PHOX2B gene mutation analysis in this proband revealed a heterozygous duplication (c.756_776dupGGCGGCAGCGGCAGCGGCGGC, p.Ala254_Ala260dup) in the exon 3 which results in polyalanine repeat expansion mutations (PARMs) to 27 repeats in the PHOX2B gene (20/27 genotype)(Fig. 2A). Her parents were normal for this mutation (20/20 genotype) (Fig. 2B, 2C).
The identified mutation (rs17879189) in this study was reported as pathogenic in ClinVar database. Using different in silico analysis tools such as mutation taster and CADD also helped us to annotate the pathogenicity of this variant; Mutation Taster showed this variant is a disease causing one, and its CADD score was 23.CADD score cutoff for a variant to be deleterious is 14.
This mutation has been previously reported in 2003 (14).Over 1,000 cases have been reported worldwide till now. Incidence rate estimated one in 150,000–200,000 live births in Japan(15, 16).
The normal PHOX2B gene has 20 alanine repeats (20/20 genotype),More than 90% of CCHS reported cases have been heterozygous for an in-frame PARM; the normal 20-alanine tract is expanded to 24–33 alanine repeats, with resultant genotypes of 20/24–20/33 PARMs.The 20/25, 20/26, and 20/27 genotypes are the most common, although increasing numbers of even the less common mutations are being identified monthly.The remaining 10% are heterozygous for a non-polyalanine expansion repeat mutation (NPARM) in the PHOX2B gene. (17).
Our identified mutation, c.756_776dupGGCGGCAGCGGCAGCGGCGGC, p.Ala254_Ala260dup, is a likely pathogenic one according to the ACMG guideline because: this mutation is located in a mutational hotspot (PM1), it is absent from controls in Exome Sequencing Project, 1000 Genomes Project, or Exome Aggregation Consortium (PM2), multiple lines of in silico analysis support that it has a deleterious effect on the gene or gene product(PP3), patient’s phenotype is highly specific for the disease (PP4), reputable sources recently report the variant is a pathogenic one (PP5).
There is significant “quantitative” correlation between the length of the polyalaninestretch and the degree of the hypoventilation severity in PARM patients (18).In general CCHS patients with 20/27–20/33 PARMs shows severe alveolar hypoventilation and require full-time ventilator support while those with shorter PARMS (20/24–20/25) have more subtle symptoms and later onset. Our patients with 20/27 PARM also were intubated shortly after her birth.
Hirschsprungwasalsoobservedin our patient, in general, it isreported in 20% of all CCHS cases(19), and affected individuals with 20/27 genotype or longer repeats are at greater risk of hirschsprungdisease (19). Cardiacarrhythmia isalso described in some patients with genotypes 20/25, 20/26, and 20/27, but our patient was normal in this regard.
Since the patient's parents were normal for the mutation found in their child, the mutation could be adenovoone. Most polyalanine repeat mutations arise de novo in CCHS probands, although they are inherited as an autosomal dominant trait(20).
Genetic study of this syndrome has not been previously performedin Iran. the only case report was a patient suspitious being affected by this disorder which had negative molecular result for CCHS.To our knowledge it is the first report of CCHS patient with genetic identification in Iran(21). In this paper we introduced a heterozygous PARM CCHS patient with genotype of 20/27. More investigation in these patients can help us to understand the most common mutations of PHOX2B gene in Iran and also predict patient’s clinical symptoms and help future management of the disease. The genetic study can help the family for prenatal diagnosis or pre-implantation diagnosis if the parents have gonadal mosaicism.