DOI: https://doi.org/10.21203/rs.3.rs-305918/v1
I. Background: Congenital central hypoventilation syndrome (CCHS) is an extremely rare genetic disorder characterized by autonomic nervous system (ANS) dysregulation caused by mutations in the PHOX2B gene. Here we introduce the first genetic analysis of a CCHS patient in Iran.
II. Methods and Results: Genetic analysis of the PHOX2B gene was performed by Sanger sequencing and interpreted using the American College of Medical Genetics and Genomics (ACMG) guideline. The results showed a heterozygous duplication in the exon 3 causing a polyalanine repeat expansion mutation (PARMs) to 27 repeats in the PHOX2B gene (20/27 genotype). The patient’s parents were normal for this mutation.
III. Conclusions: According to the ACMG guideline, the mutation is a pathogenic one, and it was a denovo mutation in the family. The genetic study can help the family for prenatal diagnosis or pre-implantation diagnosis if the parents have gonadal mosaicism.
Congenital central hypoventilation syndrome (CCHS) is an extremely rare genetic disorder characterized by autonomic nervous system (ANS)dysregulation and respiratory control deficiency. CCHSis manifested in the neonatal period with apnea, cyanosis, hypercapnia, and usually deteriorate during sleep(1).
This disorder is an autosomal dominant disease caused by mutation in PHOX2B gene(2). The paired-like homeobox2b, PHOX2B, gene is located on chromosome 4p12. It encodes a 314 amino acid protein that act as a transcription factor involved in the differentiation of the neural lineages of the autonomic nervous system (ANS)(1). Phox2b has 2 polyalaninerepeat- domains (2).
Two major mutationshave been identified in CCHS patientsincludingpolyalanine expansion repeat (PARM) (90%), and non-poly alanine repeatPHOX2Bmutation (NPARM) (10%).PARM patients shows 24 to 33 alanine repeats on the affected haplotypehowever normal allele has 20(3). Some studies show correlation between poly alanine expansion length and severity of autonomic dysfunction(4).Different mutations have been reported in the affected individuals with CCHS and NPARMs consisting ofpre-dominantly frameshiftmutations, and also non-sense,missense, missense with stop codon alteration, and partial/ whole gene deletion mutations(5).
Alanine expansions, or homeobox-distal mutations, found in the PHOX2B gene of CCHS patients result in a protein that is capable of binding to the right target sites in the genome, but is unable to properly do its normal regulatory function(5). poly alanine repeat mutant phox2b resulted in cytoplasmic aggregation whereas this effect was not seen inframeshift mutations(6).Trochete et al.suggestedthat mutant protein with the misfolded 33 repeats can prevent the normal protein from its usual function(7), and different studies suggested dominant negative function for Poly alanine expansion repeat mutations (22).Homozygote patientsare rarely reported;Trochetet al., described aCCHS case with homozygote PARM mutation from the asymptomatic parents, in whom both alleles had + 4 polyalanineexpansion(8).
CCHS occurs with hirschprung disease among 20% of patients. HSCR is not prevalent in PARM (to 13 to 20% of PARMs) (9)
The present study introduces the first genetically confirmed hypoventilation syndrome patient in Iran.
Case description
Preterm female infant (Gestational age: 36 weeksand five days) was delivered via cesarean section because of premature rupture of membranes (PROM). No obvious dysmorphic features were found. Her birth weight was 2560 g and the Apgar scores was6 to 8. She was the first baby born tonon-consanguineous parents. In the second day of her life, she had a seizure and positive-pressure ventilation was commenced. Additionally, she experienced recurrent episodes of apnea and cyanosis. No positive history for this phenotype was reported in the pedigree (Fig. 1).
Molecular analysis
The Proband was referred to Ali-Asghar Children Hospital one month after birth. Informed consent was received from the family patient before sampling.
DNA was extracted by salting out procedure (10).All exons and exon-intron boundaries of the PHOX2B gene (NM_003924.3) were sequenced. Primers are available upon request. DNA sequencing, and interpretation were performed using previously described techniques (11).
mutation analysis was performed using Mutation Surveyor software(12), and variants were analysed using different softwares such as CADD, and mutation taster. All variant interpretation was done based on the American College of Medical Genetics and Genomics (ACMG) guideline(13).
PHOX2B gene mutation analysis in this proband revealed a heterozygous duplication (c.756_776dupGGCGGCAGCGGCAGCGGCGGC, p.Ala254_Ala260dup) in the exon 3 which results in polyalanine repeat expansion mutations (PARMs) to 27 repeats in the PHOX2B gene (20/27 genotype)(Fig. 2A). Her parents were normal for this mutation (20/20 genotype) (Fig. 2B, 2C).
The identified mutation (rs17879189) in this study was reported as pathogenic in ClinVar database. Using different in silico analysis tools such as mutation taster and CADD also helped us to annotate the pathogenicity of this variant; Mutation Taster showed this variant is a disease causing one, and its CADD score was 23.CADD score cutoff for a variant to be deleterious is 14.
This mutation has been previously reported in 2003 (14).Over 1,000 cases have been reported worldwide till now. Incidence rate estimated one in 150,000–200,000 live births in Japan(15, 16).
The normal PHOX2B gene has 20 alanine repeats (20/20 genotype),More than 90% of CCHS reported cases have been heterozygous for an in-frame PARM; the normal 20-alanine tract is expanded to 24–33 alanine repeats, with resultant genotypes of 20/24–20/33 PARMs.The 20/25, 20/26, and 20/27 genotypes are the most common, although increasing numbers of even the less common mutations are being identified monthly.The remaining 10% are heterozygous for a non-polyalanine expansion repeat mutation (NPARM) in the PHOX2B gene. (17).
Our identified mutation, c.756_776dupGGCGGCAGCGGCAGCGGCGGC, p.Ala254_Ala260dup, is a likely pathogenic one according to the ACMG guideline because: this mutation is located in a mutational hotspot (PM1), it is absent from controls in Exome Sequencing Project, 1000 Genomes Project, or Exome Aggregation Consortium (PM2), multiple lines of in silico analysis support that it has a deleterious effect on the gene or gene product(PP3), patient’s phenotype is highly specific for the disease (PP4), reputable sources recently report the variant is a pathogenic one (PP5).
There is significant “quantitative” correlation between the length of the polyalaninestretch and the degree of the hypoventilation severity in PARM patients (18).In general CCHS patients with 20/27–20/33 PARMs shows severe alveolar hypoventilation and require full-time ventilator support while those with shorter PARMS (20/24–20/25) have more subtle symptoms and later onset. Our patients with 20/27 PARM also were intubated shortly after her birth.
Hirschsprungwasalsoobservedin our patient, in general, it isreported in 20% of all CCHS cases(19), and affected individuals with 20/27 genotype or longer repeats are at greater risk of hirschsprungdisease (19). Cardiacarrhythmia isalso described in some patients with genotypes 20/25, 20/26, and 20/27, but our patient was normal in this regard.
Since the patient's parents were normal for the mutation found in their child, the mutation could be adenovoone. Most polyalanine repeat mutations arise de novo in CCHS probands, although they are inherited as an autosomal dominant trait(20).
Genetic study of this syndrome has not been previously performedin Iran. the only case report was a patient suspitious being affected by this disorder which had negative molecular result for CCHS.To our knowledge it is the first report of CCHS patient with genetic identification in Iran(21). In this paper we introduced a heterozygous PARM CCHS patient with genotype of 20/27. More investigation in these patients can help us to understand the most common mutations of PHOX2B gene in Iran and also predict patient’s clinical symptoms and help future management of the disease. The genetic study can help the family for prenatal diagnosis or pre-implantation diagnosis if the parents have gonadal mosaicism.
Congenital central hypoventilation syndrome ;
autonomic nervous system ;
poly alanine expansion repeat mutation;
non-poly alanine repeat mutation;
American College of Medical Genetics and Genomics;
premature rupture of membranes
Ethics approval
The project was approved by the ethical committee of the IUMS research committee.
Consent to participate:
Prior to sampling, genetic counseling was performed, and Informed consent from the family was obtained for participating in this project.
Consent for publication:
Prior to sampling, genetic counseling was performed, and Informed consent for publication was obtained.
Availability of data and materials:
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Conflicts of interest:
The authors declare that they have no competing interests
Funding:
Not applicable
Code availability:
Not applicable
Authors’ contributions:
MM contributed to perform the experiments, analysis, and interpretation of data and also revised the manuscript. She led the project, supervised the study, contributed to the design of the study. RKH drafted the manuscript. NK involved in the clinical diagnosis of the patient. All authors discussed the results and approved the final manuscript.
Author details:
1 Department of Medical Genetics and Molecular Biology, Faculty of Medicine, Iran University of Medical Sciences (IUMS), ShahidHemmat Highway, Tehran, Iran.
2 Department of medical genetics, Ali-Asghar Children's Hospital, Zafar St., ShahidModarres Highway, Tehran, Iran.
3Student Research Committee, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran.