Association of verbal and non-verbal theory of mind abilities with non-coding variants of OXTR in youth with autism spectrum disorder and typically developing individuals: a case-control study

doi:10.21203/rs.3.rs-3006245/v1

Download PDF

Research Article

Association of verbal and non-verbal theory of mind abilities with non-coding variants of OXTR in youth with autism spectrum disorder and typically developing individuals: a case-control study

https://doi.org/10.21203/rs.3.rs-3006245/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 08 Jan, 2024

Read the published version in BMC Psychiatry →

You are reading this latest preprint version

Background

The ability to attribute mental states to others is called theory of mind (ToM) and is a substantial component of social cognition. This ability is abnormally developed in individuals with autism spectrum disorder (ASD). Several studies over the past decade have identified the oxytocin receptor gene (OXTR) and its variants as promising components for explaining the molecular mechanisms underlying Theory of Mind (ToM). The main aim of this study is to examine the association between rs2268498 and rs53576, two functional single nucleotide polymorphisms (SNPs), and verbal and non-verbal ToM in children and adolescents with ASD compared with a group of typically developing youth.

Methods

The study involved 44 children and adolescents with high-functioning ASD aged 8 to 18 years old and 44 TD individuals who were matched on age and sex. In all participants, blood samples were collected and rs2268498 and rs53576 were genotyped. Happe's Strange Stories test and the moving shapes paradigm were used to measure verbal and non-verbal ToM in all participants.

Results

the results of permutation tests and logistic regression suggested that in TD group, rs2268498 AA carriers showed significant higher scores in variables representing verbal ToM (ToM stories and appropriateness score) whereas, in ASD group, rs53576 AA carriers exhibited significant better performance in parameters related to non-verbal ToM (ToM general rule and intentionality score). The results of hierarchical clustering in both groups support the findings by distinguishing between language-related and language-independent aspects of ToM.

Conclusion

In the present study, we examined the association between rs2268498 and rs53576 and social functioning in individuals with ASD and TD group. We found preliminary evidence that rs2268498 and rs53576 are associated with ToM related abilities in healthy individuals as well as in autistic individuals. Accordingly, rs2268498 may play an important role in predicting ToM capabilities. It will be necessary to conduct further research to address the association of genetic variants with a deficit in ToM in individuals with ASD.

autism spectrum disorder

Theory of Mind

oxytocin receptor gene

rs2268498

rs53576

As far as social evolution is concerned, Homo sapiens is almost universally acknowledged as a highly social species capable of complex aspects of social functioning (1). Humans' ability to perceive social cues, motivation to interpersonal interactions, and maintaining relationships with others distinguishes them from other species, even the most closely related ones like chimpanzees (2–5). In order to achieve competency in social interaction, we need to have social cognition, social motivation, social awareness, and skills in maintaining relationship with others. Recently, social cognition has attracted more attention and been studied in greater depth due to its hierarchical and multidimensional nature (6). As a basic component of social cognition, Theory of Mind (ToM) is noteworthy. According to the definition of the ToM, it is the ability to attribute others’ behaviors to their mental states which are based on social stimuli (7). Impairment in ToM ability may result in neuropsychiatric symptoms, with autism spectrum disorder (ASD) standing out as a prominent example (8, 9). According to the Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5), ASD is characterized by repetitive behaviors/restricted interests, as well as social communication difficulties which reflects ToM dysfunction or “mindblindness” (8, 10).

While ASD is enigmatic in its etiology, there are several studies discovering endophenotypes relating to genetic markers of this disorder (11). In this regard, family and twin studies as well as genome wide association studies (GWAS) of human social behavior and social cognition have helped to clarify the heritability of these traits and the contribution of genetics to their development (12–15). In light of these findings, it has become increasingly apparent that oxytocin (OXT) plays a central role in many aspects of social behavior, including ToM which is impaired in some neuropsychiatric disorder including ASD (16–18). OXT is a 9-amino acid neuropeptide which is mediated through the OXT receptor (OXTR) (19, 20). Located on chromosome 3p25, the OXTR gene encodes the human OXTR protein-coupled receptor class I G, consisting of three introns and four exons. In addition to being primarily expressed in the reproductive system, OXTR expression can also be detected in several brain regions such as the frontal cortex, amygdala, hypothalamus, and olfactory nucleus (20–22). Therefore, it is not surprising that several single nucleotide polymorphisms (SNPs) within the coding, noncoding, and regulatory regions of OXTR have been associated with social cognition deficits as seen in ASD. A significant association between rs2254298 and rs53576 with autism in families has been found in Chinese Han population (23), Also a significant association between rs2268493, rs2254298, and rs53576 and high-function autism in Caucasian families (24, 25), sheds light on the potential association between OXTR SNPs and ASD. Additionally, some studies have stepped further and studied the association of OXTR SNPs with social endophenotypes underlying the autistic symptoms. In this regard, Yang et al. (2018) reported a significant association between rs2254298 and social deficit in ASD, while Skusea et al. (2014) found that rs237887 was significantly associated with human social recognition skills among individuals with ASD as well as individuals with first-degree relatives with ASD (26, 27).

In the context of different OXTR SNPs, rs2268498 and rs53576 appear to be two of the most promising candidate SNPs putatively associated with individual differences in social functioning. rs2268498 is a regulatory SNP located on 2 KB upstream of OXTR in promoter region. In 2017, Reuter et al. identified the significant association of rs2268498 G allele (AG, GG) with higher expression of OXTR in human hippocamp tissue and HEK-293 cell line (28). This study suggests that the rs2268498 genotype may contribute to the regulation of the OXT biological pathway by regulating the expression of OXTR in brain. Upon discovering this finding, further researches were conducted to determine whether the rs2268498 genotype was associated with social cognition manifestations. The effects of rs2268498 A allele on non-verbal social perception (29), facial emotion recognition (30) and empathic concern (31) are a few examples of how rs2268498 may influence social cognition. Furthermore, rs53576 is an intronic SNP which is located within intron 3. The location of rs53576 raises the possibility that rs53576 may also play a role in the regulation of OXTR expression. A significant association of rs53576 GG genotype with social auditory processing (32), different empathy domains in Asian and European populations (33), and higher attachment-related anxiety (34) support a possible association of rs53576 with social relationship.

With regard to the above studies, it appears that it has largely been neglected in attempts to examine higher levels and more complex characteristics of social cognition. One of the basic components of social cognition which has received relatively scant attention is ToM. To date, little research has been conducted on OXTR SNPs, including rs2268498 and rs53576, in association with some related aspects to ToM. For instance, little information is available regarding the association of rs53576 with the Reading Mind in the Eyes Test (RMET) and the false-belief task, both of which are known to be ToM tasks (35, 36). However, the missing link, which has not been addressed as it should, is language. Given that language plays an influential role in the development of ToM, it could be considered to be an important factor. Therefore, ToM capabilities can be categorized on the basis of their dependence or independence on verbal skills. Besides, most previous researches have focused on the associations between rs2268498 and rs53576, as well as other OXTR SNPs, and social cognition features in typically developing populations not ASD people. Thus, further investigations are required to bridge the gap between ToM and the molecular underlying mechanisms from the perspective of verbal abilities in both typically developing and ASD individuals.

Hence, the purpose of this study is to examine whether rs2268498 and rs53576 can be used to model verbal and non-verbal ToM abilities as well as other aspects of social functioning among typically developing children and adolescents compared to those with ASD.

An overall total of 88 unrelated volunteers participated in this study. Forty-four individuals with ASD and forty-four typically developing (TD) individuals were recruited in the study. ASD group consisted of 12 females and 32 males between the ages of 8 and 18. In the ASD group, participants were diagnosed as having autism spectrum disorder (mild to moderate ASD) by an expert child and adolescent psychiatrist at the Roozbeh psychiatry hospital outpatient clinic based on DSM-5 criteria. Individuals with ASD had no comorbid neuropsychiatric conditions (such as attention-deficit/hyperactivity disorder, bipolar disorder, depression, epilepsy, etc.), and Intelligence quotient (IQ) scores of 90 or higher at the time of participation. The TD group was composed of 18 females and 26 males of matched ages and sex. Parental reports indicated that the TD participants had no family or personal history of psychiatric conditions and a minimum IQ score of 90 was obtained by TD individuals. Participants in both the ASD and TD groups participated voluntarily, had Iranian ancestry, and at the time of the study did not have any diseases related to the immune system (cancer, autoimmune disorders, etc.).

Procedure

After informed consent was obtained from parents, participants were guided to a quiet room between 9:00 AM and 11:00 AM in order to complete the tasks. Moving shapes paradigm and Happé's Strange Stories tasks were selected as measures of non-verbal and verbal ToM, which were administered in a pseudorandom sequence. Each participant was administered Raven's progressive matrix test in order to determine their IQ level after completing the ToM tasks. A psychiatric examination interview was conducted with their parents based on the last six- month behaviors of the participants. Following the cognitive/ behavioral assessments, further molecular tests were conducted. The research has been approved by the Tehran University of Medical Sciences Research Ethics Committee, which is in compliance with the Helsinki declaration (IR.KHU.REC.1399.021).

Measurements

Cognitive and Behavioral measurements

In order to establish the diagnosis and severity of the symptoms parents of individuals with ASD were interviewed using the Childhood Autism Rating Scale (CARS). The CARS is comprised of 15 items that assesses ASD symptoms. Each item in CARS is scored between 1 (absence of abnormality) and 4 (severe abnormality). A cutoff point of 25.5 is considered to be indicative of a high-function ASD, and a score of 25.5 or higher is indicative of a preclinical diagnosis of mild ASD. All individuals in the ASD group achieved a CARS score of 25.5 or greater (37, 38).

An adapted version of the moving shapes paradigm (aka Frith-Happé animations) (39) and a formerly validated Happé's Strange Stories test (40) were used to examine the non-verbal and verbal ToM abilities of all participants. Each task was displayed on a 17-inch monitor while the responses were recorded. For the verbal ToM assessment, three blocks of unlinked, human, and ToM stories from Happé's Strange Stories test were utilized. Each block contains eight vignettes and each vignette is scored from 0 (irrelevant) to 2 (relevant/specific). A question was asked after each story about the characters' utterances and the main context in which they appeared. After the task was completed, participants received three scores, ranging from 0 to 16. The higher scores of strange stories test the better performance of the participant. Non-verbal ToM was measured using the moving shapes paradigm. The paradigm contains three blocks of random, goal-oriented, and ToM animations. Each block includes four short silent animations with two colored triangles as characters. The participants should accurately convey the storyline and describe the triangle's intention at the end of each animation. The following variables were derived from the participants’ responses: (1) general rule (GR) = Correctly describing the animation's intentions for each block (Random, Goal-directed, ToM), (2) intentionality score (IN) = to determine the ToM level of sophistication in the used words (3) appropriateness score (AP) = to retell the storyline in the correct sequence. A validation study of the moving shapes paradigm provides more details about the task.

rs2268498 and rs53576 genotyping

Genomic DNA was extracted from 0.5 ml of peripheral blood using Salting-out protocol. By UV-spectrophotometry, the quantity of extracted DNA was determined and the presence of a sharp and clear band, in line with the ladder one kb band, on 1% agarose gel electrophoresis gave an indication of DNA quality. DNA contamination with other chemical and biological components was also measured using the 260/280 and 260/230 ratios of absorbance. Both SNPs were genotyped utilizing restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) based on previous researches (41, 42). To digest both rs2268498 and rs53576, BslI (catalog number: #ER1201) and BamHI (catalog number: #FD0054) restriction enzymes were respectively employed, and primers were designed and checked for specify leveraging primer-blast's web-based platform (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). In the case of rs2268498, primers (forward: 5' TAGGCTGTCTCACGGGCTAC 3', reverse: 5' TCGGCCTCGAAAATTACAGA 3') were designed to anneal the DNA template at 58°C during 35 PCR cycles. The 448 bp PCR product was digested overnight at 37°C and digested product was run on 2% agarose gel electrophoresis for genotyping (AA: 266 bp,131 bp, 52 bp/ AG: 266 bp, 229 bp, 131 bp, 52 bp, 36 bp/ GG: 229 bp, 131 bp, 52 bp, 36 bp). Initially, the annealing temperature of primers for rs53576 (forward: 5' GCCCACCATGCTCTCCACATC 3', reverse: 5' GCTGGACTCAGGAGGAATAGGGAC 3') was 58°C (43). After 35 cycles of PCR, we obtained a 340 bp PCR product. A 30-minute digestion at 37°C was followed by 2% gel electrophoresis and genotyping (GG: 340 bp/ AA: 120 bp, 220 bp/ AG: 120 bp, 220 bp, 340 bp).

Statistical analysis

Statistical analyses were performed using the R programming language version 4.2.2 (R Core Team, 2022) in the RStudio environment in accordance with a 95% confidence interval (CI). Basic R commands and dplyr (https://CRAN.R-project.org/package=dplyr), tidyverse (https://doi.org/10.21105/joss.01686), vegan (https://CRAN.R-project.org/package=vegan), cluster (Maechler, M., Rousseeuw, P., Struyf, A., Hubert, M., Hornik, K.(2022). cluster: Cluster Analysis Basics and Extensions. R package version 2.1.4.), StatMatch (D'Orazio M (2022). _StatMatch: Statistical Matching or Data Fusion_. R package version 1.4.1, https://CRAN.R-project.org/package=StatMatch ), factoextra (Kassambara A, Mundt F (2020). _factoextra: Extract and Visualize the Results of Multivariate Data Analyses_. R package version 1.0.7, https://CRAN.R-project.org/package=factoextra ), and dendextend (Tal Galili (2015). dendextend: an R package for visualizing, adjusting, and comparing trees of hierarchical clustering. Bioinformatics. DOI: 10.1093/bioinformatics/btv428) packages were recruited in order to write statistical test codes. Additionally, the findings were visualized using the ggplot2 package (H. Wickham. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York, 2016.). Pearson's chi-square test and Wilcoxon test were used to compare demographic data including sex and age between ASD and TD groups. The haplotype analysis of rs2268498 and rs53576 was carried out based on expectation-maximization (EM) algorithm using Haploview software version 4.2 in order to ensure that there was no physical linkage and linkage disequilibrium (LD) between rs2268498 and rs53576. Besides, the deviation of both rs2268498 and rs53576 from Hardy-Weinberg Equilibrium (HWE) was estimated by “genetics” package (Gregory Warnes, with contributions from Gregor Gorjanc, Friedrich Leisch and Michael Man. (2021). genetics: Population Genetics. R package version 1.3.8.1.3. https://CRAN.R-project.org/package=genetics ) recruitment. With the use of the permutation test, rs2268498 and rs53576 associations with Happé's Strange Stories test and moving shapes paradigm were investigated within and between groups. Furthermore, hierarchical clustering was employed in order to distinguish different aspects of ToM based on similarities and differences in parameters extracted from Happé's Strange Stories test and moving shapes paradigm. As a final step, in order to compare feature detection abilities between SNPs (rs2268498 and rs53576) and hierarchical clustering, and to investigate the relation between cognitive parameters and both rs2268498 and rs53576, a general linear model (GLM) with logistic regression was used. It is important to note that, except for the within-group analysis, all statistical tests involving both ASD and TD groups used regression out method to adjust the effect of IQ.

Demographic results

Pearson's chi-square test indicated that there were no significant differences between the two groups based on gender (p = 0.260). Additionally, analysis of Wilcoxon test results did not reveal significant differences in age between individuals with ASD and TD group (p = 0.391). However, the IQ of the TD group was significantly higher than that of the ASD group, despite none of the participants attending exceptional schools (p = 1.883 × 10^-4). Therefore, IQ is controlled by regressing it out. A summary of the demographic results can be found in supplementary Table 1.

rs2268498/rs53576 HWE and haplotype analysis

There was no significant deviation from HWE for rs2268498 and rs53572 based on Pearson's chi-square test (p _rs2268498 = 0.519, p _rs53576 = 0.358). Additionally, rs2268498 and rs53572 do not exhibit a strong linkage based on the statistics and parameters obtained from haplotype analysis. In this respect, it could be considered that these two SNPs may act independently of one another. (D' = 0.436, LOD = 3.070, r²= 0.143). An overview of the HWE and genotype distribution is provided in supplementary Table 2.

rs2268498/rs53576 and ToM assessments

Permutation analysis of Happé's Strange Stories task revealed a significant association between the "rs2268498 × grouping" interaction and ToM stories, but not with human or unlinked stories (p _ToM = 0.003, p _human = 0.056, p _unlinked = 0.883). The analysis of within group data indicated that this finding can be attributed to both TD and ASD individuals (p _ToM−ASD = 0.018, p _ToM−TD = 0.010). As a result of further analysis, the rs2268498 AA genotype was associated significantly with higher scores in Happé's Strange Stories task ToM block in both groups (p _ToM−ASD = 0.019, p _ToM−TD = 0.005). In addition, carriers of the AA genotype in TD group, have significantly higher scores in human blocks as compared to G-carriers (p _human = 0.027). As for rs53576, there is a significant association between rs53576 and ToM stories block in the total sample population (p _ToM ≤ 0.001, p _human = 0.192, p _unlinked = 0.527). The following results indicated that rs53576 does not appear to have a significant association with ToM stories performance, neither in ASD group nor the TD one (p _ToM−ASD = 0.081, p _ToM−TD = 0.094). It is therefore likely that the association of rs53576 with ToM stories performance arises from differences in ToM stories residual scores between individuals with ASD and TD individuals. Table 1 and Fig. 1.a & 1.b provide detailed information regarding the results.

Accordingly, in terms of the moving shapes paradigm, rs2268498 was significantly associated with ToM and goal-directed GR, but not with GR of random animations (p _ToM ≤ 0.001, P _{goal-directed} = 0.002, p _random = 0.339). A subsequent analysis within each group indicated that no significant association between GR variables and rs2268498 was found in the ASD or TD groups (p _ToM-ASD = 0.647, P _{goal-directed-ASD} = 0.175, p _random-ASD = 0.109, p _ToM-TD = 0.215, P _{goal-directed-TD} = 0.289, p _random-TD = 0.437). Thus, ToM and goal-directed GR are significantly associated with rs2268498 in total samples based upon the differences between the ASD and TD groups. Among other moving shapes paradigm variables (IN and AP), only IN was significantly associated with rs2268498 (p _IN ≤ 0.001, p _AP = 0.070) in total samples which was not replicated in within group analysis (p _IN-ASD = 0.444, p _IN-TD = 0.627). Nevertheless, rs2268498 showed a marginally significant association with AP in the TD group (p = 0.047). According to the subsequent analysis, rs2268498 G-carriers scored significantly lower in the AP variable than AA carriers in the TD group (p = 0.032). On the other hand, the total sample permutation test demonstrated that the interaction of “rs53576 × grouping" was significantly associated with GR of goal-directed and ToM animations but not random animations (p _ToM = 0.002, P _{goal-directed} = 0.004, p _random = 0.370). The results of the within group analysis indicated that there exists a significant association between the GR of the goal-directed animations and the ToM animations with rs53576 in the ASD group, whereas the permutation test failed to replicate this finding in the TD group (p _ToM-ASD = 0.039, P _{goal-directed-ASD} = 0.006, p _random-ASD = 0.279, p _ToM-TD = 0.356, P _{goal-directed-TD} = 0.695, p _random-TD = 0.402). Additional investigations in the ASD group revealed that individuals with AA genotype scored significantly higher in both goal-directed and ToM animations (p _ToM = 0.039, P _{goal-directed} = 0.027, p _random = 0.636). Our results also indicated a significant association between rs53576 and AP and IN variables in total samples (p _AP ≤ 0.001, p _IN = 0.031), similar to what was observed in the ASD group, but not in the TD group (p _AP-ASD = 0.698, p _IN-ASD = 0.013, p _AP-TD = 0.571, p _IN-TD = 0.265). Upon further analysis in ASD group, it was revealed that the GG genotype of rs53576 was significantly associated with better intentionality scores in individuals with ASD (p _AP = 0.310, p _IN = 0.014). Figure 1.c, 2.a, 2.b, 2.c and Table 2 provide additional statistics.

Hierarchical Clustering Results

Using hierarchical clustering of dissimilarity matrix distances and for both ASD and TD groups, four clusters of cognitive parameters were found. According to the dendrograms, the cognitive variables were classified into four clusters based on the distance matrix: 1. General non-verbal characteristics regardless of ToM sophistication (random, goal-directed, and ToM GR), 2. The ability to consume verbally regardless of ToM sophistication (unlinked, human, and ToM stories), 3. The capability of acquiring non-linguistic ToM (IN), and 4. The ability to acquire verbal ToM (AP). ASD and TD clustering results are presented in figures 3.a and 3.b, respectively. As a result of visualizing 2-dimensional K-means clustering, it was revealed that in the TD group, the parameters representing similar ToM features (verbal/non-verbal) have a relatively smaller distance from one another than other variables. While such a distance ratio was observed in the patient group as well, the parameters illustrating verbal and non-verbal characteristics were significantly lower in the ASD group than in the TD group. The figures 3.c and 3.d illustrate the 2-dimensional clustering in more detail.

General Linear Model and Logistic Regression

None of the ToM parameters in the ASD group was predicted by the rs2268498 AA genotype. However, in the TD group, the rs2268498 AA genotype was significantly associated with AP, human, and ToM stories, which are partially associated with verbal ToM and verbal skills (β _human = 1.423, p _human = 0.019, β _ToM= 2.286, p _ToM = 1.440 × 10^-4, β _AP = 2.333, p _AP = 0.023). Using GLM results for rs53576 in both groups, it was found that rs53576 AA genotype significantly predicted GR of goal-directed and ToM animations, and GG genotype significantly predicted IN responses (β _{goal-directed} = 1.583, p _{goal-directed} = 0.047, β _ToM= 1.532, p _ToM = 7.270 × 10^-3, β _IN = -7.324, p _IN = 0.016). The rs53576 AA genotype was also found to be a significant predictor of ToM animations GR in individuals who were TD (β _ToM = 1.699, p _ToM = 0.035). There is a detailed presentation of GLM results in Table 3.

In this study, we examined the association of two OXTR non-coding SNPs, rs2268498 and rs53576, with verbal and non-verbal ToM abilities and model ToM skills in ASD and TD participants. Based on the convergence of results from permutation tests and GLM analysis, it was determined that rs2268498 AA genotype was significantly associated with verbal ToM in the TD group, whereas rs53576 AA genotype was significantly associated with non-verbal ToM in the ASD group. This finding could be attributed to the evolutionary role that OXT and OXTR play in the social perception of vertebrates, particularly mammals. In 2022, it was demonstrated that homozygous deletion of the Oxtr could result in social isolation in eight-week-old zebrafish (44). Also, earlier in 2016, it was suggested that OXTR expression changes in the Nucleus Accumbens (NAcc) play a significant role in the regulation of social behavior in prairie voles. According to the results of this study, there are several non-coding polymorphisms in the OXTR regulatory and intronic regions that are associated with altered OXTR expression in the NAcc (45). This may lend support to the contention that OXTR plays a significant role in social perception in mammals. As discussed earlier, due to the complexity of social cognition processes in humans, OXTR has a much broader and more complex impact on humans than it does on other species. As a result, the effects of OXT and OXTR variants can be observed in humans from prenatal development to adulthood, as well as in daily social interactions seen in individuals with social cognition impairment such as ASD. As an example of the effect of OXTR variation during infancy, it was reported in 2015 by Unternaehrer et al that maternal behaviors in childhood have a significant impact on OXTR methylation pattern during adulthood. The study discovered that individuals who received less maternal care during childhood exhibit significantly higher methylation of OXTR during adulthood, which is significantly associated with the incidence of psychiatric disorders (46). While different studies have demonstrated the association between various variants of OXTR and maternal behavior effects on toddlers, rs2268498 and rs53576 stand out in this field due to their significant interaction with environmental factors both during childhood and adulthood. In 2019, Smarius et al suggested that five-to-six-year-old children who had the GG genotype in rs53576 and were exposed to verbal violence by their mothers, as well as same age children who were carriers of the A allele in rs2268498 (AA and AG) and were exposed to verbal violence by their mothers, showed a significant increase in systolic blood pressure (47). In addition, Sicorello et al in 2020 attempted to identify associations between rs2268498 and rs53576 and everyday social behaviors, such as social buffering, among healthy individuals. Their results demonstrated that G carriers of both rs2268498 and rs53576 exhibited lower social company requirements after stressful events (48). In light of the findings discussed above, it is implied that rs2268498 and rs53576 together and alongside each other may be significantly associated with social functioning. As a result, further investigation may be needed in order to gain a deeper understanding of the mechanisms behind the association of rs2268498 and rs53576 with social cognition. Regarding this approach, Laursen et al investigated the association between rs2268498 and rs53576 polymorphisms and cognitive empathy in 2014. The results indicated that healthy individuals who hold the CC and AA genotypes at rs2268498 and rs53576, respectively, displayed significantly higher levels of empathic concern (49). Moreover, in 2019, Meixner et al assessed if rs2268498 and rs53576 are associated with language-based ToM through the use of a word-processing task. The results illustrated that rs2268498 A carriers and rs53576 G carriers showed weaker bias in conditions measuring emotionally positive self-related words (50). Thus, it could be anticipated that rs2268498 and rs53576 may also be associated with verbal ToM on the basis of such an observation. In this respect, our findings demonstrate a positive association between the rs2268498 AA genotype and validated parameters pertaining to language-based ToM abilities in typically developing children and adolescents. In this regard, it is worth mentioning that a number of previous studies have also examined the association of OXTR polymorphisms and validated ToM tasks. Hence, some studies have attempted to determine if there is a significant association between OXTR SNPs and well-known ToM tasks such as the Reading Mind in the Eyes' Test (RMET) and the false-belief task. The obtained results showed no significant association between OXTR SNPs and false-belief task performance in healthy populations regardless of age (36, 51), whereas RMET accuracy in healthy adolescents and young adults was significantly associated with rs53576, rs2254298, and rs2228485 (52). While rs2268498 has been shown to be significantly associated with autistic traits in healthy young adults (53), no study has yet been able to find an association between OXTR variants and ToM tasks such as RMET in population with ASD symptoms (54). Moreover, considering that individuals with ASD may also present language delays, it may be more appropriate to use language-related and language-free ToM tasks separately. In this regard, our results clearly illuminated that rs53576 is associated with non-verbal ToM in individuals with ASD. Despite of findings regarding association between rs53576 and rs2268498 with different aspects of ToM, including this study, the accuracy and reliability of these findings are still in question. In light of this, it appears that these results require assistance on a computational level. Using the matrix distance principle, we have found that linguistic and nonlinguistic ToM differ from one another in both ASD and TD individuals. According to our results, rs53576 was associated with parameters that represent verbal ToM in the ASD group, while rs2268498 was associated with variables indicative of verbal ToM in the TD group.

While many aspects have been discussed so far, the most pressing question here is how OXTR variants affect cognitive and behavioral functions related to ToM? Generally, it is presumed that associations between genetic variants and behavioral and cognitive characteristics are moderated by neurobiological endophenotypes. These endophenotypes can range from changes in the characteristics of neural cells to changes in the volume, structure, activity, and connectivity of different brain regions. Therefore, studying these endophenotypes could potentially shed light on the neural basis of genetic polymorphisms' association with human behavioral and cognitive features. In 2014, Brian W. Haas et al published one of the first studies in this field. The results of this study indicated that OXTR is significantly associated with social endophenotypes. These endophenotypes include brain regions such as dorsolateral prefrontal cortex (DLPFC), Ventromedial Prefrontal Cortex (VMPFC), Visual Cortex (VC), Premotor Cortex (PMC), and Anterior Cingulate Cortex (ACC), which are essential for various social cognition processes, including emotion recognition and social reward, social communication, empathy, and ToM. Researchers hypothesized that OXTR is associated with social traits indirectly by affecting these brain regions (55). Thus, when it comes to rs53576, homozygote individuals GG- who experienced insecure childhood attachments have shown higher brain gray matter volumes in the left amygdala and lower volumes in the right superior parietal lobule, left temporal pole, and bilateral frontal regions during the ToM paradigm. (34). In addition, Uzefovsky et al. in 2019 found significant association between rs53576 GG genotype and hyperactivity in the right supramarginal gyrus (rSMG) and inferior parietal lobule (rIPL) during RMET whereas AA genotype was associated with topological patterns in brain functional networks. (56, 57). Nevertheless, little is known about the association between rs2268498 and brain scale endophenotypes. For instance, Zimmermann et al. showed that rs2268498 AA is associated with Amygdala functional connectivity (58). Considering these findings together, they shed light on the association between rs2268498 AA genotype and rs53576 GG genotype and changes in brain regions related to ToM. In this sense, our findings at the cognitive level were implicitly aligned with the results of those studies.

It should be noted that this study had a number of limitations and problems, one of which was an overlap with the 5th wave of the Coronavirus pandemic in Iran. Ultimately, this problem was compounded by the fact that the study was conducting research with children, which made it impossible to expand the sampling size of the study. Further, advanced assessment techniques such as neuroimaging techniques and assays that measure other DNA variants more accurately were not feasible due to time and financial constraints.

In conclusion, here, children and adolescents with ASD and typically developing individuals, matched on sex and age in the Iranian population were assessed for verbal and non-verbal ToM as well as OXTR two variants, rs2268498 and rs53576, respectively. It was discovered that rs2268498 could significantly predict verbal ToM of TD participants, whereas rs53576 could significantly predict non-verbal ToM of participants with ASD. Additionally, the genetic and hierarchical modeling results aligned with each other and showed partial agreement. In order to ensure that the results of this study are reliable, further examinations will be required.

Anterior Cingulate Cortex (ACC)

appropriateness score (AP)

Autism Spectrum Disorder (ASD)

Childhood Autism Rating Scale (CARS)

Confidence Interval (CI)

Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5)

dorsolateral prefrontal cortex (DLPFC)

expectation-maximization (EM)

general rule (GR)

Genome Wide Association Study (GWAS)

Hardy-Weinberg Equilibrium (HWE)

Intelligence quotient (IQ)

intentionality score (IN)

linkage disequilibrium (LD)

Nucleus Accumbens (NAcc)

oxytocin (OXT)

Oxytocin Receptor gene (OXTR)

Premotor Cortex (PMC)

Reading Mind in the Eyes Test (RMET)

single nucleotide polymorphism (SNP)

Theory of Mind (ToM)

Typically developing (TD)

Ventromedial Prefrontal Cortex (VMPFC)

Visual Cortex (VC)

Ethics approval and consent to participate

The informed consent was obtained from all participants’ parents and steps of this study ethically were approved by the Tehran University of Medical Sciences Research Ethics Committee (IR.KHU.REC.1399.021) based on Helsinki declaration.

Consent for publication

Not applicable

Availability of data and materials

The dataset supporting the conclusions of this article is available in G-Node GIN repository (https://gin.g-node.org/ranaghamari/OXTR).

Competing interests

The authors declare that they have no competing interests

Funding

The study was funded by no special organization or institute

Authors' contributions

Rana Ghamari: conception and design, acquisition of data, analysis and interpretation of data and writing the draft. Mohammad Tahmaseb: data collecting. Atiye Sarabi-Jamab: data collecting, analysis of data, and revising final draft. Seyed-Alireza Etesami: data collecting. Azar Mohammadzadeh: data collecting. Fatemeh Alizadeh: data collecting, Mehdi Tehrani-Doost: conception and design, acquisition of data, analysis and interpretation of data and revision of the draft

Acknowledgements

We want to extend my gratitude to all individuals and their parents who participated in this study.

Tomasello M. The ultra‐social animal. European journal of social psychology. 2014;44(3):187-94.
Green MF, Horan WP, Lee J. Social cognition in schizophrenia. Nature Reviews Neuroscience. 2015;16(10):620-31.
Happé F, Frith U. Annual research review: Towards a developmental neuroscience of atypical social cognition. Journal of Child Psychology and Psychiatry. 2014;55(6):553-77.
Happé F, Cook JL, Bird G. The structure of social cognition: In (ter) dependence of sociocognitive processes. Annual review of psychology. 2017;68(1):243-67.
Huber L, Plötner M, Schmitz J. Social competence and psychopathology in early childhood: a systematic review. European child & adolescent psychiatry. 2019;28(4):443-59.
Fiske S, Taylor S. Social cognition. Mcgraw-Hill Book Company. 1991.
Premack D, Woodruff G. Does the chimpanzee have a theory of mind? Behavioral and brain sciences. 1978;1(4):515-26.
Baron-Cohen S, Leslie AM, Frith U. Does the autistic child have a “theory of mind”? Cognition. 1985;21(1):37-46.
Isaksson J, Van’t Westeinde A, Cauvet É, Kuja-Halkola R, Lundin K, Neufeld J, et al. Social Cognition in Autism and Other Neurodevelopmental Disorders: A Co-twin Control Study. Journal of Autism and Developmental Disorders. 2019;49(7):2838-48.
Association AP. The diagnostic and statistical manual of mental disorders, (DSM-5). Philadelphia: American Psychiatric Association. 2013.
Sandin S, Lichtenstein P, Kuja-Halkola R, Hultman C, Larsson H, Reichenberg A. The heritability of autism spectrum disorder. Jama. 2017;318(12):1182-4.
Ebstein RP, Israel S, Chew SH, Zhong S, Knafo A. Genetics of human social behavior. Neuron. 2010;65(6):831-44.
Scourfield J, Martin N, Lewis G, McGuffin P. Heritability of social cognitive skills in children and adolescents. The British Journal of Psychiatry. 1999;175(6):559-64.
Tick B, Bolton P, Happé F, Rutter M, Rijsdijk F. Heritability of autism spectrum disorders: a meta‐analysis of twin studies. Journal of Child Psychology and Psychiatry. 2016;57(5):585-95.
Warrier V, Chee V, Smith P, Chakrabarti B, Baron-Cohen S. A comprehensive meta-analysis of common genetic variants in autism spectrum conditions. Molecular autism. 2015;6(1):1-11.
Feldman R, Monakhov M, Pratt M, Ebstein RP. Oxytocin pathway genes: evolutionary ancient system impacting on human affiliation, sociality, and psychopathology. Biological psychiatry. 2016;79(3):174-84.
Guastella AJ, Hickie IB. Oxytocin treatment, circuitry, and autism: a critical review of the literature placing oxytocin into the autism context. Biological psychiatry. 2016;79(3):234-42.
Sun R, Vuillier L, Deakin J, Kogan A. Oxytocin increases emotional theory of mind, but only for low socioeconomic status individuals. Heliyon. 2020;6(3):e03540.
Ross HE, Young LJ. Oxytocin and the neural mechanisms regulating social cognition and affiliative behavior. Frontiers in neuroendocrinology. 2009;30(4):534-47.
Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function, and regulation. Physiological reviews. 2001;81(2):629-83.
Frazer KA, Ballinger DG, Cox DR, Hinds DA, Stuve LL, Gibbs RA, et al. A second generation human haplotype map of over 3.1 million SNPs. Nature. 2007;449(7164):851-61.
Tansey KE, Brookes KJ, Hill MJ, Cochrane LE, Gill M, Skuse D, et al. Oxytocin receptor (OXTR) does not play a major role in the aetiology of autism: genetic and molecular studies. Neurosci Lett. 2010;474(3):163-7.
Wu S, Jia M, Ruan Y, Liu J, Guo Y, Shuang M, et al. Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han population. Biological psychiatry. 2005;58(1):74-7.
Nyffeler J, Walitza S, Bobrowski E, Gundelfinger R, Grünblatt E. Association study in siblings and case-controls of serotonin-and oxytocin-related genes with high functioning autism. Journal of molecular psychiatry. 2014;2(1):1-9.
Di Napoli A, Warrier V, Baron-Cohen S, Chakrabarti B. Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome. Molecular autism. 2014;5(1):1-7.
Skuse DH, Lori A, Cubells JF, Lee I, Conneely KN, Puura K, et al. Common polymorphism in the oxytocin receptor gene (OXTR) is associated with human social recognition skills. Proceedings of the National Academy of Sciences. 2014;111(5):1987-92.
Yang S, Dong X, Guo X, Han Y, Song H, Gao L, et al. Serum oxytocin levels and an oxytocin receptor gene polymorphism (rs2254298) indicate social deficits in children and adolescents with autism spectrum disorders. Frontiers in neuroscience. 2017;11:221.
Reuter M, Montag C, Altmann S, Bendlow F, Elger C, Kirsch P, et al. Functional characterization of an oxytocin receptor gene variant (rs2268498) previously associated with social cognition by expression analysis in vitro and in human brain biopsy. Social neuroscience. 2017;12(5):604-11.
Melchers M, Montag C, Felten A, Reuter M. The oxytocin receptor gene and social perception. Social neuroscience. 2015;10(4):345-53.
Melchers M, Montag C, Markett S, Reuter M. Relationship between oxytocin receptor genotype and recognition of facial emotion. Behav Neurosci. 2013;127(5):780-7.
Christ CC, Carlo G, Stoltenberg SF. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern. J Pers. 2016;84(2):204-13.
Tops M, Van Ijzendoorn MH, Riem MM, Boksem MA, Bakermans-Kranenburg MJ. Oxytocin receptor gene associated with the efficiency of social auditory processing. Frontiers in psychiatry. 2011;2:60.
Chander RJ, Mather KA, Cleary R, Grainger SA, Thalamuthu A, Numbers K, et al. The influence of rs53576 polymorphism in the oxytocin receptor (OXTR) gene on empathy in healthy adults by subtype and ethnicity: a systematic review and meta-analysis. Reviews in the neurosciences. 2022;33(1):43-57.
Schneider-Hassloff H, Straube B, Jansen A, Nuscheler B, Wemken G, Witt SH, et al. Oxytocin receptor polymorphism and childhood social experiences shape adult personality, brain structure and neural correlates of mentalizing. Neuroimage. 2016;134:671-84.
Lucht MJ, Barnow S, Sonnenfeld C, Ulrich I, Grabe HJ, Schroeder W, et al. Associations between the oxytocin receptor gene (OXTR) and “mind-reading” in humans—An exploratory study. Nordic Journal of Psychiatry. 2013;67(1):15-21.
Opitz T, Schuwerk T, Paulus M, Kloo D, Osterhaus C, Lesch KP, et al. No links between genetic variation and developing theory of mind: A preregistered replication attempt of candidate gene studies. Developmental Science. 2021;24(5):e13100.
Chlebowski C, Green JA, Barton ML, Fein D. Using the childhood autism rating scale to diagnose autism spectrum disorders. Journal of autism and developmental disorders. 2010;40:787-99.
Mayes SD, Calhoun SL, Murray MJ, Morrow JD, Yurich KK, Cothren S, et al. Use of the childhood autism rating scale (CARS) for children with high functioning autism or Asperger syndrome. Focus on Autism and Other Developmental Disabilities. 2012;27(1):31-8.
Shahrivar Z, Tehrani-Doost M, Banaraki AK, Mohammadzadeh A. Normative Data and Reliability of the Moving Shapes Paradigm. Iranian journal of psychiatry. 2020;15(2):143.
Shahrivar Z, Tehrani‐Doost M, Khorrami Banaraki A, Mohammadzadeh A, Happe F. Normative data and psychometric properties of a Farsi translation of the strange stories test. Autism Research. 2017;10(12):1960-7.
Lakatosova S, Dudova L, Pivovarciova A, Husarova V, Babinska K, Kubranska A, et al. Association with autism of two polymorphisms in gene encoding oxytocin receptors in slovakia. Autism. 2013;3(121):10.4172.
Bašić J, Milošević V, Stanković M, Jevtović-Stoimenov T, Cvetković T, Despotović M, et al. The influence of rs53576 and rs2254298 oxytocin receptor gene polymorphisms on plasma oxytocin levels and measures of empathy. Archives of Biological Sciences. 2019;71(1):159-65.
Lucht MJ, Barnow S, Sonnenfeld C, Rosenberger A, Grabe HJ, Schroeder W, et al. Associations between the oxytocin receptor gene (OXTR) and affect, loneliness and intelligence in normal subjects. Progress in Neuro-Psychopharmacology and Biological Psychiatry. 2009;33(5):860-6.
Gemmer A, Mirkes K, Anneser L, Eilers T, Kibat C, Mathuru A, et al. Oxytocin receptors influence the development and maintenance of social behavior in zebrafish (Danio rerio). Scientific reports. 2022;12(1):1-13.
King LB, Walum H, Inoue K, Eyrich NW, Young LJ. Variation in the oxytocin receptor gene predicts brain region–specific expression and social attachment. Biological psychiatry. 2016;80(2):160-9.
Unternaehrer E, Meyer AH, Burkhardt SC, Dempster E, Staehli S, Theill N, et al. Childhood maternal care is associated with DNA methylation of the genes for brain-derived neurotrophic factor (BDNF) and oxytocin receptor (OXTR) in peripheral blood cells in adult men and women. Stress. 2015;18(4):451-61.
Smarius L, Strieder TGA, Doreleijers TAH, Vrijkotte TGM, Zafarmand MH, de Rooij SR. Common oxytocin polymorphisms interact with maternal verbal aggression in early infancy impacting blood pressure at age 5-6: The ABCD study. PLoS One. 2019;14(6):e0216035.
Sicorello M, Dieckmann L, Moser D, Lux V, Luhmann M, Schlotz W, et al. Oxytocin and the stress buffering effect of social company: a genetic study in daily life. Soc Cogn Affect Neurosci. 2020;15(3):293-301.
Laursen HR, Siebner HR, Haren T, Madsen K, Grønlund R, Hulme O, et al. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy. Front Behav Neurosci. 2014;8:423.
Meixner F, Montag C, Herbert C. Affective Language, Interpretation Bias and Its Molecular Genetic Variations: Exploring the Relationship Between Genetic Variations of the OXTR Gene (rs53576 and rs2268498) and the Emotional Evaluation of Words Related to the Self or the Other. Front Psychol. 2019;10:68.
Kim HW, Kang JI, An SK, Kim SJ. Oxytocin receptor gene variants are associated with emotion recognition and resilience, but not with false‐belief reasoning performance in healthy young Korean volunteers. CNS neuroscience & therapeutics. 2019;25(4):519-26.
Lucht MJ, Barnow S, Sonnenfeld C, Ulrich I, Grabe HJ, Schroeder W, et al. Associations between the oxytocin receptor gene (OXTR) and “mind-reading” in humans—An exploratory study. Nordic Journal of Psychiatry. 2013;67(1):15-21.
Montag C, Sindermann C, Melchers M, Jung S, Luo R, Becker B, et al. A functional polymorphism of the OXTR gene is associated with autistic traits in Caucasian and Asian populations. American journal of medical genetics Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics. 2017;174(8):808-16.
Baribeau DA, Dupuis A, Paton TA, Scherer SW, Schachar RJ, Arnold PD, et al. Oxytocin Receptor Polymorphisms are Differentially Associated with Social Abilities across Neurodevelopmental Disorders. Sci Rep. 2017;7(1):11618.
Haas BW, Anderson IW, Smith JM. Navigating the complex path between the oxytocin receptor gene (OXTR) and cooperation: an endophenotype approach. Front Hum Neurosci. 2013;7:801.
Uzefovsky F, Bethlehem RAI, Shamay-Tsoory S, Ruigrok A, Holt R, Spencer M, et al. The oxytocin receptor gene predicts brain activity during an emotion recognition task in autism. Mol Autism. 2019;10:12.
Wang J, Zhang Y, Zhu D, Yang Z, Liu F, Qin W, et al. A common variant in OXTR rs53576 impacts topological patterns of brain functional networks. Eur Child Adolesc Psychiatry. 2020;29(7):993-1002.
Zimmermann J, Deris N, Montag C, Reuter M, Felten A, Becker B, et al. A common polymorphism on the oxytocin receptor gene (rs2268498) and resting-state functional connectivity of amygdala subregions - A genetic imaging study. Neuroimage. 2018;179:1-10.

No competing interests reported.

SupplementaryMaterials.docx

Download PDF

Journal Publication

published 08 Jan, 2024

Read the published version in BMC Psychiatry →

Editorial decision: Major revision
27 Sep, 2023
Reviews received at journal
26 Sep, 2023
Reviewers agreed at journal
02 Sep, 2023
Reviews received at journal
25 Jul, 2023
Reviewers agreed at journal
16 Jul, 2023
Reviewers invited by journal
14 Jun, 2023
Editor assigned by journal
10 Jun, 2023
Editor invited by journal
07 Jun, 2023
Submission checks completed at journal
07 Jun, 2023
First submitted to journal
31 May, 2023

You are reading this latest preprint version

Association of verbal and non-verbal theory of mind abilities with non-coding variants of OXTR in youth with autism spectrum disorder and typically developing individuals: a case-control study

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Methods

Procedure

Measurements

Cognitive and Behavioral measurements

rs2268498 and rs53576 genotyping

Statistical analysis

Results

Demographic results

rs2268498/rs53576 HWE and haplotype analysis

rs2268498/rs53576 and ToM assessments

Hierarchical Clustering Results

General Linear Model and Logistic Regression

Discussion

Conclusion

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and materials

Competing interests

Funding

Authors' contributions

Acknowledgements

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1