Cytotoxic effects of dimethyl-celecoxib (DMC) on bone tumor cell line MG63 and cell line HEK293

doi:10.21203/rs.3.rs-2999359/v1

Download PDF

Research Article

Cytotoxic effects of dimethyl-celecoxib (DMC) on bone tumor cell line MG63 and cell line HEK293

https://doi.org/10.21203/rs.3.rs-2999359/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Dimethyl-celecoxib (DMC), is a celecoxib (CXB) derivative has no inhibitory function on cyclooxygenase-2 (COX-2) and displays antitumor properties. This substance can be helpful in advancing the treatment of COX-2-indipentent cancers. In the current study, we assayed the efficacy of DMC on MG63 bone tumor cell line and Human embryonic kidney (HEK293) cell line. The cellular viability, nitrogen monoxide content, and Inducible nitric oxide synthases (iNOS) gene expression were measured respectively with MTT (The MTT assay is a colorimetric assay for assessing cell metabolic activity.) Griess reaction, and real-time Reverse transcription polymerase chain reaction (RT-PCR) procedures .IC50 was determined by MTT assay, and iNOS gene expression was evaluated by RT-PCR. Also, monoxide nitrogen production was monitored by a Griess test and finally one-way Anova (Analysis of Variance (ANOVA) is a statistical formula used to compare variances across the means (or average) of different groups.) and T-test were used to analyze the data. Results showed that Dimethylcelloxib at concentrations of: 62.5, 125, 250, 500 µg /ml at 48 h significantly decreased the survival rate of MG63 and HEK293 tumor cells (P < 0.001). It was found that iNOS gene expression decreased significantly (P < 0.001) and production of monoxide nitrogen molecule had a significant increase (P < 0.01 and P < 0.001). since Dimethylceloxib reduced iNOS gene expression, it was expected to decrease nitrogen monoxide, but this drug showed its cytotoxic effects through increased nitrogen monoxide production.

In recent years, physicians have witnessed a remarkable shift in the connection between cancer and bone in bone metastasis incidence. Attempts have been led osteo oncology (Ibrahim et al. 2013). Thus, there is a great demand to detect novel therapeutic procedures for the treatment of bone cancer diseases. So far, effort has been made to identify the cancers regulators, leading to cyclooxygenase-2 (COX-2), acts as a key inflammatory regulator (Sobolewski et al. 2010). Over expresses in a variety of cancers, play a in tumor aggressiveness by contributing to the survival and proliferation of cancer cells (Wun et al. 2004). The distinct suppressors for COX-2 including the “coxib” family are known as potent candidates for various cancer treatment (Sobolewski et al. 2010). The suppressors also can sensitize tumors to photodynamic therapy, radiotherapy, or chemotherapy (Cao et al. 2002). Despite these favorable impacts, the chronic application of the suppressors has been shown to be related to acute side effects, such as enhanced risks of myocardial or stroke infarction and gastric ulcers (Ortiz 2004). Furthermore, antitumor features of the suppressors do not necessarily depend on cyclooxygenase-2 (Schönthal .2006). Taken all together, these data suggest the precaution has to be taken for chronic application of cyclooxygenase-2 in the treatment of various cancers such as bone cancers diseases. Non coxib celecoxib analogs such as 2,5-dimethyl-celecoxib (DMC) present the promising approaches for cancers therapy with any generic side effect (Schönthal .2006). A variety of researches revealed that DMC decreases the growth of cancer cells more effectively than COX-2 suppressors (Jenilyn et al. 2010). These anticancer attributes are related to blockage of tumor angiogenesis and invasion, cell cycle changes, as well as apoptosis induction (Zhang et al. 2007). The apoptosis induction has been documented to be related to AKT (protein kinase B)/PI3K signaling suppression and survival signaling downstream paths (kB nuclear factor) (Fresno et al.2004), and more recently, to endoplasmic reticulum stress, displaying that DMC induces apoptosis by various mechanisms (Schönthal et al. 2006). The mitochondrial incidents occurring within apoptosis process depend on the Bax as well as Bak proapoptotic proteins activation, which could be hindered by heterodimerization with antiapoptotic proteins including Bcl-xL and Bcl-2 (Ortiz 2004). DMC can decline the expression of Bcl-2gene (Liu et al. 2013).

Only a few researches have been carried out for figuring out this efficacy, but it seems that 2,5-dimethyl-celecoxib results in downregulation of cyclin B and A (Zhang et al.2007), which are known as key regulators in the process of G2/M transition.

Notably, NOS molecule is one of the molecules involved in the inflammation process that contains the three isoforms iNOS, Endothelial NOS (eNOS) and Neuronal nitric oxide synthase(nNOS). eNOS and nNOS are expressed in epithelial cells and neurons, respectively, and are calcium-dependent whereas iNOS is produced by different cells and is independent of NO (Carey et al. 2016). Given the documented cytotoxic effects in the previous studies, we evaluated the efficacy of DMC on MG63 bone tumor cell line and HEK293 normal cell line. In this regard, the cellular viability, nitrogen monoxide content, and nitric oxide synthases (iNOS) gene expression were measured respectively with MTT, Griess reaction, and real-time RT-PCR procedures.

Cell Culture and Reagents

The bone tumor cell line MG63 and normal cell line HEK293 came from Cell Bank of the Pasteur Institute of Iran. These cell lines were cultured in medium RPMI 1640 completed with2 mM L-glutamine (Gibco-Invitrogen), 10% (v/v) fetal calf serum (Gibco-Invitrogen), and 1% (v/v) antibiotic-antimycotic solution, in a humidified atmosphere at 5% CO₂ and 37°C.Dimethyl-celecoxib (DMC) was obtained from Aminsan and dissolved at 20mM in 100% dimethyl sulfoxide (Sigma). Trypsin and BSA were purchased from Sigma.

MTT assay

Cytotoxic effect of Dimethyl-celecoxib (DMC) on bone tumor cell line MG63 and normal cell line HEK293 was assayed via MTT test, the mechanism of which is reduction of MTT salt to formazan crystal via mitochondrial dehydrogenases in live cells (Hazary et al., 2001). The outcome of this activity is the formation of soluble crystals of purple formazan soluble in dimethyl sulfoxide (DMSO). For optimizing the concentration of DMC in the culture medium, the bone tumor cell line MG63 and normal cell line HEK293 were exposed with a serial dilution of DMC (500 to 1500µM) along with 0.1% dimethyl sulfoxide for seven consecutive days. After 240 min of incubation at 37°C, 100 ml of dimethyl sulfoxide was incorporated and then the optical density (OD) of each well was registered via a micro-plate reader (Bio-Rad, Hercules.CA) at 570 nm. Finally, the percentage of cell death was calculated as follows: The percentage of cell death is calculated as follows(A-B)/A*100(Hazary et al., 2001), where, A is the negative control OD, and B is the sample OD after DMC was treated (Bigdeli et al. 2019).

Quantitative real-time RT-PCR

The mRNA level of iNOS in the studied samples was estimated using qRT-PCR technique (Kunwar et al., 2016). Briefly, total RNA was extracted from the studied samples through Trizol reagent and then dissolved in water containing diethyl pyro carbonate (DEPC) based on the instructions of the manufacturer. Then, cDNA was synthesized from 2µg of RNA and qRT-PCR was performed using ABI 7300 qRT-PCR apparatus (Applied Biosystem foster city). The PCR was set up through mixing 10µl of SYBR green PCR 10X master mix, 1 µl of cDNA,1 µM from each of reverse and forward primers (Table 1), as well as PCR-grade water in 20 µl reaction volume. The amplification process was carried out according to the following steps: step 1-denaturation for 4 min at 94°C; step 2- denaturation for 30 s at 94°C; step 3- annealing for 40 s at 60°; step 4- extension for 30 s at 72°C and step 5- analysis of melting curve. Steps 2–4 were repeated for forty cycles. Amplifications were carried out in triplicate for each gene. The specificity of the respective amplicon was verified via analysis of its melting curve. The standards of threshold cycle resulted from the above runs were utilized to measure the expression fold change of the studied genes through REST384 software Ver. 2.0. Normalization of gene expression was performed versus the house-keeping gene β-actin and then plotted as relative expression change as for the control (Bigdeli et al. 2019).

Table 1

The list of used primers.
primers	Forward (5′ − 3′)	Reverse (5′ − 3′)
iNOS	GTGCCCTGCTTTGTGCG	TCCTCCTGGTAGATGTGGTCCT
GAPDH	CCCACTCCTCCACCTTTGAC	CATACCAGGAAATGAGCTTGACAA

Nitric oxide assay

Nitric oxide assay was performed by using Griess reaction (Sun et al., 2003). To measure the concentration of nitrite and total nitrate (NOx), 100 µL of serum was deproteinized and then 100 µL of vanadium chloride (III) (8 mg/ml) was added to convert the nitrates to nitrite. Then 100 µL of mixture (1 to 1) of sulfonamide and naphthyl ethylenediamine dihydrochloride (NEDD) was incorporated and incubated for 30 min at 37°C. After reaction and dye formation, light absorption from dye material was read at 540 nm by ELISA reader and the concentration of samples was estimated using standard curve (Nathan et al.2007).

Statistical Analysis

Statistical analyses in the current study were carried out through the student’s t-test. Furthermore, P values < 0.05 was taken into consideration as significant differences.

To investigate the cytotoxic effects of 2,5-Dimethyl-celecoxib (DMC) on MG63 tumor cell line, the different concentrations of DMC were prepared and exposed to the cells for 48 hours. In terms of MG63 tumor cell line, statistical analysis showed that DMC at 500, 250, 125, 62.5, 31.25, 15.625, and7.8125mg/l concentrations for 48 h reduced cell viability compared to the control group by 26.96, 25.26, 25.86, 26.42, 93.68, and 88.03 µg/ml, respectively. The difference was significant at 500, 250, 125, and 62.5 mg/l concentrations (P < 0.001) (Fig. 1) .

According to nonlinear regression and excel software, the IC50 of DMC was determined as 40.7 mg/ml for MG63 tumor cell line. In term of HEK cell line, it was appeared that DMC at 500, 250, 125, 62.5, 31.25, 15.625, and 7.8125 mg/l concentrations for 48 h decreased the cell viability when compared to the control group by 4.6, 5.1, 5.5, 8.4, 96.1, and 105.1, respectively. There was a significant difference at 500, 250, 125, and 62.5 mg/l concentrations (P < 0.001) (Fig. 2).

Based on the nonlinear regression and excel software, the IC50 of DMC was determined as 46.8 mg/ml for HEK cell line. To evaluate the effects of DMC on iNOS expression in MG63 bone tumor cell line and HEK normal cell line, they were treated with IC50 DMC and then the change in iNOS expression was determined. The results of the evaluation of iNOS expression on the MG63 cell line treated with DMC compared to the control group are shown in Fig. 3. Statistical analysis showed that iNOS expression was significantly decreased in MG63 cells treated with DMC compared with the control group (P < 0.001).

The results of one-way ANOVA analysis showed that the amount of nitric oxide produced in the supernatant of MG63 cells treated with IC50 dose of DMC [40.7 mg/ml] significantly increased as compared with the control group (Fig. 4) .

Furthermore, the NO amount in the supernatant of HEK cells treated with IC50 dose of DMC [40.7 mg/ml] remarkably rose in contrast to the control group (Fig. 5) .

Celecoxib (CXB) appears to be special among the category of COX2 suppressors (coxibs), as this specific combination applies another role that is autonomous of its famous capability for COX-2 inhibition. The second role is the ability to stimulate cell death and hinder cell proliferation at a much lower concentration than any other selective COX-2 inhibitors. Interestingly, these two roles are controlled through various moieties of CXB molecule and could be segregated (Schönthal .2006) One derivative, 2,5-dimethyl-celecoxib (DMC), which maintains the apoptosis-inducing and anti-proliferative roles, but totally losses the inhibitory function of COX-2, can mimic all of the antitumor efficacies of CXB that have been assayed so far, such as tumor growth inhibition and neovascularization reduction and in different tumor models in vivo and in vitro (Schönthal et al .2008) Regarding the life-threatening side effect of CXB, it can be advantageous to follow the potential advantages of derivatives including DMC for the treatment of anticancer diseases. It is necessary to mention that DMC can be beneficial in the administration of COX-2- independent tumors because of DMC has not inhibitory function coxib, yet potently retains the anticancer property of CXBs (Schönthal .2006) .

In the current study, DMC was appeared potent in impeding the growth of MG63 tumor bone cells (half maximal inhibitory concentration (IC50): 40.7 mg/ml at 48 h (Zhou et al .2015). Demonstrating that at a limited area of concentrations (0–80 µg/ml), CXB significantly hindered the cell proliferation of MG-63 cell line in a concentration- and time-dependent fashion. The IC50 dose of CXB was ~ 19 and ~ 48 µg/ml for 48 h and 24 h-treatment, respectively. The expression of iNOS gene was significantly decreased in MG63 cell line treated with DMC in comparison with the control group (P < 0.001). Niederberg et al Suggested that iNOS expression slightly enhanced at 200 mg/kg concentration of CXB (Niederberger et al .2001). In their study, the effect of this compound on iNOS gene expression in rats was similar to the one being detected in cell culture, proposing that the mechanisms detected in vitro also has been taken place in vivo. Furthermore, the amount of nitric oxide in the supernatant of MG63 cell line treated with DMC increased significantly when compared to the control group (P < 0.001). Our findings propose that DMC may exert at least part of its anticancer efficacies through down-regulation of iNOS gene and increase nitric oxide content. The mechanism underlying this phenomenon can be explained by the cytotoxic ability of DMC for enhancing the NO production and subsequently the DNA fragmentation through NOs invasion.

In the previous efforts, the mechanisms involved in cytotoxic effects of CXB and its derivatives on cancer cells, Zhou et al., (2015) observed that CXB hinders the proliferation of MG-63 cell line via apoptosis induction and S-phase arrest. CXB-induced RECK up-regulation and MMP-9 and MMP-2 down-regulation were suggested to be associated with the local tumor microenvironment alteration and apoptosis induction. Thus, the authors proposed that CXB can up-regulate RECK to hinder the MMP-9 and MMP-2 expression, and thereby exert at least in part of its anticancer efficacies (Zhou et al .2015). In a similar probe, Liu et al., (2008) treated MG-63 cells with CXB for 48 h in a medium supplemented with serum. They observed that CXB significantly inhibits cell growth through controlling G1 phase in a dose‐dependent way, inducing the apoptotic changes such as apoptotic bodies, DNA fragments, down regulating Bcl‐2, surviving, Akt/PI3K, procaspase‐3 and procaspase‐9. As a result, the authors proposed that CXB applies its anti‐tumor properties via COX‐2‐independent mechanisms, which may be Bcl‐2 and survive in ‐related and Akt /PI3K‐dependent in addition, PI3K may be at the center of the CXB functions, which plays an important role in the Bcl‐2 and surviving in regulation (Liu et al .2008 ). Nevertheless, further research is required to the light the exact mechanism underlying cytotoxic consequences of DMC compound on cancer cells.

Considering the life-threatening side effect of CXB, it can be advantageous to follow the potential benefits of derivatives including DMC for anticancer disease therapy (Sobolewski et al .2010). It is important to mention that DMC can potentially be beneficial in the treatment of COX-2- independent tumors because of DMC being not a coxib yet retains the anticancer property of CXBs. The outcome of the current study proposes that DMC has some anticancer properties through a decrease in Nitric oxide synthases gene expression and an increase in nitric oxide content. The mechanism underlying this phenomenon could be elucidated through the cytotoxic capability of DMC for elevating nitric oxide production and thereby the DNA fragmentation by nitric oxidase radicals. However, further investigations are required to reveal the exact mechanism involved in the cytotoxic effects of DMC on cancer cells.

FUNDING

This project did not have any funding or grant from any Institution and also no conflict of interest.

ACKNOWLEDGEMENT

The authors are grateful to all participants of the study. We are also thankful to Zistfanavari Javid Company specially Dr. Askari and Miss Bigdeli assistance.

CONFLICT OF INTEREST:

The Authors declare that they have no conflict of interests.

Bigdeli R, Shahnazari M, Panahnejad E, Ahangari R, Dashbolaghi A, Asgari V (2019) Cytotoxic & apoptotic properties of silver cloride nanoparticles synthesized using escherichia coli cell-free supernatant on human breast cancer, MCF7 cell line. Artif Cells Nanomed Biotechnol 47(1):1603-1609. https://doi.org/10.1080/21691401.2019.1604533
Cao Y, and Prescott SM (2002) Many actions of cyclooxygenase-2 in cellular dynamics and in cancer. J Cell Physiol. 190:279–286. https://doi.org/10.1002/jcp.10068
Carey RM, Chen B, Adappa ND, Palmer JN, Kennedy DW, Lee RJ,Cohen NA (2016) Human upper airway epithelium produces nitric oxide in response to staphylococcus epidermidis . Int Forum Allergy Rhinol 1238-44. https://doi.org/10.1002/alr.21837
Fresno Vara JA, Casado E, Castro J, Cejas P, Belda-Iniesta C, González- Barón M (2004) PI3K/Akt signaling pathway and cancer. Cancer Treat Rev 30(2):193-204. https://doi.org/10.1016/j.ctrv.2003.07.007
Hazary RC, Chaudhuri D, Wishart GJ (2001) Application of an MTT reduction assay for assessing sperm quality and predicting fertilizing ability of domestic fowl semen. Br Poult Sci 42:115–117. https://doi.org/10.1080/713655009
Ibrahim T, Mercatali L, Amadori D (2013) Bone and cancer: the osteo oncology. Clin Cases Miner Bone Metab 10: 121–123. http://PMID.org/24133529 .
Jenilyn J. Virrey, Zhi L, Cho H-Y, Kardosh A, Encouse B, Stan G, Kevin J. Gaffney, Nicos A. Petasis, Axel H. Schönthal, Thomas C and Florence M (2010) Antiangiogenic activities of 2,5-dimethylcelecoxib on the tumor vasculature. Mol Cancer Ther 9:631–641. https://doi.org/10.1158/1535-7163.MCT-09-0652
Kunwar A, Jayakumar S, Bhilwade HN, Bag PP, Bhatt H., Chaubey RC, Priyadarsini KI (2016) Protective effects of selenocystine against gamma-radiation-induced geno-toxicity in Swiss albino mice. Radiat Environ Biophys 50:271–280. https://doi.org/10.1007/s00411-011-0352-2
Liu B, li-Shi Z, Feng J, Tao H (2008) ‏Celecoxib, a cyclooxygenase‐2 inhibitor, induces apoptosis in human osteosarcoma cell line MG‐63 via down‐regulation of PI3K/Akt. Cell biology international 32(5):494-501. https://doi.org/10.1016/j.cellbi.2007.10.008
Liu J, Qin CK, Lv W, Zhao Q, Qin CY (2013) OSU-03012, a non-Cox inhibiting celecox derivative, induces apoptosis of human esophageal carcinoma cells through a p53/Bax/cytochrome c/caspase-9-dependent pathway. Anticancer Drugs 24(7):p 690-698 . https://doi.org/10.1097/CAD.0b013e328362469f
Nathan S. Bryan and Matthew B. Grisham (2007) Methods to Detect Nitric Oxide and its Metabolites in Biological Samples. Published in final edited form as Free Radic Biol Med 43(5):645-657. https://doi.org/10.1016/j.freeradbiomed.2007.04.026
Niederberger E, Tegeder I, Vetter G, Schmidtko A, Schmidt H, Euchenhofer C, Bräutigam L, Grösch S, Geisslinger G (2001) Celecoxib loses its anti-inflammatory efficacy at high doses through activation of NF-kappaB. FASEB J 15: 16-20. https://doi.org/10.1096/fj.00-0716fje
Ortiz E (2004) Market withdrawal of Vioxx: is it time to rethink the use of COX-2 inhibitors? J Manag Care Pharm 10: 551–554. https://doi.org/10.18553/jmcp.2004.10.6.551
Schönthal AH (2006) Anti-tumor properties of dimethyl-celecoxib, a derivative of celecoxib that does not inhibit cyclooxygenase-2, implications for glioma therapy. Neurosurg Focus 20: E21. https://doi.org/10.3171/foc.2006.20.4.14
Schönthal AH, Chen TC, Hofman FM, Louie SG, Petasis NA (2008) Celecoxib analogs that lack COX-2 inhibitory function, preclinical development of novel anticancer drugs. Expert Opin Investig Drugs 17:197-208. https://doi.org/10.1517/13543784.17.2.197
Sobolewski C, Cerella C, Dicato M, Ghibelli L, Diederich M (2010) The role of cyclooxygenase-2 in cell Proliferation and cell death in human malignancies. Int J Cell Biol 215158. https://doi.org/10.1155/2010/215158
Sun J.Zhang X, Broderick M, Fein H (2003) Measurement of nitric oxide production in biological systems by using Griess reaction assay . Sensors 3:278-84. https://doi.org/10.3390/s30800276
Vannini F, Kashfi K, Nathb N (2015) The dual role of iNos in cancer. Redox Biol 6: 334–343. https://doi.org/10.1016/j.redox.2015.08.009
Wun T, McKnight H, Tuscano JM (2004) Increased cyclooxygenase-2 (COX-2): a potential role in the Pathogenesis of lymphoma. Leuk Res 28:179–190. https://doi.org/10.1016/S0145-2126(03)00183-8
Zhang S, Suvannasankha A, Crean CD, White VL, Johnson A, Chen CS, Faras SS (2007) OSU-03012, a novel celecoxib derivative, is cytotoxic to myeloma cells and acts through multiple mechanisms. Clin Cancer Res 13:4750–4758. https://doi.org/10.1158/1078-0432.CCR-07-0136
Zhou X, Shi X, Ren K, Fan GT, Wu SJ, Zhao JN (2015)‏ Celecoxib inhibits cell growth and modulates the expression of matrix metalloproteinase in human osteosarcoma MG-63 cell line . Eur Rev Med Pharmacol Sci 19: 4087-4097 . http://PMID.org/26592832 .

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Cytotoxic effects of dimethyl-celecoxib (DMC) on bone tumor cell line MG63 and cell line HEK293

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Cell Culture and Reagents

MTT assay

Quantitative real-time RT-PCR

Nitric oxide assay

Statistical Analysis

RESULTS

DISCUSSION

CONCLUSION

Declarations

References

Additional Declarations

Status:

Version 1