Tissue samples
In this study, tumor tissues were obtained from 67 glioma patients, and non-neoplastic brain samples were obtained from 7 traumatic brain injury patients at the Department of Neurosurgery of The first affiliated Hospital of Wannan Medical College from February 2014 to October 2017. Two pathologists evaluated all specimens according to the World Health Organization (WHO) guidelines. No local or systemic treatments were administered to these patients before surgery. The tissues were immediately frozen in liquid nitrogen and stored at −80°C until use. All of the patients provided signed, informed consent before the use of these clinical materials for research purposes. The use of these archival tissues in this study was approved by the Ethics Committee of The first affiliated Hospital of Wannan Medical College.
Cell culture
Human U87MG and LN382 glioblastoma cell lines were obtained from ATCC (American Type Culture Collection, USA). All cell lines were routinely cultured at 37°C in a 5% CO2 humidified atmosphere in Dulbecco’s-modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS, Gibco).
Real-time RT-PCR
Total RNA was extracted from the transfected cells with TRIzol (Invitrogen) and 0.4μg RNA was used to synthesize cDNA using a first strand cDNA synthesis kit (Termo scientifc, USA). The RNA concentration was examined using a NanoDrop 2000 spectrophotometer (Termoscientifc, USA). Real-time RT-PCR analysis was performed using the CFX-96 (BioRad, USA) according to the manufacturer’s instructions. Data were normalized according to the level of GAPDH expression in each sample. GAPDH was used as an internal control, and 2-△△Ct values were used to assess the relative expression of the target gene. The primers of GAPDH were synthesized by RiBoBio (Guangzhou, China)
qRT-PCR primers for lncRNA SLC8A1-AS1 were as follows:
Forward 5’-3’: CAGTCGTGTTCGTCGCACTT
Reverse 5’-3’: GCTGCCCGTGACGTTACCTAT
Colony formation assay
For the colony formation assay, the cells were plated in 6-well plates at 2×102 cells per well and maintained in DMEM containing 10% FBS for 2 weeks. After 2 weeks, the cells were washed two times with PBS, fixed with methanol and stained with rystal violet at the end of the time course prior to the capture of the representative images via camera. The number of colonies was counted under a microscope. All experiments were performed in triplicate.
Cell cycle assay
Cell cycle analysis was performed by determining the DNA content with propidium iodide (PI) staining (BD Biosciences; San Jose, CA, USA). Briefly, U87MG and LN382 glioma cells were harvested, re-suspended and stained with propidium iodide (PI; BD Biosciences) in the presence of RNase A for 20 min. Cells were analysed using a flow cytometer (BD Biosciences) according to the manufacturer’s instructions.
Wound healing assay
Culture and transfection conditions for U87MG and LN382 cells were optimized to ensure a homogeneous and viable cell monolayer prior to wounding. One day before transfection, equal numbers of U87MG and LN382 cells (5.0×105) were seeded into 6-well tissue culture plates without antibiotics. Cells were then transfected with Noncontrol (100nM) and SLC8A1-AS1 siRNA (100 nM) using riboFECTTM CP RiBoBio (Guangzhou, China), respectively. When the cell confluence reached about 90 % at 24h post-transfection, an artificial homogenous wound was created onto the monolayer with a sterile plastic 200μL micropipette tip. After wounding, the debris was removed by washing the cells with serum-free medium. Migration of cells into the wound was observed at 0 and 24h, respectively. Cells that migrated into the wounded area or cells with extended protrusion from the border of the wound were visualized and photographed under an inverted microscope (Nikon Ti-u). Migration was quantified by counting the total number of cells that migrated toward the original wound field. A total of three areas were selected randomly from each well and the cells in three wells of each group were quantified in each experiment.
Invasion assay
Invasion assay was tested on the newer technique of real time migration monitoring using the CIM devices and the xCELLigence DP system (ACEA Biosciences, USA). Before experiment going on, Matrigel was coated on wells respectively. In this system, 8×103 treated either with siRNA SLC8A1-AS1 or Noncontrol, then seeded in the upper chamber in the normal culture medium of the respective cell line without FBS. This upper chamber was then placed on the lower part of the CIM-device containing growth medium supplemented with 10% FBS as an attractant. Invasion of the cells was followed over a time period of up to 120h by changes of the impedance signal in a CIM-plate (ACEA Bio) measured on the backside of the membrane and cell growth was monitored in a 16-well e-plate (ACEA Bio) as described for the xCELLigence DP system. Invasion assay was also tested by using Tumor Invasion System (BD BioCoat, BD, NJ) in matrigel coated 24-well inserts. A sample of 3×104 cells treated with Noncontrol or SLC8A1-AS1 siRNAs was placed on this system in DMEM-medium without FCS. The inserts were set into DMEM-medium with 10% FCS as an attractant. After 48 h, the cells were stained with 0.1% crystal violet for 30 min and observed under a light microscope.
Migration assay
Cell migration assay were performed by using the newer technique of real time migration monitoring using the CIM devices and the xCELLigence DP system (ACEA Bio). In this system, 8×103 cells treated either with siRNA SLC8A1-AS1 or Noncontrol, then seeded in the upper chamber in the normal culture medium of the respective cell line without FBS. This upper chamber was then placed on the lower part of the CIM-device containing growth medium supplemented with 10% FBS as an attractant. Migration of the cells was followed over a time period of up to 120h by changes of the impedance signal in a CIM-plate (ACEA Bio) measured on the backside of the membrane and cell growth was monitored in a 16-well e-plate (ACEA Bio) as described for the xCELLigence DP system. Cell migration assay was also tested by using Transwell insert chambers (8μm pore size, Corning, USA). A total of 3×104 concentration cells were seeded into the upper chambers in serum-free medium. The lower chamber of the Transwell was filled with 500μl culture media containing 10% FBS as a chemo-attractant. After the chambers were incubated at 37°C for 48 h, non-invaded cells on the top of the Transwell were scraped off with a cotton swab. Successfully migrated cells were fixed with 10% formalin. Then, they were stained with 0.1% crystal violet for 30 min and counted under a light microscope.
Western blot analysis
Cell lysates were prepared using sample buffer, laemmli (Sigma, USA) for protein extraction. Protein lysates were separated by 10% SDS-PAGE, transferred to 0.22-μm NC membranes (Milipore, USA) and incubated with antibody. β-actin was used as a control. Antibodies (1:1000) against claudin, vimentin, E-cadherin, N-cadherin, GSK-3β, phosphor GSK-3β, β-catenin , phosphor β-catenin were purchased from Abcam. β-actin (1:1000) were purchashed from Sigma. The band intensity was measured by densitometry using the Image J. The protein levels were normalized with that of β-actin. All experiments were repeated in triplicate, and the representative results were shown.
Statistical analysis
The SPSS 16.0 statistical analysis software was used for the statistical analysis of the experimental data. The significance of differences between groups was estimated by Student’s t-test. A p value less than 0.05 were considered significant.