Microglia activation induced by a rat model of mild acute pancreatitis

doi:10.21203/rs.3.rs-3083187/v1

Download PDF

Research Article

Microglia activation induced by a rat model of mild acute pancreatitis

https://doi.org/10.21203/rs.3.rs-3083187/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Acute pancreatitis is an inflammation of the pancreatic glandular parenchyma that causes injury with or without the destruction of pancreatic acini. Clinical and experimental evidence point to some systemic pro-inflammatory mediators as responsible for triggering the basic mechanisms involved in microglial reactivity. Here, we investigated the possible repercussions of mild acute pancreatitis (AP) on the production of inflammatory mediators in the brain parenchyma focusing on microglial activation in the hippocampus.

Methods The acute pancreatic injury in rats was induced by a pancreas ligation surgical procedure (PLSP) on the splenic lobe, which corresponds to approximately 10% of total mass of the pancreas. Blood samples were collected via intracardiac puncture for the measurement of serum amylase. After euthanasia, frozen or paraffin-embedded brains and pancreas were analyzed using qRT-PCR or immunohistochemistry, respectively.

Results Immunohistochemistry assays showed a large number of Iba1 and PU.1 positive-cells in the CA1, CA3, and dentate gyrus (DG) regions of the hippocampus of the PLSP group. TNF-α mRNA expression was significantly higher in the brain from PLSP-group. NLRP3 inflammasome expression was found to be significantly increased in the pancreas and brain of rats of the PLSP-group. High levels of BNDF mRNA were found in the rat brain of PLSP-group. In contrast, NGF mRNA levels were significantly higher in the control group versus PLSP-group.

Conclusion Our results suggest that AP has the potential to induce morphological changes in the microglia compatible with the activated phenotype.

Cellular & Molecular Neuroscience

Surgery

Acute Pancreatitis Models

Primed Microglia

Systemic Inflammation

Neurodegeneration

Neurodegenerative Diseases

Neurotrophic Factors

Acute pancreatitis (AP) is an inflammation of the pancreatic glandular parenchyma that causes injury with or without the destruction of pancreatic acini. AP is a disease of varying severity, which can evolve from mild edematous to severe necrotizing form, potentially leading to death. Its acute inflammatory process promotes leukocyte activation and the release of pro-inflammatory mediators that are responsible not only for local pancreatic damage but also for the development of systemic inflammatory response syndrome (SIRS). Activated leukocytes are the main source of cytokines. IL-1β and TNF-α are the primary mediators involved in SIRS. They play a key role in almost all stages of the response, from early to late stages, leading to the amplification of inflammation. Both IL-1β and TNF-α are able to induce their own expression as well as the expression of other cytokines, generating a self-regulating mechanism with consequences of great amplitude and systemic diffusion [1].

TNF-α is also capable of altering the blood-brain barrier permeability by regulating the levels of ICAM-1 in endothelial cells [2, 3]. Once in the central nervous system (CNS), TNF-α is capable of triggering damage events such as neuroinflammation and excitotoxicity. In addition, TNF- α induces astrocyte activation, as well as MHC class I and II expression in astrocytes and microglia [2].

Microglia are present throughout the CNS as a kind of sentinel cell, being the first cell to react during the inflammatory process, acting as a biological sensor for cell damage or infections [4–6]. In a healthy brain, microglia move their extensions in several directions in order to constantly monitor the microenvironment. It is possible to find two basic types of this cell: branched morphology throughout the encephalic parenchyma and, in a very particular way, amoeboid in the circumventricular regions [7]. Microglia react to peripheral stimuli from chronic inflammatory diseases, such as diabetes, and arthritis, and also from infectious diseases such as pneumonia and sepsis. Regardless of whether they are infectious or not, IL1-β, IL-6, and TNF-α are released into the blood stream, which reaches the CNS and triggers a response from glial cells, including microglia. This response involves inflammasomes activation [8], synthesis or positive regulation of receptors specialized in the recognition of damage-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs), such as Toll-like receptors, scavengers, and mannose receptor. The receptors colony-stimulating factor receptor 1 (CSF1R) and receptor for advanced glycation end products (RAGE) are also found expressed in the activated microglia [4, 9–11].

Based on the above, our study aimed to investigate if the model of AP used herein can induce a systemic inflammatory response and if these mediators can act on regions of brain parenchyma, such as the hippocampus, activating microglia.

Animals

Sixteen female Wistar rats (Rattus norvegicus albinus, Rodentia mammalia), two months old and with an average weight of (± 160g), were obtained from the Animal Facility of the Centre for Experimental Surgery Laboratory at the Federal University of Rio de Janeiro, Brazil. Rats were kept in an environment free of specific pathogens, under standard animal allocation conditions (temperature between 20º and 24º C, relative humidity around 50–60%, with 12 h of the light period and 12 h of the dark period), fed with specific ration and water ad libitum and controlled environment with attention to the circadian cycle. All animals were exposed to the same environmental conditions during the experiment.

Surgical procedures

Rats were randomly divided into two groups: Control group (n = 8); animals were submitted to laparotomy with minimum manipulation of the pancreas and adjacent viscera. Mild acute pancreatitis group (n = 8); animals were submitted to laparotomy and pancreas ligation surgical procedure (PLSP) on the splenic lobe.

In both groups, rats were sedated and anesthetized with an intraperitoneal injection of ketamine hydrochloride 5% (100 mg/kg) combined with xylazine hydrochloride 2% (10 mg/kg). After anesthetic administration, animals were immobilized in a supine position, shaved, and decolonized with 4% chlorhexidine digluconate, followed by a 2% alcoholic chlorhexidine solution. After these procedures, a 4 cm long median incision was made to access the abdominal cavity.

To assess whether surgical manipulation could cause damage to the pancreas, the animals in the control group underwent laparotomy, the pancreas was identified, exposed and gently handled, as well as the stomach and spleen. Next, the peritoneal cavity and skin were sutured with simple stitches using mononylon 4.0 suture thread. In order to operate on the pancreas of rats from the PLSP group, we used the segmental division method of the rat pancreas as previously described by members of our group [12]. Pancreatic ligation was performed in the secondary ducts of the splenic region of the pancreas, avoiding the main pancreatic duct (Fig. 1).

After the operation, the animals were housed in the vivarium under the same conditions described above. Postoperative analgesia consisted of dipyrone (25mg ∕ kg), subcutaneously in the first moment after surgery and then orally, placing it in the animals' water, every 8 hours, until euthanasia.

Forty eight hours after surgery, a blood sample (1ml) was collected by intracardiac puncture and placed in vacuum collection tubes without anticoagulant solution, for serum amylase dosage. Thereafter, the rats of each group were put to death by cervical dislocation with the animal deeply sedated and the reflexes and respiratory and cardiac movement capacity constantly checked. After the euthanasia, the pancreas and brain were immediately removed. Samples (pancreas and brain) were cryopreserved for RT-PCR analysis or for immunohistochemistry. Other samples were fixed in buffered formalin, included in paraffin and, later stained with hematoxylin-eosin (H&E - Vector Laboratories, Burlingame, CA, USA) for histopathological evaluation. Some sections of the brain were prepared for immunohistochemical analysis.

Histological analysis of the pancreas and brain

Fragments of the pancreatic and brain tissues of the different groups were collected and washed in sodium phosphate buffer (PBS) and fixed in buffered formaldehyde for 24 hours. Afterward, samples were washed in running water and stored in previously identified cassettes, for processing. That consisted of dehydration by alcohol (70%, 80%, 90%, and 100%, respectively), diaphanization by xylol, (two baths), and impregnation by paraffin at 60ºC, for 60 min. Then, the material was embedded in paraffin and reserved for microtomy. Five µM cuts were made in a rotating microtome.Tissue was stretched in a water bath, caught in frosted sheets, and taken to an oven at 60ºC, for two hours. After this period, deparaffinization was carried out by xylol, rehydration by alcohol, followed by washing in running water and in distilled water for 5 min. The slides were stained by the hematoxylin-eosin (H&E - Vector Laboratories, Burlingame, CA, USA) method, washed in running water, dehydrated in alcohol, clarified in xylol, mounted with glass coverslips and reserved for analysis under an optical microscope in order to putative tissue damage in both pancreas and brain.

Quantification of mRNA expression of inflammatory mediators during AP

Tissue samples from brains and pancreas were frozen in liquid nitrogen and stored in a freezer − 80ºC. Then, homogenized in Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA), following the manufacturer's instructions to isolate the total mRNA. The isolated mRNA was quantified by spectrophotometry (Nanodrop ND-1000; Thermo Fisher Scientific, Waltham, MA, USA) and converted to cDNA with a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific) after checking its integrity by electrophoresis on an agarose gel to 2%. The cDNA libraries were analyzed by RT-PCR using the GoTaq PCR Master Mix (Promega) and specific primers for each gene - Sigma-Aldrich was used (Table 1). The amplification of cDNA was detected by green fluorescence using a Mastercycler ep Realplex thermocycler (Eppendorf). The quality of the PCR primers was evaluated by electrophoresis on 1.5% agarose gel, checking the size of the PCR product. Each sample was evaluated in duplicate, and gene expression was normalized by the reference gene (Housekeeping gene, acidic ribosomal phosphoprotein P0, 36B4, Forward AATCCTGAGCGATGTGCAG Reverse: GCTGCCATTGTCAAACAC. Data were analyzed using the 2-ΔCCt method, where Δ result is Δsubtraction of the reference gene by the gene of interest and ΔΔCt was calculated in relation to the control animals.

PANCREAS
Gene	Forward (FW)	Reverse (RV)
Inflammasomes:
NLRP3	TCACCCAAGGAGGAAGAAGA	GTCTGGAAGAACAGGCAACA
Caspase-1	CACAGCTCTGGAGATGACAAA	CTGGAGACCATGAGACATGAATAC
BRAIN
Cytokines:
TNF-α	CAGCCGATTTGCCATTTCATAC	GGCTCTGAGGAGTAGACGATAA
INF-γ	GATGTGCGGATACCTGAAGC	AGGGATGCCAACATGACTGA
Inflammasomes:
Caspase-1	CACAGCTCTGGAGATGACAAA	CTGGAGACCATGAGACATGAATAC
NLRP3	TCACCCAAGGAGGAAGAAGA	GTCTGGAAGAACAGGCAACA
Neurotrophic Factors:
NGF	ACACTCTGATCACTGCGTTTTTG	CCTTCTGGGACATTGCTATCTGT
BDNF	CTTTTGTCTATGCCCCTGCAGCCTT	AGCCTCCTCTGCTCTTTCTGCTGGA

Immunohistochemistry Assay

Coronal sections of the brain were obtained with a thickness of 3µm on silanized slides, the slides were incubated at 60ºC for 60 min. Then, they were deparaffinized in xylol, rehydrated in alcohol, washed in running water and distilled for 5 min, and subjected to endogenous peroxidase block (0.3% hydrogen peroxide) for 10 min, followed by washing in running water and distilled for 5 min and stored in TBS buffer pH 7.6 for 5 min, the specimens were subjected to protein blocking containing 10% fetal bovine serum (FBS - Cultilab, Campinas, SP, Brazil) and 3% bovine serum albumin (BSA - Sigma Chemical, St. Louis, MO, USA) in PBS for 30 min, and then rinsed in running water and distilled for 5 min and conditioned in Tris-buffered saline (TBS) pH 7.6 two times for 5 min. The sections were incubated with primary antibody Anti-Iba1 Rabbit monoclonal Abcam (1: 100 - EPR16588) and Anti-PU.1Rabbit Monoclonal Sigma-Aldrich (1: 500 - EPR3158Y), five slides each, in a humid chamber at 4ºCovernight. The material was then washed in running water and distilled for 5 min each wash. Then, being washed twice in TBS for 5 min each and incubated with a secondary antibody (Polimero HRP-anti rabbit,1:200 - Nichirei Biosciences Inc., Tokyo, Japan) for 30 min. The slides were washed in running distilled water for 5 min, conditioned in TBS for 5 min, and incubated with chromogen DAB. The samples were counterstained with Harris hematoxylin for 30 seconds, washed in running water for 10 min, dehydrated in alcohol, clarified in xylol, and assembled with Damar gum for further analysis. The percentage of Iba1⁺ or PU.1⁺ cells was determined by examining, in bright-field optics, randomly selected cells in at least 300 fields at 630x magnification with a light microscope (Eclipse E800; Nikon, Tokyo, Japan) coupled to a digital camera (Evolution Media Cybernetics Inc., Bethesda, MD, USA) and a computer running QCapture 2.95.0 software, version 2.0.5 (Silicon Graphics Inc., Milpitas, CA, USA).

Biochemical Analysis Procedure

Blood samples were sent to the Labor Life laboratory (Rio de Janeiro, RJ, Brazil) for serum amylase analysis.

Statistical analysis

Statistical analysis was performed by using GraphPad Prism 6 software (GraphPad Software, La Jolla, CA, USA). Data are expressed as mean ± standard deviation (SD) of the number of experiments. Values from groups were compared by Student’s t-test or Mann–Whitney U test based on the parametric or nonparametric distribution of the continuous variables. P values equal to or less than 0.05 were considered statistically significant.

The impact of systemic inflammation on the brain has already been investigated, but the connection between pancreatitis and brain homeostasis remains unclear. Here we investigatedwhetherpancreatitis could also lead to brain inflammation. Before starting our studies, it was necessary to establish a mild acute pancreatitis induction protocol in rats, avoiding the occurrence of extensive tissue necrosis commonly observed in other models. Animals were divided into two groups: the exploratory laparotomy group (Control Group) and the pancreas ligation surgical procedure-induced pancreatitis group (PLSP).

The animals in the control group 48 hours after laparotomy presented, macroscopically, a slight pancreatic edema (Fig. 2A vs. 2B). Macroscopic pancreatic examination of the PLSP group showed whitish areas, corresponding to cytosteatonecrosis, hemorrhage, and edema. (Fig. 2C vs. 2D). Histological analysis of the control group pancreas showed mild edema and sparse interstitial inflammatory infiltrate (Fig. 2A). On the other hand, acute pancreatitis characterized by parenchymal necrosis, steatonecrosis, hemorrhage foci, and mono- and polymorphonuclear inflammatory infiltrate was observed in the PLSP group, (Fig. 3B and 3C). The occurrence of pancreatitis in rats in the PLSP group was confirmed by measuring serum amylase. A significant increase in serum levels of amylase in the PLSP group when compared to the control group after 48 hours of surgery was observed (Fig. 4).

To investigate the impact of PLSP on the activated microglia population, we have evaluatedIba1 immunohistochemistry staining, an activated microglia marker, in different regions of the hippocampus. The number of Iba1⁺ cells was found increased in CA1, CA3, and dentate gyrus (DG) hippocampus regions of PLSP when compared with the control group (Fig. 5A vs. 5B and Fig. 6). Not only the number of microglial cells (Iba1 + cells expression) washigheracross the entire hippocampus (Fig. 5B, Fig. 6), but they also were with numerous branched processes, compatible with their activated state (inset in Fig. 5B). It was confirmed by analyzing PU.1 expression, a nucleartranscription factor expressed in activated microglial cells.Our results of immunohistochemical assays revealed a significant increase in PU.1 expression in the entire hippocampus of rats in the PLSP group compared to those in the control group (Fig. 7A vs. 7B and Fig. 8).

In order to understand the impact of the systemic inflammatory response induced by acute pancreatitis on brain homeostasis, we evaluated the profile of the proinflammatory cytokines TNF-α, IL-1β, and IFN-γby qRT-PCR assays in the brain.TNF-αmRNAexpression was significantly higher in the PLSP group compared to the control group (Fig. 9). In contrast, IL-1β and IFN-γ mRNA levels were similar in both group PLSP and control. No significant differences were observed in the time of 48 hours after the induction of AP by PLSP (data not shown).

In addition, we studied the NLRP3 inflammasome expression in the whole brain and also in the pancreas from two experimental groups. NLRP3 is a member of the inflammasome family known as NOD-like receptors, which act as important sensors of innate immunity, implicated in the inflammatory response [13]. Moreover, NLRP3 seems to be involved in caspase-1 activation [14]. We investigate whether AP could modulate NLRP3 and caspase-1 expression in the whole brain and pancreas tissue. After molecular analysis, the NLRP3 expression was found significantly increased in the pancreas from the PLSP group compared to the control group (Fig. 10A). Furthermore, we observed that PLSP was able to positively regulate the expression of NLRP3 mRNA in brain tissue (Fig. 10B). PLSP upregulated the NLRP3 mRNA expression in both tissues, which was significantly higher when compared with control groups (Fig. 10A and 10B). In contrast, no significant change in the caspase-1 mRNA levels was observed in the brain of the rats from the PLSP and control groups, but caspase-1 was significantly higher in the pancreatic tissue of the PLSP group compared to the control group (Fig. 11).

We have previously shown that growth factors such as NGF and BDNF are able in modulating microglia phenotype after bacterial nasal challenge [14]. Because of that, we verified whether mRNA levels of these molecules would be presented in different concentrations after pancreatitis-induced. Interestingly, qRT-PCR assays revealed high levels of BDNF mRNAin the brain after systemic inflammation induced by PLSP (Fig. 12A). On the other hand, mRNA NGF levels were significantly higher in the control group compared to the PLSP group (Fig. 12B).

In the present study, we aimed to understand the impact of acute pancreatitis on brain homeostasis. In particular, we investigated whether pancreatitis could change the microglial phenotype to a potentially activated state. Blood-brain barrier permeability is not equal across the whole brain, which is a key point for peripheral and CNS communication [16, 17]. Additionally, Cunningham et al. demonstrated that microglia can be activated by lipopolysaccharide (LPS) peripheral challenge even in healthy brains. In this case, systemic inflammation following the LPS challenge was able to activate not only microglia but astrocytes in animals without the previous neurodegenerative disease [18].

RT-PCR analysis, performed from pancreatic and brain tissue, suggests that AP induction has a possible regulatory role in the levels of inflammasomes (NLRP3 and Casp-1), cytokine (TNF-α), and factors neurotrophic (NGF and BDNF). After molecular analysis, NLRP3 expression was found to be significantly increased in the pancreas of the AP group when compared to the Sham group. Elevated levels of caspase-1 mRNA were also observed in the pancreas of the AP group compared to Sham. Considering the widely known role of these mediators on tissue inflammation, these results suggest that our model of pancreatitis can trigger systemic changes, starting from the pancreatic tissue, with possible consequences for other organs, such as the brain. The profile of the pro-inflammatory cytokines TNF-α, IL-1β, and IFN-α was also evaluated through qRT-PCR assays of pancreatic tissue. The mRNA levels for TNF-α, IL-1β, and IFN-γ were similar between the AP group and the Sham group, with no significant differences being observed at the time 48 hours after AP induction (data not shown). Although we did not detect significant changes in the levels of cytokines considered key molecules in the pathophysiology of pancreatitis, some questions should be considered about our AP model: i) there is no way to determine whether, in the case of mild pancreatitis, induced by PLSP, sufficient tissue damage occurs to promote the production of these investigated cytokines; ii) the evolution times tested in our study after AP induction may not be synchronized with the peak of the release of these cytokines, requiring further evaluations with shorter and/or longer times for a better definition; iii) the possible occurrence of counterregulatory factors responsible for inhibition in the production of these cytokines in this AP model cannot be ruled out.

In order to understand the impact of a systemic inflammatory response, induced by AP, on brain homeostasis, we evaluated the levels of inflammasomes (NLRP3 and Casp-1) and the profile of the pro-inflammatory cytokines TNF-α, IL-1β, and IFN-α by qRT-PCR assays in brain tissue. The NLRP3 inflammasome showed an increase in mRNA levels in the AP group compared to the Sham group. On the other hand, PLSP did not induce any change in Casp-1 inflammasome mRNA levels. Regarding cytokine expression, we found that TNF-α mRNA levels were significantly higher in the PLSP group compared to the control group. The systemic inflammatory response may lead to sickness behavior episodes in patients affected by peripheral inflammation associated with high levels of serum TNF-α [19]. TNF-α plays an important role in peripheral inflammation and cognitive dysfunction, being frequently associated with episodes of behavior change and the progression of neurogenerative diseases [19, 20]. Our results revealed high levels of TNF-α in the brain following the pancreatitis induction, which is in line with previous studies about peripheral and brain crosstalk [20]. Also, TNF-α, which plays a major role among proinflammatory cytokines, is involved in systemic inflammation onset [21]. Although systemic inflammation appears to be involved in the early events of brain inflammation, the crosstalk between pancreas and brain inflammation remains unclear.

The failure to detect changes in mRNA levels in the brain tissue for the Casp-1 inflammasome and for the cytokines IL-1β and IFN-γ may be related to the same factors described above for pancreatic tissue. It should be borne in mind that multiple regulatory pathways dependent on severity, evolutionary time, and the extent of the lesion can alter the expression of these molecules. Thus, other approaches will be necessary in order to test the occurrence of this and other inflammatory mediators more conclusively.

In the AP model developed by us, we showed that the pancreas became inflamed after a PLSP without any exogenous stimulus. Apparently, this AP induction seems to have been able to lead to a systemic inflammatory response. In this sense, inflammation was able to impact microglia cells, changing their morphology into an activated phenotype. We showed microglia cells were found activated in the pancreatitis group, which was confirmed by Ibal⁺ cells across the hippocampus. Microglia cells are essential cells in maintaining brain homeostasis, but their activation can modify neuronal function [22]. Microglia have been implicated in responding to systemic inflammation induced by LPS challenge, and are also involved in neurodegenerative disease [22–24]. Moreover, microglia cells play a major role in neurogenerative disease. Overall, microglia can become activated by a variety of pro-inflammatory molecules after either injury or an immune stimulus. Once activated, microglia can change their phenotype to an inflammatory state known as primed [7]. Primed microglia drive neurons to death by oxidative stress [25, 26]. Activated microglia can be recognized by a transcription factor known as PU.1. PU.1 has been associated with inflammatory profiles in neurogenerative disease as Alzheimer’s disease [19, 27–29]. Gòmez-Nicola et al. showed higher expression of PU.1 mRNA expression in animals affected by neurogenerative diseases [22]. In this work, it was also shown that PU.1 intracellular pathway inhibition reduced the progression of inflammation, followed by a decreased number of neuronal deaths. Here, we showed the highest PU.1 expression in the hippocampus of animals with pancreatitis, which is in line with our results from Iba1 staining also this region. Both Iba1 and PU.1 expressions were significantly increased in all regions of the hippocampus. As expected, microglia were not found primed, because we did not associate pancreatitis with another inflammatory condition. Here, the animals affected by pancreatitis did not have any comorbidity. Microglia usually became primed after a second inflammatory stimulus. For example, during neurodegenerative disease, microglia became activated by proinflammatory molecules delivered in situ. However, if these cells were found activated by proinflammatory molecules delivered into the blood circulation from another inflamed organ (e.g. lung inflammation), microglia will be primed and as a consequence, many neurons will die. Notably, systemic inflammation could accelerate neuronal death in patients affected by neurodegenerative disease [30].

The reduction in NGF levels in the PLSP group supports our hypothesis of a deleterious effect of AP on the CNS, considering that a recent study showed that NGF can regulate the homeostatic activities of microglia. This study points to NGF as a possible neuroprotective agent in pathologies of Aβ accumulation, through the anti-inflammatory activity of this neurotrophin on microglia [31].

A number of recent reports have described a correlation between the effects of BDNF and immunomodulation [32]. Altered levels of BDNF have been reported in the brain and plasma of patients with the most varied types of neurological disorders [33]. A previous study by our group showed a down-regulation of BDNF production in the olfactory bulb of mice infected with S. pneumonia [11]. Despite these studies, the pathophysiological mechanisms mediated by BDNF are still unknown, and a larger number of reports are still needed to better support this correlation between this neurotrophin and neuroinflammation.

Taken together, our results point to the possible existence of a pancreatitis-induced mechanism capable of altering the hippocampal microglia phenotype. Furthermore, a systemic inflammation triggered by AP could interfere with the homeostasis of the CNS microenvironment even in the absence of direct brain damage (Fig. 13). In this sense, it can be predicted that a second inflammatory challenge after AP could exacerbate this pro-inflammatory phenotype in microglia, leading to possible degenerative neuropathologies.

Acknowledgments We thank Claudio Sergio Correa Lau Junior and Dr. Marcus Vinicius Alves da Silva for help with animal care.

Author’s contribution HM-R, FFC, JEFM and WB-d-C conceived of the study. TC-F performed most of the experiments. FFC and TC-F performed the molecular biology experiments. TC-F and AF performed tissue sample preparation and histology protocols. VLNP, HM-R and WB-d-C carried out the histological analysis. PCS, TC-F, JMRE and JEFM developed the model of acute pancreatitis in rats. MMP and WB-d-C conceived of the scheme in figure 13, and MMP drew the images. HM-R and WB-d-C wrote the final version of the manuscript. All authors read and approved the final manuscript.

Funding Financial support for this work was provided by the Graduate Vice-Presidency of Universidade Federal do Rio de Janeiro (CEPG/UFRJ), the Brazilian Council for Science and Technology (CNPq), and the Rio de Janeiro State Foundation for Research Support (FAPERJ).

Conflict of interest The authors declare no confict of interest with regard to the present manuscript.

Ethical approval The experimental protocol was submitted to the Ethics Committee for the Use of Animals in Scientific Experimentation at the Health Sciences Center of the Federal University of Rio de Janeiro (CEUA-CCS-UFRJ- Registration Number: 01200.001568/2013-87), registered with the National Council for the Control of Animal Experimentation (CONCEA) and approved for execution.

Fernandes-Alnemri T, Yu JW, Datta P, et al. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 2009; 458:509–13.
Szelényi J. Cytokines and the central nervous system. Brain Res Bull. 2001;54:329–38.
Malleo G, Mazzon E, Siriwardena AK, et al. Role of tumor necrosis factor-α in acute pancreatitis: From biological basis to clinical evidence. Shock. 2007;28:130–40.
Kreutzberg GW. Microglia: a sensor for pathological events in the CNS. Trends Neurosci. 1996;19:312–8.
Allan SM, Rothwell NJ. Inflammation in central nervous system injury. Philos Trans R Soc B Biol Sci. 2003;358:1669.
Habtezion A, Gukovskaya AS, Pandol SJ. Acute Pancreatitis: A Multifaceted Set of Organelle and Cellular Interactions. Gastroenterology. 2019;156:1941–50.
Gomez-Nicola D, Perry VH. Microglial dynamics and role in the healthy and diseased brain: A paradigm of functional plasticity. Neuroscientist. 2015;21:169–84.
Latz E, Xiao TS, Stutz A. Activation and regulation of the inflammasomes. Nat Rev Immunol. 2013;13:397–411.
Perry VH, Nicoll JAR, Holmes C. Microglia in neurodegenerative disease. Nat Rev Neurol. 2010;6:193–201.
Perry VH. Contribution of systemic inflammation to chronic neurodegeneration. Acta Neuropathol. 2010;120:277–86.
Macedo-Ramos H, Ruiz-Mendoza S, Mariante RM, et al. Streptococcus pneumoniae resists intracellular killing by olfactory ensheathing cells but not by microglia. Sci Rep. 2016;6.
Eulálio JMR, Bon-Habib ACC, de Oliveira Soares D, et al. Critical analysis and systematization of rat pancreatectomy terminology. Acta Cirúrgica Bras. 2016;31:698–704.
Ferrero-Andrés A, Panisello-Roselló A, Roselló-Catafau J, et al. NLRP3 Inflammasome-Mediated Inflammation in Acute Pancreatitis. Int J Mol Sci. 2020;21:5386.
Kelley N, Jeltema D, Duan Y, et al. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci. 2019;20.
Ruiz-Mendoza S, Macedo-Ramos H, Santos FA, et al. Streptococcus Pneumoniae Infection Regulates Expression Of Neurotrophic Factors In The Olfactory Bulb And Cultured Olfactory Ensheathing Cells. neuroscience. 2016;01:016
Lacroix S, Feinstein D, Rivest S. The bacterial endotoxin lipopolysaccharide has the ability to target the brain in upregulating its membrane CD14 receptor within specific cellular populations. Brain Pathol. 1998;8:625–40.
Galea I, Bechmann I, Perry VH. What is immune privilege (not)? Trends Immunol. 2007;28:12–8.
Cunningham C, Wilcockson DC, Campion S, et al. Central and systemic endotoxin challenges exacerbate the local inflammatory response and increase neuronal death during chronic neurodegeneration. J Neurosci. 2005;25:9275–84.
Holmes C, Cunningham C, Zotova E, et al. Systemic inflammation and disease progression in Alzheimer disease. Neurology. 2009;73:768–74.
Hennessy E, Gormley S, Lopez-Rodriguez AB, et al. Systemic TNF-α produces acute cognitive dysfunction and exaggerated sickness behavior when superimposed upon progressive neurodegeneration. Brain Behav Immun. 2017;59:233–44.
Olmos G, Lladó J. Tumor necrosis factor alpha: A link between neuroinflammation and excitotoxicity. Mediators Inflamm. 2014;2014.
Gómez-Nicola D, Fransen NL, Suzzi S, et al. Regulation of Microglial Proliferation during Chronic Neurodegeneration. J Neurosci. 2013;33:2481–93.
Combrinck MI, Perry VH, Cunningham C. Peripheral infection evokes exaggerated sickness behaviour in pre-clinical murine prion disease. Neuroscience. 2002;112:7–11.
De Lucia C, Rinchon A, Olmos-Alonso A, et al. Microglia regulate hippocampal neurogenesis during chronic neurodegeneration. Brain Behav Immun. 2016;55:179.
Jackson TC, Kotermanski SE, Kochanek PM, et al. Oxidative Stress Induces Release of 2’-AMP from Microglia. Brain Res. 2019;1706:101.
Lehmann ML, Weigel TK, Poffenberger CN, et al. The Behavioral Sequelae of Social Defeat Require Microglia and Are Driven by Oxidative Stress in Mice. J Neurosci. 2019;39:5594–605.
Singhrao SK, Harding A, Simmons T, et al. Oral Inflammation, Tooth Loss, Risk Factors, and Association with Progression of Alzheimer’s Disease. J Alzheimer’s Dis. 2014;42:723–37.
Heneka MT, Carson MJ, Khoury J El, et al. Neuroinflammation in Alzheimer’s disease. Lancet Neurol. 2015;14:388–405.
Perry VH, Holmes C. Microglial priming in neurodegenerative disease. Nat Rev Neurol. 2014;10:217–24.
Perry VH, Newman TA, Cunningham C. The impact of systemic infection on the progression of neurodegenerative disease. Nat Rev Neurosci. 2003;4:103–12.
Rizzi C, Tiberi A, Giustizieri M, et al. NGF steers microglia toward a neuroprotective phenotype. Glia. 2018;66:1395.
Lima Giacobbo B, Doorduin J, Klein HC, et al. Brain-Derived Neurotrophic Factor in Brain Disorders: Focus on Neuroinflammation. Mol Neurobiol. 2019;56:3295–312.
Eyileten C, Sharif L, Wicik Z, et al. The Relation of the Brain-Derived Neurotrophic Factor with MicroRNAs in Neurodegenerative Diseases and Ischemic Stroke. Mol Neurobiol. 2021;58:329–47.

Download PDF

Version 1

posted

You are reading this latest preprint version

Microglia activation induced by a rat model of mild acute pancreatitis

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Animals

Surgical procedures

Histological analysis of the pancreas and brain

Quantification of mRNA expression of inflammatory mediators during AP

Immunohistochemistry Assay

Biochemical Analysis Procedure

Statistical analysis

Results

Discussion

Conclusions

Declarations

References

Status:

Version 1