expressed in brain tissues (https://www.proteinatlas.org/ENSG00000140323-DISP2/tissue). DISP2 is among the top 5 protective genes against low grade glioma in human [18]. In relevance to the above role, impaired neurocognitive function is extremely common in patients with higher grade primary brain tumor [19].

Here we sequenced the DISP2 (CCG)-repeat in a sample of humans, consisting of late-onset NCDs and controls. We also studied potential RNA heterodimer accessibility patterns resulting from exemplary genotypes, and the status of this STR across vertebrates.

Allele distribution

Extreme short alleles in the NCD group and not controls

The human DISP2 (CCG) repeat was located in a hypermutable region, in which CTG and CCA trinucleotides flanked the (CCG)-repeat, which were most likely the consequence of C to T substitutions in the forward and reverse strands, respectively. The substitutions interrupted a longer ancestral stretch of CCGs, and created a number of CCG-residues at the flanking sequences to the intact (CCG)-repeat (Fig. 1). One predominantly abundant allele of 8-repeats was detected in the human subjects studied in both groups (Fig. 2). At significantly lower frequencies, we detected 9 and 10 repeats of this STR across the two groups. In the NCD group, we found lengths of 5 and 6-repeats, which were not detected in the controls.

Genotype distribution

Overall genotype distribution

The overall genotype distribution at the region encompassing the (CCG) repeat was not significantly different between the two groups of NCD and controls (p > 0.05) (Fig. 3). Furthermore, the distribution of the haplotypes encompassing the (CCG) repeat and the CTG/CCA residues was not significantly different between the two groups (p > 0/05) (Table 1, Fig. 4).

Table 1

Combinatory genotypes across the intact (GCC)-repeat and residues.
Combinatory Genotypes
R1 + R2 + R3 + Intact (CCG)-repeat	Controls (n)	NCDs (n)
3 + 0 + 0 + 5/3 + 2 + 0 + 8 ^a	0	1
3 + 2 + 0 + 6/3 + 2 + 1 + 8 ^a	0	1
3 + 2 + 1 + 6/3 + 2 + 3 + 8 ^a	0	1
3 + 2 + 0 + 8/3 + 2 + 0 + 8	94	78
3 + 2 + 0 + 8/3 + 2 + 1 + 8	70	50
3 + 2 + 0 + 8/3 + 2 + 3 + 8	22	23
3 + 2 + 0 + 8/3 + 2 + 4 + 8 ^a	0	1
3 + 2 + 1 + 8/3 + 2 + 1 + 8	7	3
3 + 2 + 1 + 8/3 + 2 + 3 + 8	13	10
3 + 2 + 3 + 8/3 + 2 + 3 + 8	3	5
3 + 2 + 4 + 8/3 + 2 + 4 + 8 ^b	1	0
3 + 2 + CTG + 8/3 + 2 + CTG + 8 ^b	1	0
3 + 2 + 0 + 8/3 + 2 + 0 + 9	11	7
3 + 2 + 0 + 8/2 + 2 + 0 + 9	6	13
3 + 2 + 1 + 8/3 + 2 + 0 + 9	3	1
3 + 2 + 1 + 8/2 + 2 + 0 + 9	2	4
3 + 2 + 3 + 8/3 + 2 + 0 + 9 ^b	2	0
3 + 2 + 3 + 8/2 + 2 + 0 + 9	4	3
3 + 2 + 0 + 8/3 + 2 + 0 + 10 ^b	1	0
3 + 2 + 0 + 8/2 + 2 + 0 + 10 ^b	1	0
3 + 2 + 0 + 8/3 + 0 + 0 + 11	1	1
3 + 2 + 0 + 9/2 + 2 + 0 + 9	2	1
2 + 2 + 0 + 9/2 + 2 + 0 + 9 ^b	1	0
	245	203
^a NCD-only genotypes. ^b Control-only genotypes. R = residue

Four combinatory genotypes were detected in the NCD group and not controls.

We detected four combinatory genotypes that were detected in the NCD group only (Fig. 5). Assessment of the patients harboring those genotypes through clinical interviews, neurological examinations, the course of the disease, and ruling out other major neurological and psychiatric disorders, indicated possible diagnosis of Alzheimer’s disease (AD) in patients 1, 2, and 4 (Table 2). In patient 3, there was a history of hypertension and stroke prior to the cognitive decline, indicating the diagnosis of vascular dementia (VD). All four genotypes consisted of repeat lengths across the intact (CCG)-repeat and the residues that were non-existent in the control group.

Table 2

Four NCD patients harboring combinatory genotypes that were not detected in the controls.
Patient No.	Gender	Age	AMTS	MMSE	Combinatory Genotype	Possible Diagnosis
1	M	70	5	NA	3 + 0 + 0 + 5/3 + 2 + 0 + 8	AD
2	M	82	2	NA	3 + 2 + 0 + 6/3 + 2 + 1 + 8	AD
3	F	65	0	NA	3 + 2 + 1 + 6/3 + 2 + 3 + 8	VD
4	F	75	4	14	3 + 2 + 0 + 8/3 + 2 + 4 + 8	AD

Six combinatory genotypes were detected in the NCD group and not controls.

Six combinatory genotypes encompassing the intact (CCG)-repeat and residues were detected in the controls only (Table 3. Figure 6). Those genotypes predominantly consisted of the 8-repeat.

Table 3

Six combinatory genotypes were detected in the control group and not NCDs.
Control No.	Gender	Age	AMTS	MMSE	Combinatory Genotype
1	M	72	8	NA	3 + 2 + 4 + 8/3 + 2 + 4 + 8
2	M	71	10	NA	3 + 2 + CTG + 8/3 + 2 + CTG + 8
3	F	74	8	NA	3 + 2 + 3 + 8/3 + 2 + 0 + 9
4	F	68	8	29	3 + 2 + 0 + 8/3 + 2 + 0 + 10
5	M	79	9	NA	3 + 2 + 0 + 8/2 + 2 + 0 + 10
6	M	85	8	NA	2 + 2 + 0 + 9/2 + 2 + 0 + 9

RNA accessibility varied with different RNA heterodimers.

The potential RNA/RNA heterodimer structures differed as a result of exemplary combinatory genotypes. Those structures potentially altered accessibility of the RNA heterodimer structures at least across exons 1 and 2 (Fig. 7).

DISP2 (CCG)-repeat expanded specifically in primates.

Across all the vertebrate species studied, the DISP2 (CCG)-repeat specifically expanded beyond 2-repeats in primates (Fig. 8). The repeat formula was specific for each primate, and bushbaby, as the most basic primate among those primates, had 2-repeats at this locus.

Intact (CCG)-repeats are probably among the top STRs in respect of their link with natural selection for several reasons. Firstly, (CCG)-repeats are specifically enriched in genic regions. Secondly, CG-rich sequences inherent to those repeats are mutation hotspots [20], and frequently interrupted by single nucleotide substitutions. Thirdly, CCG/CGG repeat expansions are linked with various neurological and neurodevelopmental disorders in human 16. Fourthly, low frequency genotypes of these STRs in a number of genes appear to unambiguously link with late-onset NCD [14, 15, 21]. However, these blocks remain largely overlooked in concern with their link with selection processes. The region in which the human DISP2 (CCG)-repeat is located is a mutation hotspot, which has led to several (CCT) and (CCA) trinucleotides and (CCG)-residues at the flanking sequence of the intact (CCG)-repeat. The fact that despite the high mutation rate in the region, an intact 8-repeat predominated in the human samples studied, supports the hypothesis that this repeat length is the optimal length in respect of natural selection in human. In line with the above hypothesis, we found four divergent genotypes in the NCD group only, that mainly contained allele lengths at the extreme short length of the intact (CCG)-repeat that were non-existent in the controls. On the other hand, six combinatory genotypes were detected in the controls only, which may confer protection against late-onset NCD in human. Those genotypes were predominantly consistent of the 8-repeat. At the inter-species level, intactness of the (CCG)-repeat in primates, and not in any other order, supports selective advantage of this STR in this order.

The human DISP2 is almost exceptionally expressed in the brain. GGC/(CCG)-repeats of similar length range, for example, in Reelin (RELN), which is critical to neurodevelopment in human, modulate gene expression in luciferase reporter assays [22]. It is speculated that similar to the RELN (CCG) repeat, different repeat lengths of the DISP2 (CCG) repeat alter gene expression, the consequence of which may contribute to compromised higher order brain functions observed in late-onset NCD.

It is often claimed that genes affecting health in older age are beyond the reach of natural selection. However, findings on the APOE alleles and several other NCD susceptibility loci indicate that natural selection indeed happens on such alleles [23–25]. Instances of STR allelic natural selection at non-coding loci in human are limited [8, 14, 15], and DISP2 provides a valuable locus to further test this phenomenon.

Successful PCR amplification of the human DISP2 gene necessitates stringent conditions and special CG-rich buffer preparations as described in the Methods. Furthermore, it is essential that all PCR products are sequenced because of the (CCG)-residues flanking the (CCG)-repeat, which will make fragment-based allele callings unreliable.

Findings on DISP2 reinforce the notion that a collection of rare alleles and genotypes in a number of genes may contribute to an unambiguous genotype compartment in the pathogenesis of late-onset NCD, which warrants further validation by independent groups. These data also warrant sequencing of the region in a spectrum of neurological and neurocognitive disorders.

We report a novel potential locus for late-onset AD and VD at the DISP2 (CCG)-repeat and indication of natural selection at this locus in human. Allele lengths and genotypes at this locus may unambiguously predispose to, or protected against late-onset NCD. While the group-specific genotypes encompassed approximately 2% of the genotypes, they represent an underappreciated feature, which may link complex disorders such as AD and VD to unambiguous genotypes at certain STR loci.

Subjects

Four hundred forty-eight Iranian subjects of ≥60 years of age, consisting of late-onset NCD patients (DSM-5) (N=203) and controls (N=245) were recruited from the provinces of Tehran, Qazvin, and Rasht. In each NCD case, the Persian version of the Abbreviated Mental Test Score (AMTS) [26, 27] was implemented (AMTS<7 was an inclusion criterion for NCD), medical records were reviewed in all participants, and CT-scans were taken where possible. Furthermore, in a number of subjects, the Mini-Mental State Exam (MMSE) Test [28] was implemented in addition to the AMTS. A score of <24 was an inclusion criterion for NCD. The Persian version of the AMTS is a valid cognitive assessment tool for older Iranian adults, and can be used for NCD screening in Iran [26]. The control group was selected based on cognitive AMTS of >7 and MMSE>24, lack of major medical history, and normal CT-scan where possible. The cases and controls were matched based on age, gender, and residential district. The subjects' informed consent was obtained (from their guardians where necessary) and their identities remained confidential throughout the study. The research was approved by the Ethics Committee of the Social Welfare and Rehabilitation Sciences, Tehran, Iran, and was consistent with the principles outlined in an internationally recognized standard for the ethical conduct of human research. All methods were performed in accordance with the relevant guidelines and regulations.

Allele and genotype analysis of the DISP2 (CCG)-repeat.

Genomic DNA was extracted from peripheral blood using a standard salting out method. PCR reactions for the amplification of the DISP2 (CCG)-repeat were set up with the following primers:

Forward: GACTCCTAACAGCGGCTCTC

Reverse: AATTGACCCGGCAGGATGA

PCR reactions were carried out with a GC-TEMPase 2x master mix (Amplicon) in a thermocycler (Peqlab-PEQStar) under the following conditions: touchdown PCR: 95 ◦C for 5 min, 20 cycles of denaturation at 95 ◦C for 45 s, annealing for 45 s at 65◦C (-0.5 decrease for each cycle) and extension at 72 ◦C for 1 min, and 30 cycles of denaturation at 95 ◦C for 40 s, annealing at 55 ◦C for 45 s and extension at 72 ◦C for 1 min, and a final extension at 72 ◦C for 10 min. Genotyping of every sample included in this study was performed following Sanger sequencing by the forward primer, using an ABI 3130 DNA sequencer (Suppl. 1).

Predicting RNA-RNA Interactions

The RNAstructure software [29] was implemented to study example RNA/RNA dimerization patterns and potential accessibility variations across those dimers.

Analysis of the DISP2 (CCG)-repeat across vertebrates

The interval between +1 and +100 of the TSS of DISP2 was searched across all species in which DISP2 was annotated, based on Ensembl 108. The Ensembl alignment program was implemented for the sequence alignments across the selected species.

Statistical analysis

OpenEpi (https://www.openepi.com/TwobyTwo/TwobyTwo.htm) was used to analyze the allele and genotype data in the human samples studied.

AD: Alzheimer’s disease

AMTS: Abbreviated Mental Test Score

DISP2: Dispatched RND transporter family member 2

MMSE: Mini-Mental State Examination

NCD: Neurocognitive disorder

STR: Short tandem repeat

VD: Vascular dementia

Acknowledgments

Not applicable.

Funding

Not applicable.

Competing Interests

None to be declared.

Author Contributions

S. Kh and S. A performed the molecular experiments and allele and genotype analyses. H.R. Kh, A. D, and N. T contributed to data collection. M. O conceived and supervised the project and wrote the manuscript with input from all authors.

Data Availability

All raw data on alleles and genotypes, and sequence electropherograms are available upon reasonable request to the corresponding authors.

Ethics approval

This research conformed to the Ethics guidelines of the Ethics Committee of the Social Welfare and Rehabilitation Sciences, Tehran, Iran.

Consent to participate

Written informed consent was obtained from all participants (or their guardians where necessary).

Consent to publish

Confirmed and agreed by all co-authors.

Nikkhah M, Rezazadeh M, Khorram Khorshid HR, et al (2016) An exceptionally long CA-repeat in the core promoter of SCGB2B2 links with the evolution of apes and Old World monkeys. Gene 576:109-14. doi: 10.1016/j.gene.2015.09.070.
Mohammadparast S, Bayat H, Biglarian A, et al (2014) Exceptional expansion and conservation of a CT-repeat complex in the core promoter of PAXBP1 in primates. Am J Primatol 76:747-56. doi: 10.1002/ajp.22266.
Afshar H, Khamse S, Alizadeh F, et al (2020) Evolving evidence on a link between the ZMYM3 exceptionally long GA-STR and human cognition. Scientific Reports 10. doi: 10.1038/s41598-020-76461-z
Watts P, Kallio E, Koskela E, et al (2017) Stabilizing selection on microsatellite allele length at arginine vasopressin 1a receptor and oxytocin receptor loci. Proceedings of the Royal Society B: Biological Sciences 284:20171896. doi: 10.1098/rspb.2017.1896.
Hannan AJ. Tandem repeats mediating genetic plasticity in health and disease (2018) Nature Reviews Genetics19:286-98. doi: 10.1038/nrg.2017.115.
Ranathunge C, Pramod S, Renaut S, et al (2021) Microsatellites as Agents of Adaptive Change: An RNA-Seq-Based Comparative Study of Transcriptomes from Five Helianthus Species. Symmetry 13:933.
Fotsing SF, Margoliash J, Wang C, et al (2019) The impact of short tandem repeat variation on gene expression. Nat Genet 51:1652-59. doi: 10.1038/s41588-019-0521-9.
Afshar H, Adelirad F, Kowsari A, et al (2020) Natural Selection at the NHLH2 Core Promoter Exceptionally Long CA-Repeat in Human and Disease-Only Genotypes in Late-Onset Neurocognitive Disorder. Gerontology 66:514-22. doi: 10.1159/000509471.
Maddi AMA, Kavousi K, Arabfard M, et al (2022) Tandem repeats ubiquitously flank and contribute to translation initiation sites. BMC Genomic Data 23:59. doi: 10.1186/s12863-022-01075-5.
Arabfard M, Kavousi K, Delbari A, et al (2018) Link between short tandem repeats and translation initiation site selection. Human Genomics 12:47. doi: 10.1186/s40246-018-0181-3.
Press MO, Hall AN, Morton EA, et al (2019) Substitutions Are Boring: Some Arguments about Parallel Mutations and High Mutation Rates. Trends in genetics : TIG 35:253-64. doi: 10.1016/j.tig.2019.01.002.
Press MO, Carlson KD, Queitsch C (2014) The overdue promise of short tandem repeat variation for heritability. Trends Genet 30:504-12. doi: 10.1016/j.tig.2014.07.008.
Annear DJ, Vandeweyer G, Elinck E, et al (2021) Abundancy of polymorphic CGG repeats in the human genome suggest a broad involvement in neurological disease. Scientific Reports 11:2515. doi: 10.1038/s41598-021-82050-5.
Jafarian Z, Khamse S, Afshar H, et al (2021) Natural selection at the RASGEF1C (GGC) repeat in human and divergent genotypes in late-onset neurocognitive disorder. Scientific Reports 11:19235. doi: 10.1038/s41598-021-98725-y.
Khamse S, Jafarian Z, Bozorgmehr A, et al (2021) Novel implications of a strictly monomorphic (GCC) repeat in the human PRKACB gene. Scientific Reports 11:20629. doi: 10.1038/s41598-021-99932-3.
Tang H, Kirkness EF, Lippert C, et al (2017) Profiling of Short-Tandem-Repeat Disease Alleles in 12,632 Human Whole Genomes. Am J Hum Genet 101:700-15. doi: 10.1016/j.ajhg.2017.09.013.
Namdar P, Mohammadparast S, Zaker B, et al (2015) Exceptionally long 5′ UTR short tandem repeats specifically linked to primates. Gene 569. doi: 10.1016/j.gene.2015.05.053.
Liu W, Zou J, Ren R, et al (2021) A Novel 10-Gene Signature Predicts Poor Prognosis in Low Grade Glioma. Technol Cancer Res Treat 20:1533033821992084. doi: 10.1177/1533033821992084.
Bosma I, Douw L, Bartolomei F, et al (2008) Synchronized brain activity and neurocognitive function in patients with low-grade glioma: a magnetoencephalography study. Neuro Oncol 10:734-44. doi: 10.1215/15228517-2008-034.
Nesta AV, Tafur D, Beck CR (2021) Hotspots of Human Mutation. Trends Genet 37:717-29. doi: 10.1016/j.tig.2020.10.003.
Khamse S, Alizadeh S, Bernhart SH, et al (2022) A (GCC) repeat in SBF1 reveals a novel biological phenomenon in human and links to late onset neurocognitive disorder. Sci Rep 12:15480. doi: 10.1038/s41598-022-19878-y.
Persico AM, Levitt P, Pimenta AF (2006) Polymorphic GGC repeat differentially regulates human reelin gene expression levels. J Neural Transm (Vienna) 113:1373-82. doi: 10.1007/s00702-006-0441-6.
Drenos F, Kirkwood TB (2010) Selection on alleles affecting human longevity and late-life disease: the example of apolipoprotein E. PLoS One 5:e10022. doi: 10.1371/journal.pone.0010022.
Raj T, Shulman JM, Keenan BT, et al (2012) Alzheimer disease susceptibility loci: evidence for a protein network under natural selection. Am J Hum Genet 90:720-6. doi: 10.1016/j.ajhg.2012.02.022.
Afshar H, Khamse S, Alizadeh F, et al (2020) Evolving evidence on a link between the ZMYM3 exceptionally long GA-STR and human cognition. Scientific Reports 10:19454. doi: 10.1038/s41598-020-76461-z.
Foroughan M, Wahlund LO, Jafari Z, et al (2017) Validity and reliability of a bbreviated M ental T Est S core (AMTS) among older I ranian. Psychogeriatrics 17:460-65.
Hodkinson HM (1972) Evaluation of a mental test score for assessment of mental impairment in the elderly. Age Ageing 1:233-8. doi: 10.1093/ageing/1.4.233.
Carpenter CR, Banerjee J, Keyes D, et al (2019) Accuracy of Dementia Screening Instruments in Emergency Medicine: A Diagnostic Meta-analysis. Acad Emerg Med 26:226-45. doi: 10.1111/acem.13573.
DiChiacchio L, Mathews DH (2016) Predicting RNA-RNA Interactions Using RNAstructure. Methods Mol Biol 1490:51-62. doi: 10.1007/978-1-4939-6433-8_4.

Download PDF

Journal Publication

published 02 Apr, 2024

Read the published version in Molecular Neurobiology →

Reviewers agreed at journal
16 Jun, 2023
Reviewers invited by journal
16 Jun, 2023
Editor invited by journal
13 Jun, 2023
Editor assigned by journal
30 May, 2023
First submitted to journal
28 May, 2023

You are reading this latest preprint version

A primate-specific (CCG) repeat in DISP2 is subject to natural selection in human and harbors divergent genotypes in late-onset neurocognitive disorder.

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Conclusion

Methods

Abbreviations

Declarations

Acknowledgments

References

Status:

Journal Publication

Version 1