The methods were carried out in accordance with the relevant guidelines and regulations of the Animal Ethics Committee of Jilin Agricultural University. All experiments were performed in accordance with relevant guidelines and regulations of the Animal Ethics Committee of Jilin Agricultural University and all experimental protocols were approved by the Animal Ethics Committee of Jilin Agricultural University.
Animals and experimental design
A total of 24 male Junmu No.1 White piglets (Sanjiang white Pig × Seghers hybrid) with the similar body weight were randomly assigned to 4 treatments with 6 replicated piglets per treatment. The piglets were purchased from the original breeding farm of Jilin University, Changchun city, Jilin Province. The positive control (MILK) group was fed sow's milk throughout the trial process. The negative control (0BC) group was weaned at d 21 without any supplementation. Another two groups were weaned at d 21 and administered oral 40 mg/kg (40BC) or 80 mg/kg β-carotene (80BC) from d 14 to d 24 of age, respectively. The duration of the experiment was 10 days. β-carotene powder was dissolved in 5 ml of corn oil (obtained frorm Sigma-Aldrich) for utilization in this experiment. β-carotene was fed once a day and stored at 4 ℃. All piglets were offered ad libitum access to water and housed in a temperature-controlled room (32–34 ℃). During the trial, all piglets were fed a basal diet. The basal diet was prepared according to the NRC (2012) nutritional requirements of piglets. The ingredients of the basal diets are shown in Table 1.
Table 1
Ingredient composition and nutrient levels of the basic diets (air-dry basis,%)
Item | Amount |
Ingredients | air-dry basis [%] |
Corn | 57.0 |
Soybean meal | 24.5 |
Whey powder | 6.0 |
Soybean oil | 2.2 |
Extruded soybeans | 4.0 |
Fish meal | 3.0 |
Dicalcium phosphate | 1.3 |
Limestone | 0.7 |
Salt | 0.3 |
Vitamin and mineral premix1 | 1.0 |
Total | 100 |
Nutrient levels: | |
Digestive energy (MJ·kg-1) | 13.6 |
Crude protein | 19.7 |
Lysine | 1.2 |
Calcium | 0.85 |
Phosphorus | 0.64 |
1The compound premix provides per kilogram of feed: Vitamin A 12000 IU, Vitamin D 31700 IU, Vitamin E 45 IU, Vitamin K 4.5 mg, Vitamin B1 4 mg, Vitamin B2 12 mg, Vitamin B6 7.5 mg, Vitamin B12 35 Μg, Biotin 150 µg, Pantothenic Acid 30 mg, Folic Acid 2.5 mg, Niacinamide 50 mg, Choline chloride 560 mg, Iron 220 mg, Zinc 210 mg, Copper 180 mg, Manganese 55 mg, Selenium 0.3 mg, Iodine 0.3 mg, Co 0.3 mg. |
Sample collection
At d 24, all piglets were anaesthetized by an intramuscular injection of 4% sodium pentobarbital solution (40 mg/kg body weight). After collecting the blood from the anterior vena cava, all piglets were then euthanized by exsanguination. The abdominal wall opened by using a scalpel, and we used anatomical features to identify the jejunum: the final meeting point of the duodenum and the pancreas was considered as the boundary between the duodenum and the jejunum, and the yolk stalk served as the boundary between the jejunum and the ileum. Then, the central ~ 2 cm of the jejunum was collected, fixed in 4% paraformaldehyde or 4% glutaraldehyde, and kept at 4 °C for histology and scanning electron microscopy (SEM) analyses. Sections of the jejunum were collected, rinsed with normal saline, blotted dry with filter paper, frozen in liquid nitrogen, and stored at -80 ℃ for Western blot analysis and real-time PCR.
Growth performance
At d 21 and d 24, the initial body weight (IBW) and final body weight (FBW) of the piglets were recorded, respectively. And total consumption of the piglets were also recorded from d 21 to d 24. The average daily gain (ADG), average daily feed intake (ADFI) and feed conversion rate (FCR)were calculated.
ADG [g/day] = (Final BW [g] − Initial BW [g])/(Test days [day] × Total number of piglets).
ADFI [g/days] = Total consumption [g]/(Test days [day] × Total number of piglets).
FCR= | ADFI/ADG |.
Detection of D-lactic acid and diamine oxidase in serum
Blood was obtained from the anterior vena cava. The serum was centrifuged at 3000 rpm for 15 minutes and placed in a 1.5 ml centrifuge tube. D-lactic acid and diamine oxidase (DAO) concentrations were measured using a pig D-lactic acid and DAO ELISA quantification kit (Bethyl Laboratories, Montgomery, TX, USA) and an ELISA starter accessory package (Bethyl Laboratories) according to the manufacturer’s instructions. The plates obtained from the procedures were measured at 450 nm with a micro plate reader (Multiskan FC; Thermo Fisher Scientific, Waltham, MA, USA).
Histology
The jejunum, which was fixed in 4% paraformaldehyde was trimmed, dehydrated and then embedded in paraffin. Afterwards, the microtome was cut into approximately 5-µm-thick slices, which were placed on glass slides and stained with haematoxylin and eosin to observe intestinal histomorphology. Villus height was measured from the crypt mouth to the villus tip, and the associated depth of the crypts was measured from the base to the crypt mouth by a computer-aided light microscope (Nikon, Tokyo, Japan). A total of 100 villi measurements per piglet were calculated and used in the statistical analysis.
SEM analysis of the jejunal morphology
For SEM, the test procedure is as described previously [18]. All villi were observed with an SEM (PW-100-011, The LASER Company, Ireland). Using SEM, we observed whether the intestinal epithelium at the top of the villus was damaged. Five images from each piglet were observed.
Analysis of mRNA abundance by real-time PCR
Total RNA was extracted from jejunum tissue using RNAiso Plus (TaKaRa Code:9109). The yield and purity of the RNA were evaluated using a NanoDrop 2000 (Thermo Scientific, USA). RNA (1 µg) was used to generate cDNA (PrimeScript™ RT reagent kit with gDNA Eraser, TaKaRa Cat# RR047A) in a volume of 20 µL. Real-time polymerase chain reaction was performed in a total volume of 20 µL using SYBR® Premix Ex Tap™ II (TaKaRa Cat# RR820A) following the manufacturer’s instructions. RNA integrity was detected by agarose gel electrophoresis.The RT-PCR programme was as follows: 30 s at 95 °C, 40 cycles of 5 s at 95 °C and 30 s at 60 °C, 5 s at 65 °C and 5 s at 95 °C. A melting curve was used to systematically analyse all samples. The primers were designed using software (Sangon Biotech Co., Ltd, Shanghai), and the sequences are listed in Table 2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The relative mRNA expression levels of the target genes were determined using the 2−∆∆CT method [19].
Table 2
Sequences of primers used for RT-qPCR amplification
Gene | Accession number | Sequence (5'→3') | Size (bp) |
GAPDH | NM_001206359 | F:5'CTCAACGGGAAGCTCACTGG R:5'TGATCTCATCATACTTGGCAGGTT | 100 |
Claudin−3 | NM_001160075 | F:5'TGTGGATGAACTGCGTGGTG R:5'ATCTTGGCTTTGGCCGTGTC | 143 |
Occludin | NM_001163647.2 | F:5':CAGTGGCTTTGGTGGCTATG R:5'AGAATCCCTTTGCTGCTCGT | 101 |
ZO−1 | XM__003353439.2 | F:5'AAGCCCTAAGTTCAATCACAATCT R:5'ATCAAACTCAGGAGGCGGC | 133 |
Western blot analysis
First, the jejunum tissue was removed from the − 80 ℃ freezer and then thawed on ice. Soon afterwards, the samples were mechanically homogenized with RIPA lysate, deacetylase inhibitor mixture, protease phosphatase inhibitor mixture and PMSF and then centrifuged at 10,000 rpm for 15 minutes at 4 °C to collect the supernate. The total protein concentrations were determined by BCA kits.
Equal amounts of protein (25 µg) were added to SDS-PAGE gels, with electrophoresis initially at 80 V for 30 min and then switched to 120 V until the end. Then proteins were then ransferred to polyvinylidene fluoride (PVDF) membranes for 140 min at 220 mA. The membranes were blocked with 5% nonfat milk for 1 h at room temperature. Then the membranes were washed in TBST buffer three times and subsequently incubated overnight at 4 °C with the primary antibodies for β-actin, occludin, claudin-3 and ZO-1 (1:5000, 1:1000, 1:500, 1:500, diluted with TBST). The next day, the membranes were washed in TBST buffer and then incubated with HRP-conjugated secondary antibody (1:3000, diluted with TBST) at room temperature for 1 h. The membranes were treated with an enhanced chemiluminescent HRP substrate (Millipore, USA) and detected by a Gene Genome bioimaging system. The protein bands were quantified by Quantity One® software (Quantity One 4.61, Bio-Rad, Hercules, CA, USA). The primary antibodies for β-actin and the secondary antibody (HRP- conjugated goat anti-rabbit and anti-mouse) were purchased from Sigma (USA). The primary antibodies for occludin were purchased from Bioss. Claudin-3 was purchased from Abcam, and ZO-1 was purchased from Novus Biologicals. The RIPA kit and Difco non-fat milk were obtained from Pierce (USA). The PVDF membranes were purchased from Millipore (Bedford, MA, USA). We used 3 biological replicates, each representing 3 technical replicates.
Intestinal epithelial cell culture
The intestinal porcine epithelial cell line J2 from the jejunum (IPEC-J2) was obtained from ATCC and the cells were cultured in DMEM supplemented with 10% FBS (Life Technologies), 100 IU/mL penicillin and 100 µg/mL streptomycin. The cells were incubated at 37 ˚C in a humidified 5% CO2 incubator. Monolayers were grown, and the cells were passaged using trypsin. Then, 13 × 107 cells were cultured in each well of six-well plates. After incubation for 24 h, the IPEC-J2 cells were divided into four groups. Group Ⅰ: control group. Group Ⅱ: β-carotene group. Group Ⅲ: NSC 23766 (specifific Rac1 inhibitor) group. Group IV: β-carotene + NSC 23766 group. The cells in groups Ⅱ and IV were treated with 150 µg L− 1 β-carotene for 3 h, and the cells in groups Ⅰ and IV were treated with DMEM for 3 h. Our laboratory has previously conducted tests on β-carotene concentration and time using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide and thiazolyl blue tetrazolium bromide (MTT). After 3 h, phosphate buffered saline (PBS) was used to wash the cells. Then, groups Ⅲ and IV were treated with 50 mM NSC 23766 (specific Rac1 inhibitor) for 12 h, and the other two groups were treated with DMEM. The cells were then collected and treated with lysis buffer to extract the total protein for Western blotting. The remainder of the cells were used to extract total RNA for real-time PCR using RNAiso Plus (TaKaRa Code: 9109).
Statistical analysis
SPSS 21.0 (IBM Corporation, Armonk, NY, USA) was used for data analysis. The significant differences were analysed via one-way ANOVA followed by a post hoc least-significant difference (LSD) test. Statements of statistical significance were based on P ≤ 0.05.