Development of a TaqMan-Probe-based multiplex real-time fluorescence quantitative PCR for simultaneous detection of three bovine diarrhea- associated viruses

doi:10.21203/rs.3.rs-2996089/v1

Background

Since the recent discovery, the prevalence of novel bovine diarrhea viruses, including bovine rotavirus virus (BRV), bovine viral diarrhea virus 1 (BVDV-1), and bovine enterovirus virus (BEV) is high worldwide, resulting in significant economic losses to the bovine industry in China. However, clinical symptoms caused by BRV, BVDV-1, and BEV are hard to distinguish, so a rapid and sensitive detection method is urgently needed to differentiate these three viruses. In this study, a real-time fluorescence quantitative-PCR (fqPCR) assay with specific primers and TaqMan fluorescent probes using multiple TaqMan probes for the simultaneous detection of BRV, BVDV-1, and BEV was established.

Result

This assay had good specificity and no cross-reactivity with BPV, BCOV, BNoV, BKoV, and BoAstV. The detection limit of single and multiplex fqPCR was up to 10 copies and correlation coefficients (R² > 0.992) in all cases, indicating that the method had good sensitivity and repeatability. Clinical detection of samples revealed a 48.4% (34/165) total rate of co-infection among the viruses and a 1.2% (2/165) triple infection rate.

Conclusion

The newly developed multiplex fqPCR assay can serve as a diagnostic tool for BRV, BVDV-1, and BEV identification, and it may be utilized for routine surveillance of these emerging and reemerging bovine diarrheal viruses.

bovine diarrheal

real-time fqPCR

TaqMan probe

co-infections

assay

Bovine diarrhea has posed a great threat to the dairy and beef industries worldwide and the health of cattle is becoming increasingly important[1]. However, accumulating evidence suggests that diarrhea in cattle is caused by co-infection of multiple viruses[2, 3]. While bovine enterovirus (BEV) is considered an important cause of diarrhea[4], several emerging bovine viruses have been recently reported, including bovine rotavirus virus (BRV)[5] and bovine viral diarrhea virus 1 (BVDV-1)[6]. However, a disease caused by BRV, BVDV, or BEV is hard to distinguish given the relative similarity between clinical symptoms caused by these three viruses[7]. Some of the viruses have been frequently missed in clinical diagnosis and epidemiological studies[8]. Thus, early diagnosis of viral pathogens associated with each outbreak could be beneficial for the timely management and control of these viruses. Rotaviruses belong to the Sedoreoviridae family and have a double-stranded RNA[9]. Bovine rotavirus A (BRV) is the major etiologic agent of severe gastroenteritis in cattle, resulting in substantial morbidity and mortality, particularly in newborn calves[10]. The primary mode of transmission of rotavirus is fecal-oral[11]. The mechanism of rotavirus-induced diarrhea is not completely known. The major mechanism appears to be a decreased absorption of salt and water related to selective infection of the absorptive intestinal villous cells, resulting in net fluid secretion10. In different studies, BRV infection rates of 20–60% in different of areas have been reported[12]. The different prevalence rates across regions may be due to the frequent recombination of rotavirus[13].

Bovine viral diarrhea (BVD) is a disease characterized by fever, diarrhea, respiratory symptoms, and reproductive disorders, and is caused by infection with bovine viral diarrhea virus (BVDV), a single-stranded, positive-sense RNA virus belonging to the Pestivirus genus and Flaviviridae family [2]. Previous studies have concluded that BVDV aggravates respiratory disease syndrome by causing immune tolerance and persistent infection[14]. Tajima M et al. summarized the incidence of BVDV in Japan in the past 20 years, with a continuos increase in the incidence rate, reaching its peak in 2016 indicating safety problems with the vaccine[15]. Seroprevalences estimated in regions under the surveillance of the United Nations ranged from 46.23–48.73% at the animal level, and from 66.08–67.01% at the herd level. Dall Agnol AM et al. reported a mixed infection of rotavirus and bovine viral diarrhea in newborn calves and suggested that the probability of mixed infection of the two viruses was high[16]. In the last decades, demand for dairy products and beef has dramatically increased[17], expediting the development and investment in the cattle industry, as well as increasing the cattle transport frequency, resulting in BVDV spreading extensively globally. BEV is a common bovine enterovirus that has been reported in cattle herds in the United States, Canada, the United Kingdom, Germany, Poland, Pakistan, and China[18]. BEV is a small, spherical, non-enveloped virus with a single-stranded, sense RNA genome. Enterovirus includes 12 enteroviruses (Enterovirus A–L). According to the latest classification, the species of bovine enterovirus are classified as Enterovirus-E and Enterovirus-F[19]. BEV was first detected in diarrheal cattle in 1959 and was first reported in China in 2011[20]. Clinical manifestations of enterovirus infection in cattle can range from respiratory and intestinal diseases to reproductive diseases and infertility. The pathogenicity and virulence of BEV are poorly understood, with previous studies suggesting limited pathogenicity and no clinically significant signs of BEV infection replicated in calves. However, as BEV isolates are increasingly being detected in infected cattle[21], their pathogenicity and virulence have garnered renewed attention.

Due to the similarity in clinical signs and co-infections involved in diarrhea, it is nearly impossible to rapidly and accurately identify the causative agents solely based on the clinical signs and conventional methods like pathogens isolation. Therefore, single and multiplex real-time PCR assays have been developed for the rapid detection of pathogens associated with diarrhea in the past years[22, 23]. However, single target real-time PCR requires separate amplification by consuming excess resources along with inefficient processing[24]. Diagnostic methods that can directly detect the above three viruses simultaneously are lacking. In addition, the pathogenesis of these viruses is still unclear, and there are few prevention and control measures. Timely prevention and monitoring are the main means of prevention and control in clinical practice.

In this study, we developed a multiplex real-time PCR assay for synchronously detecting three viral pathogens associated with diarrhea. The optimized assay displayed excellent performance. More importantly, this provides an important tool for studies on the etiology of diarrhea in cattle.

Virus strains and clinical samples

In this study, the nucleic acid of all the virus strains was isolated from clinical samples that had tested positive by PCR assays and preserved at -20 °C until further use. The viral sequences were uploaded to GenBank. A total of 165 clinical samples, comprising feces and small intestines from bovines with diarrhea symptoms, were collected in China between 2021 and 2022. Samples were stored in the laboratory before analysis.

Nucleic acid extraction and reverse transcription

Positive samples were treated with PBS（phosphate buffer saline）, and the supernatant was collected. RNA was extracted following the manufacturer's instructions from the samples using an automatic nucleic acid extraction instrument (Xian Tianlong Science & Technology Co.Ltd). (5×)PrimeScript^RT Master Mix Kit (Takara, Dalian, China) was used to reverse-transcribe the extracted RNA into cDNA following the manufacturer’s instructions. All DNA and cDNA products were stored at -20 °C until use.

Design of specific primers and probe

The conservation of genes was determined for designing specific probes and primers using Primer Premier 5 software. Using the Basic Local Alignment Search Tool, we examined potential cross-reactivity and target specificity. Primers and probes were synthesized by Takara Biomedical Technology (Dalian, China). The details data are presented in Table 1.

Table 1. Primers and probes designed for the multiplex fqPCR

Virus	Primer/probe	Sequence(5’-3’)	Size(bp)	Target gene	Reference

	F	TCAACTCTTTCTGGAAAATCTATT	221bp 256bp 215bp	5’UTR 5’UTR 5’UTR	This Study This Study This Study
BRV	R	TCTGGAGACTTCGACAACATGTA
	Probe	FAM-AGTGAACAATACATTTCACCAGATGC-BHQ1

	F	GAGTTCGTTGGATGGCTGAA
BVDV	R	CGCACAAAGCGTCGAACCACT
	Probe	Texas Red- TGAGTACAGGGTAGTCGT-MGB

	F	GGCCGTGAATGCTGCTAATC
BEV	R	CGCGTTACGACGTAGCAACA
	Probe	CY5-AACCTCCGAGCGTGTGCGCA(G)C-BHQ3

Preparation of standard plasmids

Target fragments of BRV, BVDV-1, and BEV were amplified by PCR, using the same primers as those used for multiplex fqPCR.The total reaction volume was 25 µL, including 12.5 µL of Takara LA Taq DNA Polymerase, 100 nmol forward and reverse primers, and 1 µL of template DNA. Sterile water was added to make up the final volume to 25 µL. The cycling reaction conditions were as follows: 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, and 72°C for 10 min. Sterile water was used as a negative control. The PCR was conducted on a hema96TC instrument. The PCR product was separated by agarose gel electrophoresis, and the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 was used for recovery of nucleic acids from the gel; pGEM-T Easy was used and the nucleic acids were cloned into JM109 receptor cells. Then, the bacterial cultures were shaken and grown for 10–14h at 37 ℃. The positive plasmids were extracted and concentrations were measured. The recombination plasmids were confirmed by Takara Biomedical Technology (Dalian, China). The copy number of extracted plasmid was calculated as follows:

The plasmid was diluted 10-fold to calculate the copy number, and the plasmid concentration was diluted from 1×107 copies/µL to 1×101 copies/µL, which was used for a single fqPCR assay of each virus to generate three standard curves. The standard equation was calculated according to the E-value (amplification efficiency) and R2 value (correlation coefficient).

Optimization of the single and multiplex TaqMan fqPCR assays

The single system fqPCR comprised 12.5 µL of 2×TaqMan fqPCR Master Mix,100 nmol forward and reverse primers,100 nmol probe, and 1 µL template DNA; sterile water was added to a total volume of 25 µL. The end of the reaction system was optimized by the matrix method. Multiplex fqPCR was conducted after several optimizations of the reaction system composition to determine the optimal multiple reaction system. The thermal cycling procedure was as follows: 95 °C for 5 min, 40 cycles of 95 °C for 30 s, and 58 °C for 30 s. Signals were automatically collected at the end of each cycle. Amplification was performed using LightCycler® 96 (Applied Biosystems). The fluorescence channels of the fqPCR instrument were set as follows: channel 1, FAM; channel 2, Texas Red, and channel 3, Cy5. Fluorescence signals were also collected with the fqPCR instrument.

Sensitivity test for the multiplex fqPCR assay

The correct plasmids which were confirmed by sequencing were diluted from 106 to 101 copies/µL, as the template, and the detection limit of the multiplex fqPCR was examined. Three replicates were used for each concentration.

Specificity test of the multiplex fqPCR assay

To confirm the specificity of multiplex fqPCR and avoid false positive results due to other viruses, using multiplex fqPCR to detect BPV, BCOV, BNoV, BKoV, and BoAstV which were stored in the laboratory. Sterile water was used as the negative control.

Repeatability test of the multiplex fqPCR assay

To ensure the stability of the experiment, repeated test was conducted by different experimenters on different instruments for various periods, and intra-assay and inter-assay analyses were conducted for experimental data.

Examination of clinical samples using multiplex fqPCR

From 2021 to 2022, the feces and intestinum tenue from 165 bovines in China were collected. The clinical samples were collected and physiological saline was immediately added for storage at -80 °C. Multiplex fqPCR assay was conducted for all samples to determine the virus positivity of the samples. To ensure the authenticity and reliability of the procedure, all positive samples were sequenced by Takara Biomedical Technology (Dalian, China). The infection rate of each virus was analyzed after obtaining the assay results of all clinical samples.

Optimized single fqPCR for individual viruses

Before developing multiple assays, a single fqPCR was established for each virus. With standard plasmids from each virus diluted 10-fold serially from 10⁷ to 10¹ copies/μL, the standard curves showed good amplification efficiency, with the following correlation coefficients: BRV (R² = 0.994; eff % = 107), BVDV (R²= 0.994; eff % = 102), BEV (R² = 0.999; eff % = 102). The quantitative cycle (Cq) values determined by a single fqPCR for a single virus are shown in Table 2. All primers and probes designed using this technology were effective and sensitive, and all plasmids qualified, as shown in Figure 1. The minimum effective positive fluorescence (EPF) was set at 0.05 according to the instrument's default. The Cq value was recorded when the EPF was 0.05 and Cq values >36 were considered negative.

Table 2. The quantification cycle (Cq) values of the single fqPCR assays for individual viruses.

Templates（copies/ul）	BRV	BVDV	BEV
10⁷	13.96	14.17	14.09
10⁶	15.72	18.11	17.79
10⁵	19.17	22.69	21.83
10⁴	22.86	25.88	25.28
10³	25.91	29.44	28.59
10²	29.87	33.18	32.35
10¹	33.29	35.49	35.56

Multiplex fqPCR optimization

The probes and primers interacted with each other of different viruses in multiple fqPCR. Three fluorescence groups with different excitation wavelengths were selected for designing separate probes for each virus to ensure the normal recognition of the instrument. The end reaction volume was 25 μL (12.5 μL 2 × PrimeScript Master Mix), with 100 nmol forward and reverse primers, 100 nmol probes, 1 μL viral template, and nuclease-free water added to make up the final volume). The thermal cycle procedure was as follows: 95 °C for 5 min, 95 °C 30 s, and 58 °C 30 s for 40 cycles. Automatic signals were collected at the end of each cycle. Multiplex fqPCR results showed that all target genes of three viruses could be detected with high correlation values. The standard curves showed good correlation coefficients and amplification effects; the correlation coefficients were as follows: BRV(R² = 0.996; Eff% = 99), BVDV (R² = 0.993; Eff% = 96), and BEV (R² = 0.998; Eff% = 98) as shown in Figure 2.

Specificity of the multiplex fqPCR

BRV, BVDV-1, BEV, BPV, BCOV, BNoV, BKoV, and BoAstV were amplified to detect the specificity of the multiplex fqPCR technology developed in this study. nuclease-free water was used as a negative control, and only the target virus was found to be positive ( Figure 3 ), indicating the method’s specificity.

Repeatability of the multiplex fqPCR

To verify the repeatability of the experimental method, three different researchers conducted detection experiments at different times and collected data for analyses. Both within-batch and between-batch analyses showed high repeatability of multiplex fqPCR (Table 3).

Table 3. The repeatability of the multiplex fqPCR

Template	(copies/μL) Concentration	Intra-assay Mean±SD	Intra-assay variabilityCV %	Inter-assay Mean±SD	Inter-assay variability CV %
pGEM-BRV-NSP6	1.0×10⁵	20.17±0.33	1.63	19.85±0.28	1.41
	1.0×10⁴	24.27±0.21	0.86	25.16±0.43	1.70
	1.0×10³	27.38±0.43	1.57	27.11±0.31	1.14
	1.0×10²	29.82±0.34	1.14	29.05±0.43	1.48
pGEM-BVDV-5’UTR	1.0×10⁵	20.45±0.22	1.06	20.53±0.38	1.85
	1.0×10⁴	22.69±0.31	1.36	22.89±0.31	1.35
	1.0×10³	25.68±0.29	1.12	25.08±0.32	1.27
	1.0×10²	29.44±0.39	1.13	30.18±0.23	0.76
pGEM-BEV- 5’UTR	1.0×10⁵	22.49±0.23	1.04	19.86±0.36	1.81
	1.0×10⁴	25.28±0.19	0.75	24.77±0.21	0.84
	1.0×10³	28.89±0.20	0.69	28.94±0.26	0.89
	1.0×10²	32.75±0.31	0.94	31.16±0.17	0.54

Sensitivity of the multiplex fqPCR

The optimized reaction systems used standard plasmids before detecting the method’s sensitivity. The minimum amount of detection was 10 copies/μL. As shown in Table 4, one copy could also be detected; the CT was greater than 36 but the result was not stable enough to be considered.

Table 4. Sensitivity of the multiplex fqPCR assay

Templates	Copies/ul	Total/times	Positive detection/times	Rate (%)	95%Confidence region
BRV	10	45	45	100%	√
	1	45	11	24.1%	×
BVDV	10	45	45	100%	√
	1	45	9	19.6%	×
BEV	10	45	45	100%	√
	1	45	35	78.4%	×

Agreement between the results of multiplex fqPCR and sequencing

The method developed in this study was used to evaluate fecal samples from 165 bovines with diarrhea symptoms, and the positive samples were validated by sequencing by Takara Biomedical Technology (Dalian, China)

Infection rate in clinical samples

A total of 165 samples, including clinical intestine samples and feces samples were collected from China. Table 5 shows the total detection rate of the three viruses in all samples at 39.39 % (65/165), with BRV having the highest positivity rate of 11.5 % (19/165); BVDV-1 and BEV at 16.5 % (10/165), 30.9 % (51/165), respectively. The total rate of co-infection of the viruses was 11.5% (19/165). Two samples were positive for all three viruses, with an infection rate of 1.21 % (2/165), as shown in Figure 4.

Table 5. Infection rates from the clinical bovine stool samples

Virus	BRV	BVDV	BEV	Positive
Total infection rate	(19/165) 11.50%	(10/165) 16.5%	(51/165) 30.90%	(65/165) 39.39%
Single infection rate	( 7/165) 4.20%	( 5/165) 3%	(40/165) 24.20%	(52/165) 31.51%
Double infection rate	(10/165) 6%	( 3/165) 1.81%	( 9/165) 5.45%	(11/165) 6.60%
Triple infection rate	( 2/165) 1.20%	( 2/165) 1.21%	( 2/165) 1.20%	( 2/165) 1.20%
Co-infection rate	(12/165) 7.20%	( 5/165) 3.03%	(11/165) 6.60%	(19/165) 11.51%

Diarrhea caused by viruses poses a serious threat to the health of cattle [25]. The main clinical symptoms are diarrhea, production disorders, and huge economic losses to the breeding industry. However, before 2008, BRV and BEV were not reported in mainland China, and BVDV was often recognized as the main cause of diarrhea in clinical diagnosis [26]. With the gradual reporting and spread of new diarrhea viruses in China, the clinical detection methods of bovine viral diarrhea need to be updated. At present, the commonly used detection assays are classified into antigen and antibody detection [27]. However, this method is only suitable for identifying infection by a single pathogen and is time-consuming [28, 29]. As bovine diarrhea disease is mainly caused by the co-infection of multiple pathogens, it is urgent to develop a rapid and convenient detection method to simultaneously identify the pathogens causing bovine diarrhea. So far, several detection methods have been developed for the bovine diarrhea diagnosis. Liu et al. developed a recombinase polymerase amplification method for rapid detection of bovine rotavirus. This method has good specificity and sensitivity, and the detection limit is 1.4×10¹copies/μL [30]. Niroshan Thanthrige-Don et al. developed a novel multiplex PCR electronic microarray assay for rapid and simultaneous detection of bovine respiratory and intestinal pathogens. These assays showed high analytical sensitivity and specificity and were validated using a limited number of clinical samples [23]. The prevalence of these three viruses is increasing annually and the risk of mixed infection is also increasing year by year [31]. The sort of three diseases are the key pathogens of diarrheal diseases in clinical production and clinical signs caused by different pathogens can be similar and these viruses have a high probability of mixed infection with high pathogenicity [32]. In recent years, fqPCR and RT-PCR methods have been developed for the detection of BRV, BVDV-1, and BEV [25, 33–35]. Nevertheless, a method for simultaneously detecting all three viruses is lacking, underscoring the need for updated detection methods for these related viruses.

In this study, primers and probes that could specifically recognize the desired pathogens were designed based on the highly conserved regions. Three pairs of primer-probe sets can be added to one tube system, thus allowing three pathogens to be simultaneously detected in one reaction. Remarkably, the assay has good specificity and no cross-reactivity with common viral pathogens. A total of 165 clinical samples of diarrhea were collected. Among the positive samples detected, the infection rate of BEV was the highest, while the prevalence of BVDV was relatively low. Our observations were consistent with previous reports. Due to the sampling season and sampling method, the positive rate may be affected. The high incidence of respiratory diseases mainly occurs in the spring [36], and the clinical samples used in this study were collected in autumn in central China. Due to the limited sample size, further investigation is needed to verify the observed results.

A multiplex fqPCR assay capable of simultaneously detecting BRV, BVDV-1, and BEV was successfully established in this study. The method showed good specificity, sensitivity, and reproducibility, with no cross-reactivity with common pathogens. The clinical samples were from farms in China collected from 2021 to 2022. The specific age and type of bovine were unclear and an accurate statistical analysis could not be conducted. On the contrary, we collected the infection status data of three viruses in diarrhea cattle feces, and the infection rates of three viruses in diarrhea cattle were briefly counted and described. More detailed statistical analysis and description warrant further study. Compared with the previous epidemiological report, the infection rate has a rising trend. These data underscore the need to respond promptly.

Ethics approval and consent to participate

Not applicable. Diarrhea cattles were involved in this study, but no experimental procedures were performed on it, and the sampling process did not harm the cattle. The collection of samples is carried out by technical personnel and sent to the laboratory for unified testing. The focus of the article is on the establishment of PCR methods.

Consent for publication

All authors have read and agreed to the published version of the manuscript.

Availability of data and materials

The authors confirm that the data supporting the findings of this study are available within the article [and/or its supplementary materials]

Funding

The Pig Industry Technology System Innovation Team Project of Henan Province (HARS-22-12-T)

Authors' contributions

Conceptualization, Ruoqian Yan. and Taisheng Kang.; methodology,Taisheng Kang. and Pan Tang.; soft-ware,Pan Tang.; validation, Dongfang Wang.Ying Liu and Xueli Zhao.; formal analysis, Guidan Feng. and Jianhao Zhou.; writing—original draft preparation, Taisheng Kang. and Caihua Xie.; writing—review and editing, Zhenyuan Ma. and Shujuan Wang.; visualization, Yufeng Hu.; Bowen Li.;

Acknowledgments

We thank laboratory staff for their technical expertise and assistance in samples collection and testing of feces samples. All authors have approved the content and have contributed significantly to the work .

Competing interests

NO applicable.

Yue X, Steeneveld W, van der Voort M, van Schaik G, Vernooij JCM, van Duijn L, et al. The effect of bovine viral diarrhea virus introduction on milk production of Dutch dairy herds. J Dairy Sci. 2021;104:2074–86.
Brodersen BW. Bovine viral diarrhea virus infections: manifestations of infection and recent advances in understanding pathogenesis and control. Vet Pathol. 2014;51:453–64.
Ellis J, Erickson N, Gow S, West K, Lacoste S, Godson D. Infection of calves with in-vivo passaged bovine parainfluenza-3 virus, alone or in combination with bovine respiratory syncytial virus and bovine coronavirus. Can J Vet Res. 2020;84:163–71.
Smyth M, Tate J, Hoey E, Lyons C, Martin S, Stuart D. Implications for viral uncoating from the structure of bovine enterovirus. Nat Struct Biol. 1995;2:224–31.
Chen S, Zhang W, Zhai J, Chen X, Qi Y. Prevalence of bovine rotavirus among cattle in mainland China: A meta-analysis. Microb Pathog. 2022;170:105727.
Gomez-Romero N, Ridpath JF, Basurto-Alcantara FJ, Verdugo-Rodriguez A. Bovine Viral Diarrhea Virus in Cattle From Mexico: Current Status. Front Vet Sci. 2021;8:673577.
de Barros B de CV, Chagas EN, Bezerra LW, Ribeiro LG, Duarte Júnior JWB, Pereira D, et al. Correction: Rotavirus A in wild and domestic animals from areas with environmental degradation in the Brazilian Amazon. PLoS One. 2019;14:e0211311.
Wang M, Yan Y, Wang R, Wang L, Zhou H, Li Y, et al. Simultaneous Detection of Bovine Rotavirus, Bovine Parvovirus, and Bovine Viral Diarrhea Virus Using a Gold Nanoparticle-Assisted PCR Assay With a Dual-Priming Oligonucleotide System. Front Microbiol. 2019;10:2884.
Flewett TH, Woode GN. The rotaviruses. Arch Virol. 1978;57:1–23.
Rocha TG, Silva FDF, Gregori F, Alfieri AA, Buzinaro M da G, Fagliari JJ. Longitudinal study of bovine rotavirus group A in newborn calves from vaccinated and unvaccinated dairy herds. Trop Anim Health Prod. 2017;49:783–90.
Dennehy PH. Transmission of rotavirus and other enteric pathogens in the home. Pediatr Infect Dis J. 2000;19 10 Suppl:S103-105.
Björkman C, Svensson C, Christensson B, de Verdier K. Cryptosporidium parvum and Giardia intestinalis in Calf Diarrhoea in Sweden. Acta Vet Scand. 2003;44:145–52.
Geletu US, Usmael MA, Bari FD. Rotavirus in Calves and Its Zoonotic Importance. Vet Med Int. 2021;2021:6639701.
Radostits OM, Littlejohns IR. New concepts in the pathogenesis, diagnosis and control of diseases caused by the bovine viral diarrhea virus. Can Vet J. 1988;29:513–28.
Tajima M. Prevalence of Bovine Viral Diarrhea Virus Infection in Japan: 2000–2019. Front Vet Sci. 2021;8:667933.
Dall Agnol AM, Lorenzetti E, Leme RA, Ladeia WA, Mainardi RM, Bernardi A, et al. Severe outbreak of bovine neonatal diarrhea in a dairy calf rearing unit with multifactorial etiology. Braz J Microbiol. 2021;52:2547–53.
Diao N-C, Gong Q-L, Li J-M, Zhao D, Li D, Zhao B, et al. Prevalence of bovine viral diarrhea virus (BVDV) in yaks between 1987 and 2019 in mainland China: A systematic review and meta-analysis. Microb Pathog. 2020;144:104185.
Ren X, Zhang S, Gao X, Guo X, Xin T, Zhu H, et al. Experimental immunization of mice with a recombinant bovine enterovirus vaccine expressing BVDV E0 protein elicits a long-lasting serologic response. Virol J. 2020;17:88.
Knowles NJ, Barnett IT. A serological classification of bovine enteroviruses. Arch Virol. 1985;83:141–55.
Zhu L, Xing Z, Gai X, Li S, San Z, Wang X. Identification of a Novel Enterovirus E Isolates HY12 from Cattle with Severe Respiratory and Enteric Diseases. PLoS One. 2014;9:e97730.
McClenahan SD, Scherba G, Borst L, Fredrickson RL, Krause PR, Uhlenhaut C. Discovery of a bovine enterovirus in alpaca. PLoS One. 2013;8:e68777.
Mari V, Losurdo M, Lucente MS, Lorusso E, Elia G, Martella V, et al. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus. J Virol Methods. 2016;229:1–7.
Thanthrige-Don N, Lung O, Furukawa-Stoffer T, Buchanan C, Joseph T, Godson DL, et al. A novel multiplex PCR-electronic microarray assay for rapid and simultaneous detection of bovine respiratory and enteric pathogens. J Virol Methods. 2018;261:51–62.
Maksyutov RA, Gavrilova EV, Shchelkunov SN. Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay. J Virol Methods. 2016;236:215–20.
Cho Y-I, Yoon K-J. An overview of calf diarrhea - infectious etiology, diagnosis, and intervention. J Vet Sci. 2014;15:1–17.
Newcomer BW. 75 years of bovine viral diarrhea virus: Current status and future applications of the use of directed antivirals. Antiviral Res. 2021;196:105205.
Basera SS, Singh R, Vaid N, Sharma K, Chakravarti S, Malik YPS. Detection of Rotavirus Infection in Bovine Calves by RNA-PAGE and RT-PCR. Indian J Virol. 2010;21:144–7.
Asano KM, de Souza SP, de Barros IN, Ayres GR, Silva SOS, Richtzenhain LJ, et al. Multiplex semi-nested RT-PCR with exogenous internal control for simultaneous detection of bovine coronavirus and group A rotavirus. J Virol Methods. 2010;169:375–9.
Jiménez-Clavero MA, Escribano-Romero E, Mansilla C, Gómez N, Córdoba L, Roblas N, et al. Survey of bovine enterovirus in biological and environmental samples by a highly sensitive real-time reverse transcription-PCR. Appl Environ Microbiol. 2005;71:3536–43.
Liu Y, Liu L, Wang J, Sun X, Gao Y, Yuan W, et al. Rapid detection of bovine rotavirus a by isothermal reverse transcription recombinase polymerase amplification assays. BMC Vet Res. 2022;18:339.
Gomez DE, Weese JS. Viral enteritis in calves. Can Vet J. 2017;58:1267–74.
Cho Y-I, Han J-I, Wang C, Cooper V, Schwartz K, Engelken T, et al. Case–control study of microbiological etiology associated with calf diarrhea. Vet Microbiol. 2013;166:375–85.
Gür S, Yapkiç O, Yilmaz A. Serological survey of bovine enterovirus type 1 in different mammalian species in Turkey. Zoonoses Public Health. 2008;55:106–11.
Komoto S, Adah MI, Ide T, Yoshikawa T, Taniguchi K. Whole genomic analysis of human and bovine G8P[1] rotavirus strains isolated in Nigeria provides evidence for direct bovine-to-human interspecies transmission. Infection, Genetics and Evolution. 2016;43:424–33.
Quaye O, McDonald S, Esona MD, Lyde FC, Mijatovic-Rustempasic S, Roy S, et al. Rotavirus G9P[4] in 3 countries in Latin America, 2009-2010. Emerg Infect Dis. 2013;19:1332–3.
Guo T, Zhang J, Chen X, Wei X, Wu C, Cui Q, et al. Investigation of viral pathogens in cattle with bovine respiratory disease complex in Inner Mongolia, China. Microb Pathog. 2021;153:104594.

No competing interests reported.

Development of a TaqMan-Probe-based multiplex real-time fluorescence quantitative PCR for simultaneous detection of three bovine diarrhea- associated viruses

Status:

Version 1

Abstract

Background

Result

Conclusion

Figures

Introduction

Material and Methods

Results

Discussion and conclusions

Declarations

References

Additional Declarations

Status:

Version 1